This article was downloaded by: [University of Arizona] On: 19 April 2015, At: 18:10 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Bioscience, Biotechnology, and Biochemistry Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbbb20
Cloning and characterization of a novel Omethyltransferase from Flammulina velutipes that catalyzes methylation of pyrocatechol and pyrogallol structures in polyphenols a
a
a
a
Masanobu Kirita , Yoshihisa Tanaka , Motoyuki Tagashira , Tomomasa Kanda & Mari b
Maeda-Yamamoto a
Research & Development-Production Headquarters, Asahi Breweries Limited, Moriyashi, Ibaraki, Japan b
Click for updates
National Food Research Institute, National Agriculture and Food Research Organization, Tsukuba-shi, Ibaraki, Japan Published online: 10 Mar 2015.
To cite this article: Masanobu Kirita, Yoshihisa Tanaka, Motoyuki Tagashira, Tomomasa Kanda & Mari Maeda-Yamamoto (2015): Cloning and characterization of a novel O-methyltransferase from Flammulina velutipes that catalyzes methylation of pyrocatechol and pyrogallol structures in polyphenols, Bioscience, Biotechnology, and Biochemistry, DOI: 10.1080/09168451.2015.1015955 To link to this article: http://dx.doi.org/10.1080/09168451.2015.1015955
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Bioscience, Biotechnology, and Biochemistry, 2015
Cloning and characterization of a novel O-methyltransferase from Flammulina velutipes that catalyzes methylation of pyrocatechol and pyrogallol structures in polyphenols Masanobu Kirita1,*, Yoshihisa Tanaka1, Motoyuki Tagashira1, Tomomasa Kanda1 and Mari Maeda-Yamamoto2 1
Research & Development-Production Headquarters, Asahi Breweries Limited, Moriya-shi, Ibaraki, Japan; 2National Food Research Institute, National Agriculture and Food Research Organization, Tsukuba-shi, Ibaraki, Japan
Received December 4, 2014; accepted January 21, 2015
Downloaded by [University of Arizona] at 18:10 19 April 2015
http://dx.doi.org/10.1080/09168451.2015.1015955
A novel O-methyltransferase gene was isolated from Flammulina velutipes. The isolated full-length cDNA was composed of a 690-nucleotide open reading frame encoding 230 amino acids. A database search revealed that the deduced amino acid sequence was similar to those of other O-methyltransferases; the highest identity was only 61.8% with Laccaria bicolor. The recombinant enzyme was expressed by Escherichia coli. BL21 (DE3) was assessed for its ability to methylate (−)-epigallocatechin-3-O-gallate (EGCG). LC–TOF–MS and NMR revealed that the enzyme produced five kinds of Omethylated EGCGs: (−)-epigallocatechin-3-O-(3-Omethyl)gallate, (−)-epigallocatechin-3-O-(4-O-methyl) gallate, (−)-epigallocatechin-3-O-(3,4-O-dimethyl)gallate, (−)-epigallocatechin-3-O-(3,5-O-dimethyl)gallate, and (−)-4′-O-methylepigallocatechin-3-O-(3,5-Odimethyl)gallate. The substrate specificity of the enzyme for 20 kinds of polyphenols was assessed using the crude recombinant enzyme of O-methyltransferase. This enzyme introduced methyl group(s) into polyphenols with pyrocatechol and pyrogallol structures. Key words:
Flammulina velutipes; O-methyltransferase; O-methylated EGCGs; O-methylated polyphenols
Polyphenols in plants consist of various kinds of compounds including flavan-3-ol, proanthocyanidin, anthocyanin, phenylpropanoid, ellagitannin, flavonol, flavone, flavanone, chalcone, aurone, isoflavone, stilbene, and lignin. Epidemiological and clinical studies previously reported that these compounds had the potential to maintain human health and prevent diseases in plant foods. However, difficulties have been
associated with utilizing the potential of polyphenols due to their low bioavailability for metabolic functions.1,2) The metabolism of these low bioavailability compounds has been shown to involve oxidation and conjugation through the glucuronidation and sulfation of hydroxyl groups in polyphenols.3) The methylated flavones, 7-methoxyflavone, 7,4′-dimethoxyflavone, 5,7-dimethoxyflavone, and 5,7,4′-trimethoxyflavone in pooled human liver S9 fractions were previously reported to have markedly higher intestinal absorption and metabolic stability in Caco-2 cells.4) Although the O-methylated EGCG, epigallocatechin-3-O-(3-O-methyl)gallate (EGCG3″Me) has been isolated from various tea cultivars,5) its concentration was only 0.50–0.82% of the dry weight of leaves. A previous study reported that the area under the drug concentration time curve (AUC; min μg/mL) of EGCG was 6.72 ± 2.87 and EGCG3″Me was 8.48 ± 2.54 following the consumption of O-methylated EGCG-rich green tea containing 43.5 mg of EGCG and 8.5 mg of EGCG3″Me by healthy human volunteers.6) Although the dose of EGCG was 5.1-fold higher than that of EGCG3″Me, the AUC of EGCG3″Me was higher than that of EGCG.6) However, since these O-methylated polyphenols are present at extremely low levels in plants and not readily available, studies have been extended to in vivo or in vitro designs. We recently identified a novel enzyme produced from mycelial cultures of Flammulina velutipes.7) This enzyme catalyzed the methylation of EGCG; therefore, we attempted to purify it. Following chromatographic and two-dimensional electrophoresis, the purified enzyme was subsequently analyzed on the basis of a partial amino acid sequence using LC–MS/MS. Partial amino acid sequencing identified the 17 and 12 amino acid sequences, VLEVGTLGGYSTTWLAR and TGGIIIVDNVVR. A database search revealed that these
*Corresponding author. Email: [email protected] Abbreviations: EGCG, (−)-epigallocatechin-3-O-gallate; EGCG3″Me, (−)-epigallocatechin-3-O-(3-O-methyl)gallate; EGCG4″Me, (−)-epigallocatechin-3-O-(4-O-methyl)gallate; EGCG3″,5″diMe, (−)-epigallocatechin-3-O-(3,5-O-dimethyl)gallate; EGCG3″,4″diMe, (−)-epigallocatechin-3-O-(3,4O-dimethyl)gallate; EGCG4′,3″,5″triMe, (−)-4′-O-methylepigallocatechin-3-O-(3,5-O-dimethyl)gallate; SAM, S-adenosyl-L-methionine; CCoAOMT, Caffeoyl-coenzyme A O-methyltransferase. © 2015 Japan Society for Bioscience, Biotechnology, and Agrochemistry
2
M. Kirita et al.
sequences showed high identity with O-methyltransferase from other mushrooms. However, no studies have yet been conducted on methylation in mushrooms, including white rot fungi, without Phanerochaete chrysosporium.8,9) In this study, we extended the cloning of a novel O-methyltransferase (Fv-OMT) from F. velutipe. Using a recombinant enzyme, we showed the potential for the synthesis of various O-methylated polyphenols that may be applied to in vivo and in vitro studies and functional diets.
