Vol. 173, No. 5

JOURNAL OF BACTERIOLOGY, Mar. 1991, p. 1696-1703 0021-9193/91/051696-08$02.00/0 Copyright © 1991, American Society for Microbiology

Cloning and Characterization of DNA Damage-Inducible Promoter Regions from Bacillus subtilis DAVID L. CHEO, KEN W. BAYLES, AND RONALD E. YASBIN* Program in Molecular and Cell Biology, Department ofBiological Sciences,

University of Maryland, Baltimore County, Baltimore, Maryland 21228 Received 31 August 1990/Accepted 2 January 1991 DNA

damage-inducible (din) genes

in Bacilus sublilis

are

coordinately reguled

and together compose

a

global regilatory network that has been termed the SOS-lke or SOB regulon. To elucidate the mechms of SOB regulation, operator/promoter regios from tree din loci (dHAA, dinB, and dinC of B. subilis were cloned. Operon fusioms construed with these cloned din promoter regions rendered reporter gene damage inducible in B. subis. Induc of all three din promoters was dependent upon a functional RecA protein. Analysis of these fusins bas lzed quences required for damage-inducible expression of the dmA, dm8, and dinC promoters to within 120-, 462-, and 139-bp regios, respectively. Comparison of the nucleo sequeees of these three din promoters with the recA promoter, well with the promoters of other loci associated with DNA repair in B. subiis, has Identified the consensus sequence GAAC-N4-GITC as a putative SOB operator site. as

Inducible DNA repair systems, such as the SOS system, have been most extensively studied with the gram-negative enteric bacterium Escherichia coli (16, 41). Regulation of the SOS system in E. coli is controlled by the products of the recA and lexA genes. The RecA protein has many functions in E. coli and is involved in the processes of recombination, DNA repair, and mutagenesis (31, 41, 45). The LexA protein is a repressor of as many as 20 unlinked, coordinately regulated loci which include the recA and lexA genes themselves (19, 41). Following exposure of E. coli to agents that alter DNA structure or interfere with DNA replication (such as UV radiation, mitomycin, nalidixic acid, etc.), an inducing signal is generated. The signal (believed to consist, in part, of single-stranded DNA) reversibly activates the RecA protein. Activated RecA protein has apoprotease activity which facilitates the autocatalytic cleavage of LexA repressor (17, 18), certain lambdoid prophage repressors (4, 7, 17, 34, 35), and the UmuD protein (2, 39). As levels of LexA repressor decline, damage-inducible loci are derepressed, resulting in expression of 'the physiological phenomena that compose the SOS response (16, 41). The SOS system of E. coli has served as a model for the study of similar inducible DNA repair systems in other gram-negative bacteria (14, 36, 37, 43, 44). Similarly, the SOS system has been used as a model to study the SOS-like, or SOB, system of the gram-positive soil bacterium Bacillus subtilis (21). Like E. coli, B. subtilis responds to agents that damage DNA or interfere with DNA replication by inducing a coordinately regulated set of diverse physiological phenomena (21). Phenomena associated with the SOB response in B. subtilis include induction of DNA damage-inducible (din) loci, including the recA gene (formerly referred to as the recE gene), enhanced capacity for DNA repair, enhanced mutagenesis, Weigle (W) reactivation, prophage induction, and filamentation (21). While these analogous systems in E. coli and B. subtilis appear similar, significant functional and regulatory differences do exist. For instance, W reactivation in B. subtilis is pyrimidine dimer specific (8)

as

and essentially error free (7a). This contrasts with W reactivation in E. coli, which is capable of repairing a variety of DNA lesions by an error-prone mechanism (32). Furthermore, while induction of all SOS phenomena in E. coli is dependent upon a functional RecA protein, filamentation in B. subtilis is a RecA-independent response (21). Finally, the SOB system in B. subtilis is developmentally regulated. As B. subtilis differentiates into the physiological state of natural competence (6), SOB phenomena are spontaneously induced in the absence of externally generated DNA damage (20, 23, 47, 49, 50). DNA damage-inducible loci in B. subtilis were first identified by using transposon-mediated gene fusions (20). Tn917-lacZ transposon insertions within din loci were isolated from a library of insertions by selecting those fusions that induced expression of the lacZ reporter gene after exposure to DNA-damaging agents (20). Fifteen independently isolated din gene transposon insertions were genetically mapped and localized to three loci (dinA, dinB, and dinC) on the B. subtilis chromosome (11). As mentioned above, induction of all three din loci was demonstrated to be dependent upon a functional RecA protein (20). In order to elucidate the mechanisms that regulate damage-inducible gene expression in B. subtilis, we have cloned and sequenced DNA fragments that contain the dinA, dinB, and dinC promoter regions. Described here is our initial characterization of these cloned din promoter regions and the identification of a putative SOB operator sequence. (This research was conducted in partial fulfillment of the requirements for a Ph.D. degree by David L. Cheo at the University of Maryland, Baltimore County, Baltimore, Md.) MATERIALS AND METHODS Strains, plasmids, and bacteriophage. All B. subtilis strains used in this study are listed in Table 1. Plasmid and bacteriophage constructs are listed and described in Table 2. The plasmid pPL703C2 (15) replicates in B. subtilis, maintaining 30 to 50 copies per genome (13), and expresses constitutive neomycin resistance. Promoter fragments subcloned into the EcoRI and BamHI cloning sites of pPL703C2 drive expres-

* Corresponding author. 1696

VOL. 173,

1991

DAMAGE-INDUCIBLE REGULATION IN B. SUBTILIS

1697

TABLE 1. B. subtilis strains Strain

YB886a YBA886b YB1015C

Source or

Characteristics

metBS trpC2 xin-J SP1- amyE trpC2 xin-l SP[- amyE+ metB5 trpC2 recA4

48 B. M. Friedman 10

din: :Tn9J7-lacZ transposon insertion strainsd YB5076 YB5176 YB5007 YB5107 YB5017 YB5117 YB5001 YB5101 YB5021 YB5121 YB5018 YB5118

YB886 dinA76::Tn917-IacZ YB886 dinA76: :Tn9J7-lacZ: :pTV21A2 YB886 dinB7::Tn917-1acZ YB886 dinB7::Tn9J7-lacZ::pTV21A2 YB886 dinC17::Tn9J7-lacZ YB886 dinCJ7::Tn9J7-lacZ::pTV21A2 YB886 dinCl::Tn9J7-1acZ YB886 dinCI::Tn917-1acZ: :pTV21A2 YB886 dinC21::Tn917-1acZ YB886 dinC2l::Tn9J7-lacZ::pTV21A2 YB886 dinCJ8::Tn9J7-lacZ YB886 dinCJ8::Tn917-lacZ::pTV21A2

20 This work 20 This work 20 This work 20 This work 20 This work 20 This work

Strains carrying pPL703C2 derivativese YB5200 YB5276 YB5376 YB5207 YB5307 YB5217 YB5317 YB5218 YB5318

YB886(pPL703C2) YB886(pCATA76) YB1015(pCATA76) YB886(pCATB7) YB1O15(pCATB7) YB886(pCATC17) YB1O15(pCATC17) YB886(pCATC18) YB1015(pCATC18)

This This This This This This This This This

work work work work work work work work work

amyE::din lacZ fusion strainsf YB5476 YB5576 YB5676 YB5776 YB5876 YB5417

YBA886 amyE::pDCA1600 YBA886 amyE::pDCA1200 YBA886 amyE::pDCA900 YBA886 amyE::pDCA280 YBA886 amyE::pDCA120 YBA886 amyE::pDCC139

This This This This This This

work work work work work work

Repair-proficient parent strain. Amylase-producing transformant of YB886. c Repair-deficient transformant of YB886. d Transposon insertions were originally isolated and described by Love et al. (20). The transposon encodes MLS resistance, which is replaced by Cmr in strains containing pTV21A2 sequences. edin promoter fusions to the cat-86 reporter gene were constructed in pPL703C2 (15); this plasmid replicates in B. subtilis, maintaining 30 to 50 copies per genome (13). f din promoter fusions to the lacZ reporter gene were constructed in pAF1 (9), generating the pDC plasmids, which were integrated into the amyE locus. a

b

sion of a chloramphenicol acetyltransferase (CAT) reporter gene (cat-86). The plasmid pAF1 (9) contains amyE sequences which are disrupted by a complete cat gene and a promoterless lacZ reporter gene. Although pAF1 does not replicate in B. subtilis, chloramphenicol-resistant (Cm') transformants can be isolated after integration of the plasmid into the bacterial chromosome. Promoter fragments subcloned into the EcoRI and HindIII cloning sites of pAF1 drive expression of the lacZ reporter gene. Media and growth conditions. B. subtilis strains were maintained on tryptose blood agar base medium, and liquid cultures were grown in antibiotic medium 3 (Difco Laboratories, Detroit, Mich.) with aeration at 37°C unless otherwise stated. Chloramphenicol (2.5 to 20 ,ug/ml), kanamycin (5

jig/ml), erythromycin (1 ,ug/ml), lincomycin (25 ,g/ml), mitomycin (15 to 500 ng/ml), and 4-methylumbelliferyl 1-Dgalactoside (MUG) (20 ,g/ml) (Sigma Chemical Co., St. Louis, Mo.), were added as specified. E. coli strains were grown on Luria agar or in Luria broth. Ampicillin (50 jig/ml) and 5-bromo-4-chloro-3-indolyl-i-D-galactopyranoside (X-

Gal) (30 jig/ml) (Bethesda Research Laboratories, Gaithersburg, Md.), were added as required. DNA manipulations. Isolation of chromosomal DNA (48) and transformation of B. subtilis (50) were performed as previously described. Plasmid DNA was isolated by the alkaline lysis method (26), and DNA was sequenced by the dideoxy-chain termination method (33). DNA endonucleases (restriction enzymes) and T4 DNA ligase (Promega, Madison, Wis.) were used according to the manufacturer's instructions. Regions of the B. subtilis chromosome upstream of the different din::Tn9J7-lacZ transposon insertions were cloned by the methods of Youngman et al. (51-54). Essentially, the plasmid pTV21A2 (53) encodes resistance to chloramphenicol and contains the origin of replication and ampicillin resistance determinant from pBR322. Flanking these sequences are the proximal and distal ends of the transposon Tn917. Derivatives of strain YB886 carrying din::Tn9J7-lacZ transposon insertions were transformed to Cmr with XbaIlinearized pTV21A2 DNA. The linearized plasmid aligns by

1698

CHEO ET AL.