Downloaded by [University of Arizona] at 18:10 19 April 2015
Materials and methods Reagents. All chemicals and solvents were of high or HPLC grade. EGCG3″Me, epigallocatechin-3-O-(4O-methyl)gallate (EGCG4″Me), and epigallocatechin-3O-(3,5-O-dimethyl)gallate (EGCG3″,5″diMe) were prepared according to a previous method with minor modifications (Fig. 1).10) Other polyphenol compounds were purchased from Funakoshi Co., Ltd. (Tokyo, Japan). The edible mushroom F. velutipe was purchased from a Japanese supermarket. Isolation of the Fv-OMT enzyme gene. The mycelia of F. velutipes were isolated according to a previous method.7) The isolated mycelia were cultured in a broth containing 0.02% glucose, 0.01% peptone, 0.002% yeast extract, 0.002% KH2PO4, and 0.001% MgSO4 at 28 °C with shaking. The mycelial culture was ground in liquid nitrogen and total RNA was isolated using TRI reagent (Sigma-Aldrich, Japan). The Fv-OMT gene was isolated using degenerate primers designed from the partial amino acid sequences, VLEVGTLGGYS-
TTWLAR and TGGIIIVDNVVR, according to a previously described method.7) Reverse transcription PCR was used to isolate the enzyme gene with degenerate primers (forward: GAGGT(G/C)GG(A/C)AC(C/T)(C/T) T(G/A/T)GG(A/C)GG(G/C)TA, reverse: GC(G/T)(G/C) AC(A/C/G)AC(A/G)TT(A/G)TC(A/C)AC) using the ThermoScript reverse transcriptase kit (Life Technologies, Japan). Amplified cDNA was cloned into pGEM-T (Promega Corporation, Madison, WI) and introduced into E.coli JM109 cells to confirm its partial nucleotide sequence. To isolate a full-length cDNA fragment, specific primers were designed on the basis of the partial cDNA nucleotide sequence. The 5′ forward primers were 5′ GSP1 (AGCCTCTTAGCCTCAACAAAGTA) and 5′ GSP2 (TCTTCGAGCTCGAAGGTGAT). The 3′ reverse primers were 3′ GSP1 (ATCACCTTCGAGCTCGAAGA) and 3′ GSP2 (TACTTTGTTGAGGCTAAGAGGCT). Using these specific primers, 5′ and 3′ RACE-PCR techniques were performed using the 3′ and 5′ RACE System for the rapid amplification of cDNA ends kit (Life Technologies, Japan). PCR fragments were cloned into pGEM-T and the nucleotide sequence was confirmed. Expression and purification of the recombinant enzyme. The full-length cDNA fragment was digested from pGEM-T using NdeI and BamHI sites that were introduced using specific PCR primers (forward: TACATATGTCCAACCCGACAAGCATACT, with italics indicating the NdeI site and underlining indicating the 5′ terminal sequence; reverse: TAGGATCCAAGTTTGATAGCGTACAAGAATCC, with italics indicating the BamHI site and underlining indicating the 3′ terminal sequence). The cDNA fragment was inserted into the NdeI and BamHI sites of the pET28a(+)
Fig. 1. Chemical structures of EGCG and O-methylated EGCGs. Notes: The chemical structures of unknown compounds 5 and 6 were synthesized in an enzymatic reaction using recombinant enzyme Fv-OMT. Their chemical structures were established by LC–TOF–MS and NMR.
Downloaded by [University of Arizona] at 18:10 19 April 2015
O-Methyltransferase from Flammulina velutipes
expression vector (Merk KGaA, Germany) and transferred into E. coli BL21 (DE3) cells. The transformants were cultured in LB medium until an O.D.600 of 0.6 was reached. Isopropylthiogalactoside was added to the culture to a final concentration of 1 mM, and the cells were cultured at 28 °C for 5 h with shaking. The cultures were then centrifuged to harvest the cells, which were then suspended in 20 mM phosphate buffer (pH 7.4) containing 1 mM dithiothreitol. The cell suspension was then sonicated and centrifuged again, and the supernatant was used for purification. Fv-OMT was also purified using a His-tag column (His GraviTrap, GE Healthcare, Japan), desalted by a PD-10 column (GE Healthcare, Japan), and then eluted with 20 mM phosphate buffer (pH 7.4) containing 1 mM dithiothreitol. Enzyme activity. O-Methyltransferase activity was measured to determine whether methyl groups had been introduced into EGCG. The 3 mL reaction mixture contained 100 mM Tris-HCl (pH 7.4), 0.2 mM MgCl2, 0.25 mM EGCG, 0.5 mM S-adenosyl-L-methionine (SAM) as a methyl donor, and 1.5 mL of recombinant enzyme solution. The mixture was incubated at 37 °C for 10 min, and the reaction was stopped by the addition of 70 μL of 1 N HCl. The reaction mixture was extracted with 5 mL of ethyl acetate, and centrifugation was used to collect the organic phase, which was dried under N2 and resuspended in 30% methanol in 1% ascorbic acid solution. Enzyme activity was evaluated by HPLC with a UV detector or LC–TOF–MS (QSTAR Elite, Applied Biosystems, Inc., CA) according to a previously described method.10) Purification and NMR spectroscopy of O-methylated EGCGs. The isolation and purification of compounds were performed with a Hitachi HPLC system, L-7150 pump, L-7420 UV–vis detector, and D-2500 ChromatoIntegrator (Hitachi, Ltd., Japan). The reaction mixture was scaled up to 1000 mL, but 0.1 mM EGCG was used as described in the Materials and Methods section. The mixture was incubated at 37 °C for 16 h and extracted with ethyl acetate. Removal of ethyl acetate by evaporation gave a solid mixture of O-methylated EGCGs. O-Methylated EGCGs were fractionated by HPLC with the reversed-phase column Inertsil ODS-3 (20 mM i.d. × 250 mM, GL Sciences Inc., Japan). The detection wavelength was 280 nm, flow rate was 12 mL/min, and mobile phase was 23% (v/v) acetonitrile/H2O containing 0.1% HCOOH. They were purified to the Sep-Pak C18 35 cc (Waters Corp., Milford, MA, USA) by rinsing water and eluting with ethanol. After lyophilization, 11.92 and 0.92 mg of compounds 5 and 6, respectively, were obtained as white amorphous powders. 1H NMR (600 MHz), 13C NMR (150 MHz), HSQC, and HMBC spectra were recorded according to a previously described method10) using the Bruker AV600 instrument (Bruker BioSpin GmbH, Germany). Optimal pH and temperature of the enzyme. Optimal pH and temperature were assessed using 0.25 mL of recombinant enzyme and 0.05 mM EGCG as a substrate, in a solution containing 2.5 mM MgCl2, 0.04% ascorbic acid, and 0.5 mM SAM. Optimal pH was determined in the range of 3–9 using 20 mM acetate buffer (pH 3.0–5.5), 20 mM phosphate buffer (pH 6.0– 7.0), and 20 mM Tris–HCl (pH 7.5–9). The mixture
3
was incubated at 37 °C for 20 min. The optimal temperature was determined by incubating the mixture with 20 mM phosphate buffer (pH 7.0) for 20 min and O-methylated EGCGs were analyzed using HPLC. Time-dependent changes in O-methylated EGCG production. Time-dependent changes in the production of O-methylated EGCGs were confirmed between 0 and 240 min. The 30 mL reaction mixture used was the same as that in the enzyme activity method and samples were temporally fractionated. O-Methylated EGCGs were analyzed by HPLC. Substrate specificity of Fv-OMT. To examine the substrate specificity of Fv-OMT, 20 polyphenolic compounds were tested using the crude recombinant enzyme (Fig. 1). The 3 mL reaction mixture contained 20 mM Tris-HCl (pH 7.5), 2.5 mM MgCl2, 0.5 mM SAM as a methyl donor, 0.05 mM substrate, and 1.5 mL of crude enzyme solution. The mixture was incubated at 37 °C for 10 min, and the reaction was stopped by the addition of 70 μL of 1 N HCl. The reaction mixture was treated in the same manner as that in the enzyme activity method and evaluated by HPLC or LC–TOF–MS according to a previously described method.10)
Results Isolation of the enzyme gene and expression of the recombinant enzyme The partial cDNA fragment was isolated using degenerate primers designed based on the partial amino acid sequences. An approximately 400-bp nucleotide sequence of cDNA showed high similarity with the O-methyltransferases of mushrooms. The identified cDNA fragment was composed of a 690-nucleotide open reading frame encoding 230 amino acids (DNA Data Bank of Japan accession ID: LC007086) (Fig. 2). A database search revealed that the deduced amino acid sequence had low similarity with the other O-methyltransferases of mushrooms, with the highest identity only being 61.8% with that of Laccaria bicolor S238 N-H82 (National Center for Biotechnology Information (NCBI) accession ID: XP_001878803.1). The other O-methyltransferases of mushrooms, Trametes versicolor FP-101664 (EIW60464), Dichomitus squalens LYAD-421 SS1 (EJF65784), Stereum hirsutum FP-91666 SS1 (EIM90245), and Coprinopsis cinerea okayama 7#130 (XP_002911017), showed 57.1–61.6% identity. These results demonstrated that the novel O-methyltransferase Fv-OMT was isolated from F. velutipes. The recombinant enzyme was analyzed by SDSPAGE, and an expressed band was clearly recognized (data not shown). On the basis of SDS-PAGE and the amino acid sequence, the molecular weight of Fv-OMT was estimated to be 24.7 kDa.
Structure elucidation of O-methylated EGCGs Using the recombinant enzyme, Fv-OMT activity was measured and the reaction mixture was analyzed by HPLC and LC–TOF–MS. EGCG3″Me, EGCG4″ Me, and EGCG3″,5″diMe were subsequently detected
Downloaded by [University of Arizona] at 18:10 19 April 2015
4
M. Kirita et al.
Fig. 2. The deduced amino acid sequence of Fv-OMT was compared with those of O-methyltransferases from L. bicolor, T. versicolor, D. squalens, S. hirsutum, and C. cinerea okayama. Notes: Conserved amino acids are indicated as white characters. The conserved residues that are divalent metal ions with plant CCoAOMT (●) or cofactor-binding sites with mammalian catechol OMT (○).
in the mixture by comparing their retention times and molecular weights with those of the experimental values of standards (Fig. 3(A)). However, one major and another minor unknown peaks (compounds 5 and 6) were detected in the HPLC chromatogram (Fig. 3(B)). To confirm these unknown peaks, the compounds were fractionated by HPLC purification and subjected to LC–TOF–MS and NMR. On the basis of the negative LC–TOF–MS and 13C NMR spectral data, the molecular formula of compound 5 was deduced to be C24H22O11 (m/z 485.1080 [M-H]−, calcd for C24H21O11, 485.1078) and assigned as (–)-epigallocatechin-3-O-(3,4-O-dimethyl)gallate (EGCG3″,4″ diMe) according to a previous study (Fig. 1).11) Compound 6 was also deduced to be C25H24O11 (m/z 499.1239 [M-H]−, calcd for C25H23O11, 499.1234) and assigned as (–)-4-O-methyl-epigallocatechin-3-O-(3,5O-dimethyl)gallate (EGCG4′,3″,5″triMe) according to a previous study.11) Optimal pH, temperature for enzyme activity, and time-dependent changes in o-methylated EGCG production The optimal pH and temperature for enzyme activity were determined using the O-methylated EGCG synthesis index. The enzyme was stable in a pH range of 6–9 at 37 °C (Fig. 4(A)), and its activity was the greatest at pH 6.5. The enzyme was active between 20 and 60 °C at pH 7.0 (Fig. 4(B)), and the optimal temperature was 40–50 °C. Time-dependent changes in the production of O-methylated EGCGs were assessed. EGCG as a
substrate was not detected after 30 min of the enzymatic reaction (data not shown). The synthesis of EGCG3″Me peaked immediately after the enzymatic reaction and then decreased (Fig. 4(C)). Thereafter, the synthesis of EGCG3″,5″diMe peaked at 30 min and then slightly decreased. In contrast, EGCG4′,3″,5″triMe was slowly synthesized until 240 min. The synthesis of EGCG4″Me and EGCG3″,4″diMe peaked at 30 min and thereafter plateaued. Substrate specificity of Fv-OMT The production of the same O-methylated EGCGs had been confirmed prior to this study using a His-tag-purified or crude recombinant enzyme. Of the 20 polyphenolic compounds examined, 12 were methylated ((–)-epicatechin 3-O-gallate, (–)-gallocatechin 3-Ogallate, (–)-catechin 3-O-gallate, caffeic acid, chlorogenic acid, rosmarinic acid, ellagic acid, myricetin, luteolin, butein, sulfuretin, and procyanidin B2), while the others showed no peaks, indicating catalysis (Table 1).
Discussion In this study, the deduced amino acid sequence was compared with other mushroom O-methyltransferases following gene isolation. Although the highest identity was only 61.8%, several highly conserved regions were recognized. These O-methyltransferases were categorized to family 3, which is dependent on SAM. The NCBI BLAST search revealed that this family included the catechol O-methyltransferase, CCoAOMT, and a
O-Methyltransferase from Flammulina velutipes
5
mAU
(A)
3 2 4
1
min 3 1
4
2 Compound 5
mAU
Downloaded by [University of Arizona] at 18:10 19 April 2015
(B)
Compound 6
min Fig. 3. HPLC analysis of enzymatic reaction products using the Fv-OMT recombinant enzyme. Notes: (A) Standard catechins. Peak identification: 1, EGCG; 2, EGCG4″Me; 3, EGCG3″Me; 4, EGCG3″,5″diMe. (B) Enzymatic reaction products.