J. BACTERIOL. TABLE 2. Plasmids and bacteriophages

Plasmid or

bacteriophage

Chtti

aractenstics

Source or reference

Plasmids pTV21A2 pDINA76a pDINB7a pDINC17a pDINC1a pDINC21a pDINC18a pPL703C2 pCATA76 pCATB7 pCATC17 pCATC18 pUC18 pUCDINA120 pAFl pDCA120 pDCA280 pDCA900 pDCA1200 pDCA1600 pDCC139

Ampr and pBR322 replicon; Cmr and pE194 replicon Plasmid rescue from a partial EcoRI digest of YB5176 DNA Plasmid rescue from a Hindlll digest of YB5107 DNA Plasmid rescue from an EcoRI digest of YB5117 DNA Plasmid rescue from an EcoRI digest of YB5101 DNA Plasmid rescue from an EcoRI digest of YB5121 DNA Plasmid rescue from an EcoRI digest of YB5118 DNA Neor, pUBilO replicon, promoterless cat-86 pPL703C2 with 2,500-bp EcoRl fragment from pDINA76 pPL703C2 with 753-bp Sau3AI-BamHI fragment from pDINB7 pPL703C2 with 461-bp EcoRI-BamHI fragment from pDINC17 pPL703C2 with 836-bp EcoRI-BamHI fragment from pDINC18 Ampr and pMB1 replicon pUC18 with 120-bp PvuII-Sau3AI dinA fragment Ampr and pBR322 replicon; Cmr, amyE::lacZ fusion vector pAFI with EcoRI-HindIII fragmeit from pUCDINA120 pAFl with EcoRI-HindIII fragment from M13DINA280 pAFl with 900-bp HindIII fragment from M13DINA900 pAFl with 1,200-bp HindIII fragment from M13DINA1200 pAFl with 1,600-bp HindIII fragment from M13DINA2900 pAFi with EcoRI-HindIlI fragment from M13DINC138

53 This work This work This work This work This work This work 15 This work This work This work This work 46 This work 9 This work This work This work This work This work This work

Bacteriophages M13mpl9 M13DINA2900 M13DINA2500 M13DINA1200 M13DINA900 M13DINA280 M13DINB7 M13DINC139 M13DINC17 M13DINC1 M13DINC21 M13DINC18

Filamentous E. coli bacteriophage M13mpl9 with 2,900-bp EcoRI-BamHI fragment from pDINA76 M13mpl9 with 2,500-bp EcoRl fragment from pDINA76 M13mpl9 with 1,200-bp HindlIl fragment from pDINA76 PstI-digested and religated M13DINA1200 M13mpl9 with 280-bp PstI-HindIII dinA fragment M13mpl9 with EcoRI-BamHI fragment from pCATB7 M13mpl9 with 168-bp TaqI fragment from pDINC17 M13mpl9 with 461-bp EcoRI-BamHI fragnent from pDINC17 M13mpl9 with 514-bp EcoRI-BamHI fragment from pDINC1 M13mpl9 with 655-bp EcoRI-BamHI fragment from pDINC21 M13mpl9 with 836-bp EcoRI-BamHI fragment from pDINC18

27 This work This work This work This work This work This work This work This work This work This work This work

a The pDIN plasmids were isolated using the method of Youngman et al. (53) to clone chromosomal DNA flanking Tn917-lacZ transposon insertions by using pTV21A2. Plasmids were generated from intramolecular ligations of chromosomal DNA digested with either EcoRI or HindUI and used to transform E. coli.

homology to the proximal and distal ends of the Tn9J7-lacZ transposon and integrates into the transposon by double homologous recombination. This event replaces transposon sequences encoding macrolide-lincosamide-streptogramin B (MLS) resistance with plasmid sequences resulting in Cmr, MLS-sensitive transformants that maintain the damage-inducible lacZ phenotype. Chromosomal DNA from these insertion strains was digested with either EcoRP or Hindlll and was ligated under conditions favoring intramolecular ligation. The ligated DNA was used to transform E. coli JM109 to ampicillin resistance by electroporation with a Bio-Rad Gene Pulser, as specified by the manufacturer. The resulting pDIN series of plasmids is described in Table 2. A 2.5-kb EcoRl fragment from pDINA76, a 753-bp Sau3AI-BamHI fragment from pDINB7, a 461-bp EcoRIBamHI fragment from pDINC17, and an 836-bp EcoRIBamHI fragment from pDINC18 were subcloned into pPL703C2, resulting in pCATA76, pCATB7, pCATC17, and pCATC18, respectively. These plasmids were then used to transform the B. subtilis strains YB886 (recA+) and YB1015 (recA4) to neomycin resistance (Neor). The resulting transformants (Table 1) were each assayed for CAT activity in the presence and in the absence of mitomycin as described below. DNA fragments that generated damage-inducible

promoter activity were subcloned into M13mpl9 and se-

quenced.

Various restriction fragments of the cloned dinA76 proregion were subcloned into the E. coli bacteriophage M13mpl9 (Table 2). These subclones were then used to isolate the 1,600-, 1,200-, and 900-bp HindlIl fragments, which were cloned into pAF1, generating pDCA1600, pDCA1200, and pDCA900, respectively. In addition, a 280-bp PstI-HindIII fragment was cloned into M13mpl9, generating M13DINA280. This fragment was reisolated by digestion of M13DINA280 with EcoRI and HindIlI and then cloned into pAFl generating pDCA280. Similarly, a 120-bp PvuII-Sau3AI fragment was cloned into the SmaI and BamHI sites of pUC18, resulting in pUCDINA120. This fragment was reisolated by digestion of pUCDINA120 with EcoRI and HindIII and then cloned into pAF1, resulting in pDCA120. The pDCA1600, pDCA1200, pDCA900, pDCA280, and pDCA120 plasmids were each used to transform YBA886 (the amyE+ parental strain) to Cmr, generating YB5476, YB5576, YB5676, YB5776, and YB5876, respectively. Integration at the amyE locus was identified by plating on tryptose blood agar base medium containing 2% starch (soluble potato starch; J. T. Baker Inc.) and screening for the inability to hydrolyze starch. Southern analysis (data moter

VOL. 173,

1991

DAMAGE-INDUCIBLE REGULATION IN B. SUBTILIS

not shown) was used to verify that the plasmids had integrated at the amyE locus and not at the dinA locus. Similarly, a 168-bp TaqI fragment from pDINC17 was cloned into M13mpl9 and then reisolated on an EcoRI-HindIII fragment that was cloned into pAF1, resulting in pDCC139. This plasmid was used to transform YBA886 to Cmr, and an amyE transformant (YB5417) was selected for further study. CAT assay. Qualitative CAT activity (resistance to chloramphenicol) was assayed by observing growth on solid medium consisting of nutrient broth 2 and purified agar (Oxoid Ltd., Basingstoke, United Kingdom) supplemented with 10 to 20 ,ug of chloramphenicol per ml with or without 15 ng of mitomycin per ml. CAT specific activity was quantitated from cultures grown in nutrient broth 2 supplemented with 0.1% yeast extract. Cells were grown with aeration at 37°C to early exponential phase (50 Klett units [KU]; Klett-Summerson colorimeter; filter no. 66; 1 KU = 1 x 106 CFU/ml) and then divided. Mitomycin (500 ng/ml) was added to one sample, and the cultures were incubated as before for 2 h. The cultures were then centrifuged at 4,000 x g for 10 min at 4°C. The cell pellets were resuspended in CAT buffer (0.1 M Tris hydrochloride [pH 7.8], 0.1 mM dithiothreitol) and centrifuged as before. The cells were then resuspended in CAT buffer containing 1 mg of lysozyme per ml and 0.75 mg of phenylmethylsulfonyl fluoride per ml, incubated at 37°C for 30 minutes, and sonicated (three 5-s bursts at maximum setting) on ice. The cell extracts were centrifuged at 10,000 x g for 15 min at 4°C to remove debris and were assayed spectrophotometrically by the procedure of Shaw (38). Protein determinations were performed by the method of Bradford (la). CAT specific activity was expressed as micromoles of chloramphenicol acetylated per minute per milligram of protein.

,I-Galactosidase assay. Qualitative ,-galactosidase activity

assayed by observing fluorescence of bacteria (under long-wave UV light) grown on solid medium consisting of nutrient broth 2, purified agar, and 20 ,ug of MUG per ml with or without 50 ng of mitomycin per ml. ,-Galactosidase specific activity was quantitated from cultures grown in nutrient broth supplemented with 0.1% yeast extract. The cultures were grown with aeration at 37°C to early exponential phase (50 KU), an aliquot was removed from each culture, and the cultures were divided. Mitomycin (500 ng/ml) was added to one sample, and aliquots were taken was

from each culture after 1 and 2 h of further incubation. The cells were centrifuged at 4,000 x g for 10 min at 4°C, washed for Z buffer (28), resuspended in Z buffer containing 1 mg of lysozyme per ml, and incubated for 30 min at 37°C. The cell extracts were centrifuged at 10,000 x g for 15 min at 4°C to remove debris and assayed for ,-galactosidase activity as described by Miller (28).

RESULTS

Cloning of damage-inducible promoter regions. Three DNA damage-inducible loci (dinA, dinB, and dinC) of B. subtilis had previously been identified and were genetically mapped (11). In order to elucidate the mechanisms that control damage-inducible regulation in B. subtilis, the operator/ promoter regions of these three din loci were cloned and characterized. Regions of the bacterial chromosome upstream of din::Tn917-lacZ transposon insertions were cloned in E. coli by the strategy of Youngman et al. (53, 54). The resulting pDIN series of plasmids is diagrammed in Fig. 1. To determine whether the cloned regions of B. subtilis DNA contained damage-inducible promoters, DNA fragments

1699

1.0 Kb

R

H

Sp

H

P H R T

SmBS

R

pDINA76 L

E i ' H Sa

SmBS

T

R

pDINB7

H

a

RT T

pDINC

SmBS

R

1 7 SmBS

T

RT

pDINC1

I RT

R

L T

a

SmBS

R

pDINC21

a RT

T

SmBS

R

pDINC1 am FIG. 1. Restriction maps of B. subtilis chromosomal DNA upstream of din::Tn917-IacZ transposon insertions cloned in E. coli. The arrows represent Tn917-lacZ sequences and the orientation of the promoterless lacZ gene. Vector sequences derived from pTV21A2 are not drawn to scale and include the origin of replication (A) and ampicillin resistance (amp) determinant from pBR322 and a chloramphenicol resistance determinant (cat). DNA regions marked by thick lines represent subcloned fragments that generate damageinducible promoter activity in the pCAT plasmids. Restriction sites: R, EcoRI; H, HindIII; P, PstI; B, BamHI; S, Sall; Sa, Sau3AI; Sm, SmaI; Sp, SphI; T, TaqI.

from the pDIN plasmids were used to construct operon fusions to the cat-86 reporter gene in pPL703C2. The resulting pCAT series of plasmids is listed and described in Table 2. Promoter activity generated from each pCAT construct in B. subtilis YB886 (recA+) and YB1015 (recA4) was assayed by monitoring the expression of the cat-86 reporter gene in the presence or absence of mitomycin. Each of the pCAT constructs rendered expression of the cat-86 reporter gene damage inducible in YB886. The dinA, dinB, and dinC promoter regions were thus localized to the DNA fragments that are indicated in Fig. 1. CAT specific activities generated in B. subtilis strains carrying each of the pCAT constructs are reported in Table 3. Treatment with mitomycin induced CAT specific activity TABLE 3. CAT specific activity in B. subtilis YB886 (recA+) and YB1015 (recA4) carrying pCAT plasmids Strain