family of bacterial O-methyltransferases. The three putative SAM-binding motifs (A, B, and C) of CCoAOMT had been previously proposed by Joshi and Chiang.12) The consensus for motif A was LVXXGGXI, assigned to class I of CCoAOMT (Fig. 2), and Fv-OMT contained LVRTGGII (aa 161– 168). However, the other motifs, B and C, were poorly conserved between Fv-OMT and CCoAOMT and among mushrooms. Another motif, E (GVXTGYS), showed some similarity to the putative SAM-binding domains. In this region, Fv-OMT contained GTLGGYS (aa 73–79), which was consistent with other mushrooms. Accordingly, GYS has been proposed as the most important amino acids in this motif for SAM binding. Other residues that were conserved between Fv-OMT and CCoAOMT included 9–12 amino acids that completely matched in a divalent metal and cofactor-binding site (Fig. 2).13) These surrounding sequences showed high identity with mushroom OMT and plant CCoAOMTs.13) The other two residues matched mammalian catechol OMT. Previous studies only examined methylation by mushrooms including
white rot fungi. The 3-O- and 4-O-methyltransferases were previously purified from P. chrysosporium.8,9) The molecular weights of 3-O- and 4-O-methyltransferases indicated dimeric and monomeric proteins of 36 and 54 kDa, respectively. The substrate specificity of 3-Omethyltransferase was highly restricted to the 3-position hydroxyl group of several benzoic acids. In contrast, 4-O-methyltransferase catalyzed the 2 and 4 positions. The molecular weight of Fv-OMT was distinct from those of 3-O- and 4-O-methyltransferases, and the enzyme showed low specific methylation at the position of the hydroxyl group. The amino acid sequence of Fv-OMT was searched against the database of P. chrysosporium,14) the most intensively studied white rot fungus and another O-methyltransferase consisting of 230 amino acids showed 56.6% identity. Therefore, several methyltransferases are involved in lignin degradation. The optimal pH of Fv-OMT was slightly different from that of the native enzyme; pH6.5 and pH7.0, respectively.7) The optimal temperature of the recombinant enzyme was 40–50 °C, whereas that of the native
M. Kirita et al.
(A)
Production of O-methylated EGCGs (µM)
6
30 25 20 15 10 5 0 3
4
5
6
7
8
9
40
50
60
50 40 30 20 10 0
0
10
20
30
temperature (˚C)
(C) 35
Production of O-methylated EGCGs (µM)
Downloaded by [University of Arizona] at 18:10 19 April 2015
(B)
Production of O-methylated EGCGs (µM)
pH
EGCG3''Me EGCG4''Me EGCG3'',5''diMe EGCG3'',4''diMe EGCG4',3'',5''triMe
30 25 20 15 10 5 0 0
60
120
180
240
min Fig. 4. Optimal pH (A) and temperature (B) of Fv-OMT. The activity of the enzyme was indexed according to the production of O-methylated EGCGs. Notes: Time-dependent changes in the production of O-methylated EGCGs (C). EGCG3″Me (-○-), EGCG4″Me (-□-), EGCG3″,5″diMe (-△-), EGCG3″,4″diMe (-♢-), and EGCG4′,3″,5″triMe (-×-) were analyzed 0–240 min after the enzymatic reaction of Fv-OMT by HPLC.
enzyme was 37 °C. The activity of the recombinant enzyme was high; therefore, the reaction was saturated after 20 min. On the other hand, the reaction involving the crude enzyme purified from F. velutipes was saturated after 6 h because of low activity. These different activities may have influenced the results obtained for optimal pH and temperature. Time-dependent changes in the production of O-methylated EGCGs were also assessed. The results obtained suggested that Fv-OMT preferentially recognized the 3″ position in the galloyl
moiety of EGCG over the 4″ position. However, to confirm this, its enzymatic activity needs to be determined with each O-methylated EGCG. The reactions of the recombinant enzyme were assessed in order to establish whether Fv-OMT was able to methylate other polyphenolic compounds, and several reactions were found to be catalyzed. A consensus recognition mechanism was observed from the results. This enzyme recognized pyrocatechol and pyrogallol structures, which are substituted by any atom
O-Methyltransferase from Flammulina velutipes
7
Table 1. The LC–TOF–MS analysis of the polyphenolic compounds which were methylated or nonmethylated using crude recombinant enzyme Fv-OMT. Substrate
Di-methylated
[M-H] (m/z)
R.Time (min)
[M-H] (m/z)
R.Time (min)
[M-H] (m/z)
R.Time (min)
[M-H]− (m/z)
(–)-epicatechin -3-O-gallate (–)-gallocatechin -3-O-gallate (–)-catechin -3-O-gallate Caffeic acid
20.8
441.4
22.6
455.4
483.4
457.4
22.5
471.4
22.1
441.4
24.5
455.4
469.4 469.4 485.4 485.4 469.4 469.4
26.0
19.8
24.1 25.0 24.5 25.5 26.5 27.5
26.4 27.5 28.9 30.0
499.4 499.4 483.4 483.4
16.9
179.2
Chlorogenic acid
16.9
353.3
Rosmarinic acid Ellagic acid
25.3 21.8
359.3 301.2
Myricetin
25.0
317.2
387.3 329.2 329.2 345.2 345.2
27.8 29.4 26.8
285.2 271.3 269.3
Procyanidin B2
17.5
557.5
193.2 193.2 367.3 367.3 373.3 315.2 315.2 331.2 331.2 299.2 285.3 283.3 283.3 591.5 591.5
30.2 27.3 28.0 30.7 31.6
Luteolin Butein Sulfuretin
22.2 25.3 21.2 22.1 27.8 24.6 25.2 27.7 28.0 30.7 32.8 30.0 31.3 20.5 21.7
Nonmethylated compounds Phloretin Apigenin
Astragalin Daidzein
−
Tri-methylated
R.Time (min)
Methylated compounds
Downloaded by [University of Arizona] at 18:10 19 April 2015
Methylated −
Genistein Resveratrol
−
p-coumaric acid 3,4-dihydroxycinnamic acid
determined by LC–TOF–MS. Taken together, these results suggested that this enzyme preferentially recognized the galloyl moiety. In conclusion, this is the first study to have successfully isolated Fv-OMT from F. velutipe. We characterized Fv-OMT and its substrate specificity to polyphenols. In our previous study, the O-methylated teaflavins, teaflavin 3-O-(3-O-methyl)gallate and teaflavin 3-O-(3,5-di-O-methyl)gallate, were synthesized via the O-methylation of teaflavin 3-O-gallate using a crude enzyme containing Fv-OMT.15) The inhibitory effects of these compounds on the intracellular accumulation of triglycerides from terminally differentiated human visceral adipocytes were investigated. Therefore, this enzyme may be a useful tool for the production of O-methylated polyphenols, which are present at low levels in plants, as well as the elucidation of their functions. Fig. 5. Chemical structures that can and cannot be catalyzed by FvOMT. Pyrogallol and pyrocatechol were recognized, whereas resorcinol, phloroglucinol, and phenol were not.
without a proton at 1 position (Fig. 5). On the other hand, several compounds, such as resorcinol, phloroglucinol, and phenol structures, were not methylated by Fv-OMT. Although an EGCG4′,3″,5″triMe peak was detected when EGCG was used as a substrate, no peaks by the methylated compounds of (–)-epicatechin, (–)-epigallocatechin, (+)-catechin, and (–)-gallocatechin were detected by HPLC. However, the molecular weights of these methylated compounds were
References [1] Manach C, Williamson G, Morand C, Scalbert A, Rémésy C. Bioavailability and bioefficacy of polyphenols in humans. I. Review of 97 bioavailability studies. Am. J. Clin. Nutr. 2005;81:230S–242S. [2] Williamson G, Manach C. Bioavailability and bioefficacy of polyphenols in humans. II. Review of 93 intervention studies. Am. J. Clin. Nutr. 2005;81:243S–255S. [3] Otake Y, Hsieh F, Walle T. Glucuronidation versus oxidation of the flavonoid galangin by human liver microsomes and hepatocytes. Drug Metab. Dispos. 2002;30:576–581. [4] Wen X, Walle T. Methylated flavonoids have greatly improved intestinal absorption and metabolic stability. Drug Metab. Dispos. 2006;34:1786–1792.