YB5200 YB5276 YB5376 YB5207 YB5307 YB5217 YB5317 YB5218 YB5318

recA allele

recA+

recA+ recA4 recA+ recA4

recA+ recA4 recA+ recA4

CAT sp acta Plasmid

pPL703C2c pCATA76 pCATA76 pCATB7 pCATB7 pCATC17 pCATC17 pCATC18 pCATC18

Without

With

mitomycin

mitomycin

0.012 0.287 0.185 0.020 0.050 0.018 0.026 0.035 0.040

0.012 1.364 0.282 0.274 0.040 0.434 0.022 1.39 0.038

Induction ratiob

1.0 4.8 1.52 13 0.80 23 0.85 36 0.95

a Cell extracts were prepared and assayed after a 2-h exposure to 500 ng of mitomycin per ml. CAT specific activity is reported as micromoles of chloramphenicol acetylated per minute per milligram of protein. The CAT specific activities reported for each strain are results from one experiment. Comparable induction ratios were obtained for each strain from repetitions of the experiment. b Induction ratios are expressed as induced activity/uninduced activity. c pPL703C2 (15) is the parent vector used to generate the pCAT series of plasmids, which maintain 30 to 50 copies per genome (13).

J. BACTERIOL.

CHEO ET AL.

1700

1.0 kb R

H

Sp

H

P H R SmB S M %"

H

P H R Sm BXSPSpH

_ _

'

pDC1600 H

P

DamageInduction

GATTGTCGATTCTTCATTTTTTACTATIACAGATCAGATGAAGAATCCCTG&AAQ

61

TTTTTGATTACAAAAGCCGTTTTTGCATTGTTTTTCCCTTTTATGCTTGTTGTTCTATTT

121

ACTAGAGTCACCTTTAATCATTATGTGGCGATCGCTTTAACAGCTGCATTGCTGTTTGCC

181

TCTTATTTAAAAGGCTATACAGAAACGTATTTTATTGTAGGATTGGATGTTGTGTCTCTT

241

GTGGCTGGCGGACTGTATATGGCCAAAAAAGCGCAGAGAAAAAAGAAGAATAAATCGGA

301

CATAATGAATATAAAGACTGAATACCTGCTTTTACGTTTTAAAAGCAGGTTTTTTATACA

361

CAAAAACAGCTGGAAATAAAAAACCACCGAACTTAGTTCGTArTTTTAGTGATTTTGCT

421

TTCCATTGTGTTACTATATCTATAGGAAGATTTCGTTAAAGAAACGGAGGCTTATTTTT

480

GTGAAAGATCGCTTTGAGTTAGTCTCGAAATATCAGCCCCAGGGAGATCAGCCGAAAGCC

540

ATTGAA&AG=GTGAAAGGAATTCAGGAGGGCAAGAAGCATCAGACTCTGCTGGGTGCA

600

ACAGGAACTGGGAAAACATTTACGGTGTCCAATTTGATTAAAGAAGTCAAT d inA76

M

+

T

H

pDC1 200

+ H

pDC900

PSpH

II

pDC280

H

1I U

R L A

+

RSsK(SnVPv) (Sa/B)SXPSpH

pDC120

Y S

RSsKSmBSXP

I V

K G

T

T G G

in cultures of YB886 (recA+) carrying the dinA (pCATA76), dinB (pCATB7), and dinC (pCATC17 and pCATC18) promoter constructs by 4.8-, 13-, 24-, and 36-fold, respectively, over untreated cultures. Damage-inducible CAT activity from these same din promoter constructs was abolished in the recA4 (YB1015) genetic background. In addition, the pCAT plasmids were isolated from the YB1015 derivatives and reintroduced into YB886, where they once again generated damage-inducible CAT activity. Induction of each cloned din promoter is thus dependent upon a functional recA+ gene product. The dimA promoter region. In order to localize the dinA promoter, various restriction fragments from pDINA76 were used to construct operon fusions to the lacZ reporter gene within the B. subtilis integration vector pAF1. The resulting pDCA plasmids (Fig. 2) were then integrated into the amyE+ locus of B. subtilisYBA886 (amyE+ recA+), and the resultant amyE transformants were assayed for damage-inducible expression of the lacZ reporter gene. The pDCA1600, pDCA1200, pDCA280, and pDCA120 dinA promoter fusion constructs all generated similar levels of damage-inducible 3-galactosidase activity after a 2-h exposure to 500 ng of mitomycin per ml (Fig. 2). pDCA900 generated relatively weak promoter activity and did not significantly induce 3-galactosidase activity after the same exposure to mitomycin. The DNA sequences required for damage-inducible expression from the dinA promoter have thus been localized to a 120-bp PvuII-Sau3AI fragment. The nucleotide sequence of the dinA promoter region was determined (Fig. 3). A putative ribosome binding site and sequences similar to sigma A promoter elements (29, 30) were identified. Two open reading frames flank the dinA promoter region. Immediately downstream of the dinA promoter are 57 codons of an open reading frame that is disrupted by the Tn917-lacZ transposon insertion. The amino acid sequence of this open reading frame is 50%