Downloaded by [University of Arizona] at 18:10 19 April 2015
8
M. Kirita et al.
[5] Sano M, Suzuki M, Miyase T, Yoshino K, Maeda-Yamamoto M. Novel antiallergic catechin derivatives isolated from oolong tea. J. Agric. Food. Chem. 1999;47:1906–1910. [6] Maeda-Yamamoto M, Ema K, Shibuichi T. In vitro and in vivo anti-allergic effect of `benifuuki` green tea containing O-methylated catechin and ginger extract enhancement. Cytotechnology. 2007;55:135–142. [7] Kirita M, Tanaka Y, Tagashira M, Kanda T, Maeda-Yamamoto M. Purification and characterization of a novel O-methyltransferase from Flammulina velutipes. Biosci. Biotechnol., Biochem. 2014;78:806–811. [8] Coulter C, Kennedy JT, McRoberts WC, Harper DB. Purification and properties of an S-adenosylmethionine: 2,4-Disubstituted phenol O-methyltransferase from Phanerochaete chrysosporium. Appl. Environ. Microbiol. 1993;59:706–711. [9] Jeffers MR, McRoberts WC, Harper DB. Identification of a phenolic 3-O-methyltransferase in the lignin-degrading fungus Phanerochaete chrysosporium. Microbiology. 1997;143: 1975–1981. [10] Kirita M, Honma D, Tanaka Y, Usui S, Shoji T, Sami M, Yokota T, Tagashira M, Muranaka A, Uchiyama M, Kanda T, MaedaYamamoto M. Cloning of a novel O-methyltransferase from Camellia sinensis and synthesis of O-methylated EGCG and evaluation of their bioactivity. J. Agric. Food. Chem. 2010;58: 7196–7201.
[11] Tanaka H, Yamanouchi M, Miyoshi H, Hirotsu K, Tachibana H, Takahashi T. Solid-phase synthesis of a combinatorial methylated (±)-epigallocatechin gallate library and the growth-inhibitory effects of these compounds on melanoma B16 cells. Chem. Asian J. 2010;5:2231–2248. [12] Joshi CP, Chiang VL. Conserved sequence motifs in plant S-adenosyl-L-methionine-dependent methyltransferases. Plant. Mol. Biol. 1998;37:663–674. [13] Ferrer JL, Zubieta C, Dixon RA, Noel JP. Crystal structures of alfalfa caffeoyl coenzyme a 3-o-methyltransferase. Plant Physiol. 2005;137:1009–1017. [14] Wymelenberg AV, Minges P, Sabat G, Martinez D, Aerts A, Salamov A, Grigoriev I, Shapiro H, Putnam N, Belinky P, Dosoretz C, Gaskell J, Kersten P, Cullen D. Computational analysis of the Phanerochaete chrysosporium v2.0 genome database and mass spectrometry identification of peptides in ligninolytic cultures reveal complex mixtures of secreted proteins. Fungal Genet. Biol. 2006;43: 343–356. [15] Tanaka Y, Kirita M, Miyata S, Abe Y, Tagashira M, Kanda T, Maeda-Yamamoto M. O-methylated theaflavins suppress the intracellular accumulation of triglycerides from terminally differentiated human visceral adipocytes. J. Agric. Food. Chem. 2013;61:12634–12639.
Bioscience, Biotechnology, and Biochemistry Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbbb20
Cloning and characterization of a novel Omethyltransferase from Flammulina velutipes that catalyzes methylation of pyrocatechol and pyrogallol structures in polyphenols a
a
a
a
Masanobu Kirita , Yoshihisa Tanaka , Motoyuki Tagashira , Tomomasa Kanda & Mari b
Maeda-Yamamoto a
Research & Development-Production Headquarters, Asahi Breweries Limited, Moriyashi, Ibaraki, Japan b
Click for updates
National Food Research Institute, National Agriculture and Food Research Organization, Tsukuba-shi, Ibaraki, Japan Published online: 10 Mar 2015.
To cite this article: Masanobu Kirita, Yoshihisa Tanaka, Motoyuki Tagashira, Tomomasa Kanda & Mari Maeda-Yamamoto (2015): Cloning and characterization of a novel O-methyltransferase from Flammulina velutipes that catalyzes methylation of pyrocatechol and pyrogallol structures in polyphenols, Bioscience, Biotechnology, and Biochemistry, DOI: 10.1080/09168451.2015.1015955 To link to this article: http://dx.doi.org/10.1080/09168451.2015.1015955
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Bioscience, Biotechnology, and Biochemistry, 2015
Cloning and characterization of a novel O-methyltransferase from Flammulina velutipes that catalyzes methylation of pyrocatechol and pyrogallol structures in polyphenols Masanobu Kirita1,*, Yoshihisa Tanaka1, Motoyuki Tagashira1, Tomomasa Kanda1 and Mari Maeda-Yamamoto2 1
Research & Development-Production Headquarters, Asahi Breweries Limited, Moriya-shi, Ibaraki, Japan; 2National Food Research Institute, National Agriculture and Food Research Organization, Tsukuba-shi, Ibaraki, Japan
Received December 4, 2014; accepted January 21, 2015
Downloaded by [University of Arizona] at 18:10 19 April 2015
http://dx.doi.org/10.1080/09168451.2015.1015955
A novel O-methyltransferase gene was isolated from Flammulina velutipes. The isolated full-length cDNA was composed of a 690-nucleotide open reading frame encoding 230 amino acids. A database search revealed that the deduced amino acid sequence was similar to those of other O-methyltransferases; the highest identity was only 61.8% with Laccaria bicolor. The recombinant enzyme was expressed by Escherichia coli. BL21 (DE3) was assessed for its ability to methylate (−)-epigallocatechin-3-O-gallate (EGCG). LC–TOF–MS and NMR revealed that the enzyme produced five kinds of Omethylated EGCGs: (−)-epigallocatechin-3-O-(3-Omethyl)gallate, (−)-epigallocatechin-3-O-(4-O-methyl) gallate, (−)-epigallocatechin-3-O-(3,4-O-dimethyl)gallate, (−)-epigallocatechin-3-O-(3,5-O-dimethyl)gallate, and (−)-4′-O-methylepigallocatechin-3-O-(3,5-Odimethyl)gallate. The substrate specificity of the enzyme for 20 kinds of polyphenols was assessed using the crude recombinant enzyme of O-methyltransferase. This enzyme introduced methyl group(s) into polyphenols with pyrocatechol and pyrogallol structures. Key words:
Flammulina velutipes; O-methyltransferase; O-methylated EGCGs; O-methylated polyphenols
Polyphenols in plants consist of various kinds of compounds including flavan-3-ol, proanthocyanidin, anthocyanin, phenylpropanoid, ellagitannin, flavonol, flavone, flavanone, chalcone, aurone, isoflavone, stilbene, and lignin. Epidemiological and clinical studies previously reported that these compounds had the potential to maintain human health and prevent diseases in plant foods. However, difficulties have been
associated with utilizing the potential of polyphenols due to their low bioavailability for metabolic functions.1,2) The metabolism of these low bioavailability compounds has been shown to involve oxidation and conjugation through the glucuronidation and sulfation of hydroxyl groups in polyphenols.3) The methylated flavones, 7-methoxyflavone, 7,4′-dimethoxyflavone, 5,7-dimethoxyflavone, and 5,7,4′-trimethoxyflavone in pooled human liver S9 fractions were previously reported to have markedly higher intestinal absorption and metabolic stability in Caco-2 cells.4) Although the O-methylated EGCG, epigallocatechin-3-O-(3-O-methyl)gallate (EGCG3″Me) has been isolated from various tea cultivars,5) its concentration was only 0.50–0.82% of the dry weight of leaves. A previous study reported that the area under the drug concentration time curve (AUC; min μg/mL) of EGCG was 6.72 ± 2.87 and EGCG3″Me was 8.48 ± 2.54 following the consumption of O-methylated EGCG-rich green tea containing 43.5 mg of EGCG and 8.5 mg of EGCG3″Me by healthy human volunteers.6) Although the dose of EGCG was 5.1-fold higher than that of EGCG3″Me, the AUC of EGCG3″Me was higher than that of EGCG.6) However, since these O-methylated polyphenols are present at extremely low levels in plants and not readily available, studies have been extended to in vivo or in vitro designs. We recently identified a novel enzyme produced from mycelial cultures of Flammulina velutipes.7) This enzyme catalyzed the methylation of EGCG; therefore, we attempted to purify it. Following chromatographic and two-dimensional electrophoresis, the purified enzyme was subsequently analyzed on the basis of a partial amino acid sequence using LC–MS/MS. Partial amino acid sequencing identified the 17 and 12 amino acid sequences, VLEVGTLGGYSTTWLAR and TGGIIIVDNVVR. A database search revealed that these
*Corresponding author. Email: [email protected] Abbreviations: EGCG, (−)-epigallocatechin-3-O-gallate; EGCG3″Me, (−)-epigallocatechin-3-O-(3-O-methyl)gallate; EGCG4″Me, (−)-epigallocatechin-3-O-(4-O-methyl)gallate; EGCG3″,5″diMe, (−)-epigallocatechin-3-O-(3,5-O-dimethyl)gallate; EGCG3″,4″diMe, (−)-epigallocatechin-3-O-(3,4O-dimethyl)gallate; EGCG4′,3″,5″triMe, (−)-4′-O-methylepigallocatechin-3-O-(3,5-O-dimethyl)gallate; SAM, S-adenosyl-L-methionine; CCoAOMT, Caffeoyl-coenzyme A O-methyltransferase. © 2015 Japan Society for Bioscience, Biotechnology, and Agrochemistry
2
M. Kirita et al.
sequences showed high identity with O-methyltransferase from other mushrooms. However, no studies have yet been conducted on methylation in mushrooms, including white rot fungi, without Phanerochaete chrysosporium.8,9) In this study, we extended the cloning of a novel O-methyltransferase (Fv-OMT) from F. velutipe. Using a recombinant enzyme, we showed the potential for the synthesis of various O-methylated polyphenols that may be applied to in vivo and in vitro studies and functional diets.
Downloaded by [University of Arizona] at 18:10 19 April 2015
Materials and methods Reagents. All chemicals and solvents were of high or HPLC grade. EGCG3″Me, epigallocatechin-3-O-(4O-methyl)gallate (EGCG4″Me), and epigallocatechin-3O-(3,5-O-dimethyl)gallate (EGCG3″,5″diMe) were prepared according to a previous method with minor modifications (Fig. 1).10) Other polyphenol compounds were purchased from Funakoshi Co., Ltd. (Tokyo, Japan). The edible mushroom F. velutipe was purchased from a Japanese supermarket. Isolation of the Fv-OMT enzyme gene. The mycelia of F. velutipes were isolated according to a previous method.7) The isolated mycelia were cultured in a broth containing 0.02% glucose, 0.01% peptone, 0.002% yeast extract, 0.002% KH2PO4, and 0.001% MgSO4 at 28 °C with shaking. The mycelial culture was ground in liquid nitrogen and total RNA was isolated using TRI reagent (Sigma-Aldrich, Japan). The Fv-OMT gene was isolated using degenerate primers designed from the partial amino acid sequences, VLEVGTLGGYS-
TTWLAR and TGGIIIVDNVVR, according to a previously described method.7) Reverse transcription PCR was used to isolate the enzyme gene with degenerate primers (forward: GAGGT(G/C)GG(A/C)AC(C/T)(C/T) T(G/A/T)GG(A/C)GG(G/C)TA, reverse: GC(G/T)(G/C) AC(A/C/G)AC(A/G)TT(A/G)TC(A/C)AC) using the ThermoScript reverse transcriptase kit (Life Technologies, Japan). Amplified cDNA was cloned into pGEM-T (Promega Corporation, Madison, WI) and introduced into E.coli JM109 cells to confirm its partial nucleotide sequence. To isolate a full-length cDNA fragment, specific primers were designed on the basis of the partial cDNA nucleotide sequence. The 5′ forward primers were 5′ GSP1 (AGCCTCTTAGCCTCAACAAAGTA) and 5′ GSP2 (TCTTCGAGCTCGAAGGTGAT). The 3′ reverse primers were 3′ GSP1 (ATCACCTTCGAGCTCGAAGA) and 3′ GSP2 (TACTTTGTTGAGGCTAAGAGGCT). Using these specific primers, 5′ and 3′ RACE-PCR techniques were performed using the 3′ and 5′ RACE System for the rapid amplification of cDNA ends kit (Life Technologies, Japan). PCR fragments were cloned into pGEM-T and the nucleotide sequence was confirmed. Expression and purification of the recombinant enzyme. The full-length cDNA fragment was digested from pGEM-T using NdeI and BamHI sites that were introduced using specific PCR primers (forward: TACATATGTCCAACCCGACAAGCATACT, with italics indicating the NdeI site and underlining indicating the 5′ terminal sequence; reverse: TAGGATCCAAGTTTGATAGCGTACAAGAATCC, with italics indicating the BamHI site and underlining indicating the 3′ terminal sequence). The cDNA fragment was inserted into the NdeI and BamHI sites of the pET28a(+)
Fig. 1. Chemical structures of EGCG and O-methylated EGCGs. Notes: The chemical structures of unknown compounds 5 and 6 were synthesized in an enzymatic reaction using recombinant enzyme Fv-OMT. Their chemical structures were established by LC–TOF–MS and NMR.