K

F Y L

A

N T

Y

V

H

E M

F

Y T

A

A V

Y K

L

A F K

F

I

F

A

P

L

I V G PstI A

A

E

F

T L K

M

A D K

L

A V

E

I T

K E

G

D R F HindIII K

T

L

G

L V

E

V

L S

L

F L

F

A V


A TGTTCAAAACAGAACAAGTGTTCTTTTTTCTAIT§GM

V

locus of B. subtilis (data not shown). This construct contains a 168-bp TaqI fragment from pDINC17 which includes 29 bp of the transposon (Fig. 1). Sequences required for damageinducible expression of the dinC promoter have thus been localized to a 139-bp region (nucleotides 30 to 168 [Fig. 7]). Identification of a putative SOB operator sequence. The nucleotide sequences of the dinA, dinB, and dinC promoter regions were examined and compared with the nucleotide sequence of the recA promoter region. Conserved sequences were identified within all of the din promoter regions thus far examined. The consensus sequence GAAC-N4-GTTC is positioned at -50 within the dinA and dinC promoters and at -20 within the dinB promoter, relative to putative transcription initiation sites. Similar sequences were also identified at -102 (AAAC-N5-GTTC) within dinB; at -20 (GAAC-N4GTTT) within dinC; and at -110 (AAAC-N4-TTTC), -50 (GAAT-N4-GAAC), and +80 (GAAA-N4-GTTC) within recA (40). A comparison of the consensus sequences found within each of the promoter regions described above is shown in Fig. 8. Included in this list are similar sequences identified within the promoter regions of the B. subtilis uvrB gene (3) and dnaX operon (1) which are known to express proteins involved in DNA repair. Damage-inducible expres-

--

-35

61

A

dinB7

FIG. 5. DNA sequence of the dinB7 promoter region from the Sau3AI restriction site to the Tn917-lacZ transposon insertion. An open reading frame encoding 28 amino acids that extends into transposon sequences is indicated by the single-letter amino acid code. Putative sigma A promoter elements, a ribosome binding site (RBS), and the Sau3AI restriction site are marked and underlined. The arrows indicate a small region of dyad symmetry. The consensus sequences discussed in the text are indicated in boldface type.

dinC17

EcoRI TaqI GAATTCAAGCCAAAATTTATTGAATTTCAz9AhAATTTAATAAGCTAAATGATGACACT

GAAAGCTATACACACGAA

K

1701

dnaX Juan Alonso

&C -N4 -9FIRC -20

GTGAACCA12QAQAA& AAC§eXAGTGTTA-AACTGGAAA -20

AGAGCTTZTTGGATCO&MCAAG§X2ATGTATAATGGGAAT

FIG. 8. Consensus sequence found common to all din promoter regions thus far examined in B. subtilis. Also listed are the promoter regions from the B. subtilis uvrB gene and dnaX operon. Positions relative to putative transcription initiation sites are indicated. Putative sigma A promoter elements are underlined.

1702

CHEO ET AL.

have cloned and characterized three DNA damage-inducible promoters from B. subtilis. The cloning and characterization of operator/promoter regions that control DNA damage-inducible expression in B. subtilis has provided important information about the nature of SOB regulation. Sequences required for damage-inducible regulation in B. subtilis have been localized to 120 bp of the dinA promoter region, 460 bp of the dinB promoter region, and 139 bp of the dinC promoter region (Fig. 3, 5, and 7, respectively). Operon fusions constructed with each of these promoter fragments rendered reporter genes damage inducible in B. subtilis. Induction of each din promoter was dependent upon a functional RecA protein (formerly called RecE protein). The following observations support the hypothesis that this regulation is controlled at the level of transcription. The dinC17 insertion, which is damage inducible, separates the entire open reading frame from the dinC promoter; also, mRNA transcripts from the dinC17 promoter construct in pCATC17 are induced in B. subtilis after exposure to mitomycin (unpublished results). Sequence comparisons of din promoters in B. subtilis have identified the consensus sequence GAAC-N4-GTTC. This consensus sequence is positioned within din promoter regions such that a regulatory molecule bound at these sites could interfere with the initiation of transcription by RNA polymerase. We propose that this consensus sequence functions as an SOB operator site to regulate expression of din genes in B. subtilis. This sequence is centered at position -50 within the dinA and dinC promoters and at -20 within the dinB promoter, relative to putative transcription initiation sites. Similar sequences that match the consensus in at least six of eight positions have been identified at other locations within the dinB, dinC, and recA promoter regions (Fig. 8). Recent work in Guilldn's laboratory has determined that the rec-70 locus of B. subtilis is also DNA damage inducible and contains a sequence that is similar (seven matches out of eight positions) to the putative SOB operator site and is positioned at -20 relative to the putative transcription initiation site (13a). Sequences similar to the consensus (seven matches out of eight positions) were also identified at the -20 position within the uvrB gene and dnaX operon, which are loci in B. subtilis that are known to express gene products involved in DNA repair processes. The binding of a repressor to slightly different operator sequences with different affinities might serve to fine-tune the SOB response. Furthermore, the presence of multiple operators at distant sites within one promoter region suggests a cooperative loop model of repression such as has been described for the lac, gal, and ara systems of E. coli (12). The putative SOB operator sites are positioned between the -35 and -10 promoter elements of dinB and dinC and positioned upstream of the -35 promoter element within dinA and recA (Fig. 8). We speculate that a repressor molecule bound upstream of the -35 promoter element might not interfere with the initiation of transcription by RNA polymerase as much as a repressor bound between the -35 and -10 promoter elements. This hypothesis is consistent with the relatively low levels of expression generated by the uninduced dinB and dinC promoters and the 10-foldhigher basal level of expression generated by the dinA promoter (Table 3). It is also consistent with the relatively high basal level of RecA expression that has been observed on Western immunoblots (24). Overexpression of E. coli RecA protein can complement the deficiency in din gene induction in strains of B. subtilis

J. BACTERIOL.

carrying the recA4 mutation (5, 22). In addition, RecA of B. subtilis can facilitate the inactivation of LexA repressor in vitro (25). These results demonstrate a high degree of functional conservation between RecA of E. coli and RecA of B. subtilis and suggest that a LexA-like repressor exists in B. subtilis. B. subtilis din promoters within both the pDIN and pDC plasmids produce constitutive 0-galactosidase activity in E. coli. This activity was observed as a dark blue coloring on solid media containing X-Gal and is consistent with the lack of LexA-binding sites within these promoter regions. The putative SOB repressor thus recognizes and binds to an operator sequence that is different from the LexA box of E. coli. It will be interesting to determine whether the SOB consensus sequence has been conserved among other gram-positive bacteria. Further molecular characterization of these cloned din promoters is under way. ACKNOWLEDGMENT This research was supported by Public Health Service grant R01DE08506 from the National Institutes of Health. REFERENCES 1. Alonso, J. Personal communication. la.Bradford, M. M. 1976. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. 2. Burckhardt, S. E., R. Woodgate, R. H. Scheuermenn, and H. Echols. 1988. The UmuD protein of E. coli: overproduction, purification and cleavage by RecA. Proc. Natl. Acad. Sci. USA 85:1811-1815. 3. Chen, N., J. Zhang, and H. Paulus. 1989. Chromosomal location of the Bacillus subtilis aspartokinase II gene and nucleotide sequence of the adjacent genes. J. Gen. Microbiol. 135:29312940. 4. Craig, N. L., and J. W. Roberts. 1981. Function of nucleoside triphosphate and polynucleotide in Escherichia coli recA protein-directed cleavage of phage lambda repressor. J. Biol. Chem. 256:8039-8044. 5. De Vos, W. M., and G. Venema. 1983. Cloning and expression of the Escherichia coli recA gene in Bacillus subtilis. Gene 25:301308.

6. Dubnau, D. 1989. The competence regulon of Bacillus subtilis,

p. 147-166. In I. Smith, R. A. Slepecky, and P. Setlow (ed.), Regulation of procaryotic development: a structural and functional analysis of bacterial sporulation and germination. American Society for Microbiology, Washington, D.C. 7. Eguchi, Y., T. Ogawa, and H. Ogawa. 1988. Cleavage of bacteriophage 480 cI repressor by RecA protein. J. Mol. Biol. 202:565-573. 7a.Fields, P. I. 1982. Ph.D. thesis. Pennsylvania State University, University Park. 8. Fields, P. I., and R. E. Yasbin. 1983. DNA repair in Bacillus subtilis: an inducible dimer specific W-reactivation system. Mol. Gen. Genet. 190:475-480. 9. Fouet, A., and A. L. Sonenshein. 1990. A target for carbon source-dependent negative regulation of the citB promoter of Bacillus subtilis. J. Bacteriol. 172:835-844. 10. FrIdman, B., and R. E. Yasbiln. 1983. The genetics and specificity of the constitutive excision repair system of Bacillus subtilis. Mol. Gen. Genet. 190:481-486. 11. Gillespke, K., and R. E. Yasbin. 1987. Chromosomal locations of three Bacillus subtilis din genes. J. Bacteriol. 169:3372-3374. 12. Grafla, J. D. 1989. Bacterial gene regulation from distant sites. Cell 57:193-195. 13. Gryczan, T. J., S. Contente, and D. Dubnau. 1978. Characterization of Staphylococcus aureus plasmids introduced by transformation into Bacillus subtilis. J. Bacteriol. 134:318-329. 13a.GuIl6n, N. Personal communication. 14. Keener, S. L., K. P. McNamee, and K. McEntee. 1984. Cloning and characterization of recA genes from Proteus vulgaris,

VOL. 173, 1991

Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r. J. Bacteriol. 160:153-160. 15. Laredo, J., V. L. Wolff, and P. S. Lovett. 1988. Chloramphenicol acetyltransferase specified by cat-86: relationship between the gene and the protein. Gene 73:209-214. 16. Little, J., and D. Mount. 1982. The SOS regulatory system of Escherichia coli. Cell 29:11-22. 17. Little, J. W. 1984. Autodigestion of LexA and phage lambda repressors. Proc. Natl. Acad. Sci. USA 81:1375-1379. 18. Little, J. W., S. H. Edmiston, L. Z. Pascelli, and D. W. Mount. 1980. Cleavage of the Escherichia coli LexA protein by the RecA protease. Proc. Natl. Acad. Sci. USA 77:3225-3229. 19. Little, J. W., D. W. Mount, and C. R. Yanisch-Perron. 1981. Purified LexA protein is a repressor of the recA and lexA genes. Proc. Natl. Acad. Sci. USA 78:4199-4203. 20. Love, P. E., M. J. Lyle, and R. E. Yasbin. 1985. DNA damageinducible (din) loci are transcriptionally activated in competent Bacillus subtilis. Proc. Natl. Acad. Sci. USA 82:6201-6205. 21. Love, P. E., and R. E. Yasbin. 1984. Genetic characterization of the inducible SOS-like system of Bacillus subtilis. J. Bacteriol. 160:910-920. 22. Love, P. E., and R. E. Yasbin. 1986. Induction of the Bacillus subtilis SOS-like response by the Escherichia coli RecA protein. Proc. Natl. Acad. Sci. USA 83:5204-5208. 23. Lovett, C. M., Jr., P. E. Love, and R. E. Yasbin. 1989. Competence-specific induction of the Bacillus subtilis RecA protein analog: evidence for dual regulation of a recombination protein. J. Bacteriol. 171:2318-2322. 24. Lovett, C. M., Jr., P. E. Love, and R. E. Yasbin, and J. W. Roberts. 1988. SOS-like induction in Bacillus subtilis: induction of the RecA protein analog and a damage-inducible operon by DNA damage in Rec+ and DNA repair-deficient strains. J. Bacteriol. 170:1467-1474. 25. Lovett, C. M., Jr., and J. W. Roberts. 1985. Purification of a recA analogue from Bacillus subtilis. J. Biol. Chem. 260:33053313. 26. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 27. Messing, J., and J. Vieira. 1982. A new pair of M13 vectors for selecting either DNA strand of double digest restriction fragments. Gene 19:269-276. 28. Miller, J. H. 1972. Experiments in molecular genetics, p. 352-355. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 29. Moran, C. P., Jr. 1989. Sigma factors and the regulation of transcription, p. 167-184. In I. Smith, R. A. Slepecky, and P. Setlow (ed.), Regulation of procaryotic development: a structural and functional analysis of bacterial sporulation and germination. American Society for Microbiology, Washington, D.C. 30. Moran, C. P., Jr., N. Lang, S. F. J. Legrice, G. Lee, M. Stephens, A. L. Sonenshein, J. Pero, and R. Losick. 1982. Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol. Gen. Genet. 186:339346. 31. Radding, C. M. 1982. Homologous pairing and strand exchange in genetic recombination. Annu. Rev. Genet. 16:405-437. 32. Radman, M. 1975. SOS repair hypothesis: phenomenology of an inducible DNA repair which is accompanied by mutagenesis, p. 355-367. In P. Hanawalt and R. B. Setlow (ed.), Molecular mechanisms for repair of DNA. Plenum Publishing Corp., New York. 33. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 34. Sauer, R. T., M. J. Ross, and M. Ptashne. 1982. Cleavage of the lambda and P22 repressors by RecA protein. J. Biol. Chem.