Downloaded by [University of Arizona] at 18:10 19 April 2015
O-Methyltransferase from Flammulina velutipes
expression vector (Merk KGaA, Germany) and transferred into E. coli BL21 (DE3) cells. The transformants were cultured in LB medium until an O.D.600 of 0.6 was reached. Isopropylthiogalactoside was added to the culture to a final concentration of 1 mM, and the cells were cultured at 28 °C for 5 h with shaking. The cultures were then centrifuged to harvest the cells, which were then suspended in 20 mM phosphate buffer (pH 7.4) containing 1 mM dithiothreitol. The cell suspension was then sonicated and centrifuged again, and the supernatant was used for purification. Fv-OMT was also purified using a His-tag column (His GraviTrap, GE Healthcare, Japan), desalted by a PD-10 column (GE Healthcare, Japan), and then eluted with 20 mM phosphate buffer (pH 7.4) containing 1 mM dithiothreitol. Enzyme activity. O-Methyltransferase activity was measured to determine whether methyl groups had been introduced into EGCG. The 3 mL reaction mixture contained 100 mM Tris-HCl (pH 7.4), 0.2 mM MgCl2, 0.25 mM EGCG, 0.5 mM S-adenosyl-L-methionine (SAM) as a methyl donor, and 1.5 mL of recombinant enzyme solution. The mixture was incubated at 37 °C for 10 min, and the reaction was stopped by the addition of 70 μL of 1 N HCl. The reaction mixture was extracted with 5 mL of ethyl acetate, and centrifugation was used to collect the organic phase, which was dried under N2 and resuspended in 30% methanol in 1% ascorbic acid solution. Enzyme activity was evaluated by HPLC with a UV detector or LC–TOF–MS (QSTAR Elite, Applied Biosystems, Inc., CA) according to a previously described method.10) Purification and NMR spectroscopy of O-methylated EGCGs. The isolation and purification of compounds were performed with a Hitachi HPLC system, L-7150 pump, L-7420 UV–vis detector, and D-2500 ChromatoIntegrator (Hitachi, Ltd., Japan). The reaction mixture was scaled up to 1000 mL, but 0.1 mM EGCG was used as described in the Materials and Methods section. The mixture was incubated at 37 °C for 16 h and extracted with ethyl acetate. Removal of ethyl acetate by evaporation gave a solid mixture of O-methylated EGCGs. O-Methylated EGCGs were fractionated by HPLC with the reversed-phase column Inertsil ODS-3 (20 mM i.d. × 250 mM, GL Sciences Inc., Japan). The detection wavelength was 280 nm, flow rate was 12 mL/min, and mobile phase was 23% (v/v) acetonitrile/H2O containing 0.1% HCOOH. They were purified to the Sep-Pak C18 35 cc (Waters Corp., Milford, MA, USA) by rinsing water and eluting with ethanol. After lyophilization, 11.92 and 0.92 mg of compounds 5 and 6, respectively, were obtained as white amorphous powders. 1H NMR (600 MHz), 13C NMR (150 MHz), HSQC, and HMBC spectra were recorded according to a previously described method10) using the Bruker AV600 instrument (Bruker BioSpin GmbH, Germany). Optimal pH and temperature of the enzyme. Optimal pH and temperature were assessed using 0.25 mL of recombinant enzyme and 0.05 mM EGCG as a substrate, in a solution containing 2.5 mM MgCl2, 0.04% ascorbic acid, and 0.5 mM SAM. Optimal pH was determined in the range of 3–9 using 20 mM acetate buffer (pH 3.0–5.5), 20 mM phosphate buffer (pH 6.0– 7.0), and 20 mM Tris–HCl (pH 7.5–9). The mixture
3
was incubated at 37 °C for 20 min. The optimal temperature was determined by incubating the mixture with 20 mM phosphate buffer (pH 7.0) for 20 min and O-methylated EGCGs were analyzed using HPLC. Time-dependent changes in O-methylated EGCG production. Time-dependent changes in the production of O-methylated EGCGs were confirmed between 0 and 240 min. The 30 mL reaction mixture used was the same as that in the enzyme activity method and samples were temporally fractionated. O-Methylated EGCGs were analyzed by HPLC. Substrate specificity of Fv-OMT. To examine the substrate specificity of Fv-OMT, 20 polyphenolic compounds were tested using the crude recombinant enzyme (Fig. 1). The 3 mL reaction mixture contained 20 mM Tris-HCl (pH 7.5), 2.5 mM MgCl2, 0.5 mM SAM as a methyl donor, 0.05 mM substrate, and 1.5 mL of crude enzyme solution. The mixture was incubated at 37 °C for 10 min, and the reaction was stopped by the addition of 70 μL of 1 N HCl. The reaction mixture was treated in the same manner as that in the enzyme activity method and evaluated by HPLC or LC–TOF–MS according to a previously described method.10)
Results Isolation of the enzyme gene and expression of the recombinant enzyme The partial cDNA fragment was isolated using degenerate primers designed based on the partial amino acid sequences. An approximately 400-bp nucleotide sequence of cDNA showed high similarity with the O-methyltransferases of mushrooms. The identified cDNA fragment was composed of a 690-nucleotide open reading frame encoding 230 amino acids (DNA Data Bank of Japan accession ID: LC007086) (Fig. 2). A database search revealed that the deduced amino acid sequence had low similarity with the other O-methyltransferases of mushrooms, with the highest identity only being 61.8% with that of Laccaria bicolor S238 N-H82 (National Center for Biotechnology Information (NCBI) accession ID: XP_001878803.1). The other O-methyltransferases of mushrooms, Trametes versicolor FP-101664 (EIW60464), Dichomitus squalens LYAD-421 SS1 (EJF65784), Stereum hirsutum FP-91666 SS1 (EIM90245), and Coprinopsis cinerea okayama 7#130 (XP_002911017), showed 57.1–61.6% identity. These results demonstrated that the novel O-methyltransferase Fv-OMT was isolated from F. velutipes. The recombinant enzyme was analyzed by SDSPAGE, and an expressed band was clearly recognized (data not shown). On the basis of SDS-PAGE and the amino acid sequence, the molecular weight of Fv-OMT was estimated to be 24.7 kDa.
Structure elucidation of O-methylated EGCGs Using the recombinant enzyme, Fv-OMT activity was measured and the reaction mixture was analyzed by HPLC and LC–TOF–MS. EGCG3″Me, EGCG4″ Me, and EGCG3″,5″diMe were subsequently detected
Downloaded by [University of Arizona] at 18:10 19 April 2015
4
M. Kirita et al.
Fig. 2. The deduced amino acid sequence of Fv-OMT was compared with those of O-methyltransferases from L. bicolor, T. versicolor, D. squalens, S. hirsutum, and C. cinerea okayama. Notes: Conserved amino acids are indicated as white characters. The conserved residues that are divalent metal ions with plant CCoAOMT (●) or cofactor-binding sites with mammalian catechol OMT (○).