257:4458-4462.

35. Sauer, R. T., R. R. Yocum, R. F. Doolittle, M. Lewis, and C. 0.

DAMAGE-INDUCIBLE REGULATION IN B. SUBTILIS

1703

Pabo. 1982. Homology among DNA-binding proteins suggests use of a conserved super-secondary structure. Nature (London) 298:447-451. 36. Sedwick, S. G., and P. A. Goodwin. 1985. Differences in mutagenic and recombinational DNA repair in enterobacteria. Proc. Natl. Acad. Sci. USA 82:4172-4176. 37. Sedwick, S. G., and P. A. Goodwin. 1985. Interspecies regulation of the SOS response by the E. coli LexA+ gene. Mutat. Res. 145:103-106. 38. Shaw, W. V. 1975. Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol. 43:737755. 39. Shinagawa, H., H. Iwasaki, T. Kato, and A. Nakata. 1988. RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis. Proc. Natl. Acad. Sci. USA 85:1806-1810. 40. Stranathan, M. C., K. W. Bayles, and R. E. Yasbin. 1990. The nucleotide sequence of the recE+ gene of Bacillus subtilis. Nucleic Acids Res. 18:4249. 41. Walker, G. C. 1984. Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli. Microbiol. Rev. 48:60-93. 42. Walker, J. E., M. Saraste, J. J. Runswick, and N. J. Gay. 1982. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold, EMBO J. 1:945951. 43. West, S. C., J. K. Countryman, and P. Howard-Flanders. 1983. Purification and properties of the RecA protein of Proteus mirabilis. J. Biol. Chem. 258:4648-4654. 44. West, S. C., and J. W. Little. 1984. P. mirabilis RecA protein catalyzes cleavage of E. coli LexA protein and the lambda repressor in vitro. Mol. Gen. Genet. 194:111-113. 45. Witkin, E. M. 1976. Ultraviolet mutagenesis and inducible DNA repair in Escherichia coli. Bacteriol. Rev. 40:869-907. 46. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119. 47. Yasbin, R. E. 1977. DNA repair in Bacillus subtilis. II. Activation of the inducible system in competent bacteria. Mol. Gen. Genet. 153:219-225. 48. Yasbin, R. E., P. I. Fields, and B. J. Andersen. 1980. Properties of Bacillus subtilis derivatives freed of their natural prophages. Gene 12:155-157. 49. Yasbin, R. E., P. E. Love, J. Jackson, and C. M. Lovett, Jr. 1988. Evolutionary divergence of the SOS-like (SOB) system of Bacillus subtilis, p. 485-490. in E. C. Friedberg and P. C. Hanawalt (ed.), Mechanisms and consequences of DNA damage processing. John Wiley & Sons, Inc., New York. 50. Yasbin, R. E., G. A. Wilson, and F. E. Young. 1975. Transformation and transfection in lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage in competent cells. J. Bacteriol. 121:296-304. 51. Youngman, P., P. Zuber, J. B. Perkins, K. Sandman, M. Igo, and R. Losick. 1985. New ways to study developmental genes in spore-forming bacteria. Science 228:285-291. 52. Youngman, P. J., J. B. Perkins, and R. Losick. 1983. Genetic transposition and insertional mutagenesis in Bacillus subtilis with Streptococcus faecalis transposon Tn917. Proc. Natl. Acad. Sci. USA 80:2305-2309. 53. Youngman, P. J., J. B. Perkins, and R. Losick. 1984. A novel method for the rapid cloning in Escherichia coli of Bacillus subtilis chromosomal DNA adjacent to Tn917 insertions. Mol. Gen. Genet. 195:424-433. 54. Youngman, P. J., J. B. Perkins, and K. Sandman. 1985. Use of Tn917-mediated transcription gene fusion to lacZ and cat-86 for the identification and study of spo genes in Bacillus subtilis, p. 44-54. In J. A. Hoch and P. Setlow (ed.), Molecular biology of microbial differentiation. American Society for Microbiology, Washington, D.C.