in the mixture by comparing their retention times and molecular weights with those of the experimental values of standards (Fig. 3(A)). However, one major and another minor unknown peaks (compounds 5 and 6) were detected in the HPLC chromatogram (Fig. 3(B)). To confirm these unknown peaks, the compounds were fractionated by HPLC purification and subjected to LC–TOF–MS and NMR. On the basis of the negative LC–TOF–MS and 13C NMR spectral data, the molecular formula of compound 5 was deduced to be C24H22O11 (m/z 485.1080 [M-H]−, calcd for C24H21O11, 485.1078) and assigned as (–)-epigallocatechin-3-O-(3,4-O-dimethyl)gallate (EGCG3″,4″ diMe) according to a previous study (Fig. 1).11) Compound 6 was also deduced to be C25H24O11 (m/z 499.1239 [M-H]−, calcd for C25H23O11, 499.1234) and assigned as (–)-4-O-methyl-epigallocatechin-3-O-(3,5O-dimethyl)gallate (EGCG4′,3″,5″triMe) according to a previous study.11) Optimal pH, temperature for enzyme activity, and time-dependent changes in o-methylated EGCG production The optimal pH and temperature for enzyme activity were determined using the O-methylated EGCG synthesis index. The enzyme was stable in a pH range of 6–9 at 37 °C (Fig. 4(A)), and its activity was the greatest at pH 6.5. The enzyme was active between 20 and 60 °C at pH 7.0 (Fig. 4(B)), and the optimal temperature was 40–50 °C. Time-dependent changes in the production of O-methylated EGCGs were assessed. EGCG as a
substrate was not detected after 30 min of the enzymatic reaction (data not shown). The synthesis of EGCG3″Me peaked immediately after the enzymatic reaction and then decreased (Fig. 4(C)). Thereafter, the synthesis of EGCG3″,5″diMe peaked at 30 min and then slightly decreased. In contrast, EGCG4′,3″,5″triMe was slowly synthesized until 240 min. The synthesis of EGCG4″Me and EGCG3″,4″diMe peaked at 30 min and thereafter plateaued. Substrate specificity of Fv-OMT The production of the same O-methylated EGCGs had been confirmed prior to this study using a His-tag-purified or crude recombinant enzyme. Of the 20 polyphenolic compounds examined, 12 were methylated ((–)-epicatechin 3-O-gallate, (–)-gallocatechin 3-Ogallate, (–)-catechin 3-O-gallate, caffeic acid, chlorogenic acid, rosmarinic acid, ellagic acid, myricetin, luteolin, butein, sulfuretin, and procyanidin B2), while the others showed no peaks, indicating catalysis (Table 1).
Discussion In this study, the deduced amino acid sequence was compared with other mushroom O-methyltransferases following gene isolation. Although the highest identity was only 61.8%, several highly conserved regions were recognized. These O-methyltransferases were categorized to family 3, which is dependent on SAM. The NCBI BLAST search revealed that this family included the catechol O-methyltransferase, CCoAOMT, and a
O-Methyltransferase from Flammulina velutipes
5
mAU
(A)
3 2 4
1
min 3 1
4
2 Compound 5
mAU
Downloaded by [University of Arizona] at 18:10 19 April 2015
(B)
Compound 6
min Fig. 3. HPLC analysis of enzymatic reaction products using the Fv-OMT recombinant enzyme. Notes: (A) Standard catechins. Peak identification: 1, EGCG; 2, EGCG4″Me; 3, EGCG3″Me; 4, EGCG3″,5″diMe. (B) Enzymatic reaction products.
family of bacterial O-methyltransferases. The three putative SAM-binding motifs (A, B, and C) of CCoAOMT had been previously proposed by Joshi and Chiang.12) The consensus for motif A was LVXXGGXI, assigned to class I of CCoAOMT (Fig. 2), and Fv-OMT contained LVRTGGII (aa 161– 168). However, the other motifs, B and C, were poorly conserved between Fv-OMT and CCoAOMT and among mushrooms. Another motif, E (GVXTGYS), showed some similarity to the putative SAM-binding domains. In this region, Fv-OMT contained GTLGGYS (aa 73–79), which was consistent with other mushrooms. Accordingly, GYS has been proposed as the most important amino acids in this motif for SAM binding. Other residues that were conserved between Fv-OMT and CCoAOMT included 9–12 amino acids that completely matched in a divalent metal and cofactor-binding site (Fig. 2).13) These surrounding sequences showed high identity with mushroom OMT and plant CCoAOMTs.13) The other two residues matched mammalian catechol OMT. Previous studies only examined methylation by mushrooms including
white rot fungi. The 3-O- and 4-O-methyltransferases were previously purified from P. chrysosporium.8,9) The molecular weights of 3-O- and 4-O-methyltransferases indicated dimeric and monomeric proteins of 36 and 54 kDa, respectively. The substrate specificity of 3-Omethyltransferase was highly restricted to the 3-position hydroxyl group of several benzoic acids. In contrast, 4-O-methyltransferase catalyzed the 2 and 4 positions. The molecular weight of Fv-OMT was distinct from those of 3-O- and 4-O-methyltransferases, and the enzyme showed low specific methylation at the position of the hydroxyl group. The amino acid sequence of Fv-OMT was searched against the database of P. chrysosporium,14) the most intensively studied white rot fungus and another O-methyltransferase consisting of 230 amino acids showed 56.6% identity. Therefore, several methyltransferases are involved in lignin degradation. The optimal pH of Fv-OMT was slightly different from that of the native enzyme; pH6.5 and pH7.0, respectively.7) The optimal temperature of the recombinant enzyme was 40–50 °C, whereas that of the native
M. Kirita et al.
(A)
Production of O-methylated EGCGs (µM)
6
30 25 20 15 10 5 0 3
4
5
6
7
8
9
40
50
60
50 40 30 20 10 0
0
10
20
30
temperature (˚C)
(C) 35
Production of O-methylated EGCGs (µM)
Downloaded by [University of Arizona] at 18:10 19 April 2015
(B)
Production of O-methylated EGCGs (µM)
pH
EGCG3''Me EGCG4''Me EGCG3'',5''diMe EGCG3'',4''diMe EGCG4',3'',5''triMe
30 25 20 15 10 5 0 0
60
120
180
240
min Fig. 4. Optimal pH (A) and temperature (B) of Fv-OMT. The activity of the enzyme was indexed according to the production of O-methylated EGCGs. Notes: Time-dependent changes in the production of O-methylated EGCGs (C). EGCG3″Me (-○-), EGCG4″Me (-□-), EGCG3″,5″diMe (-△-), EGCG3″,4″diMe (-♢-), and EGCG4′,3″,5″triMe (-×-) were analyzed 0–240 min after the enzymatic reaction of Fv-OMT by HPLC.
enzyme was 37 °C. The activity of the recombinant enzyme was high; therefore, the reaction was saturated after 20 min. On the other hand, the reaction involving the crude enzyme purified from F. velutipes was saturated after 6 h because of low activity. These different activities may have influenced the results obtained for optimal pH and temperature. Time-dependent changes in the production of O-methylated EGCGs were also assessed. The results obtained suggested that Fv-OMT preferentially recognized the 3″ position in the galloyl
moiety of EGCG over the 4″ position. However, to confirm this, its enzymatic activity needs to be determined with each O-methylated EGCG. The reactions of the recombinant enzyme were assessed in order to establish whether Fv-OMT was able to methylate other polyphenolic compounds, and several reactions were found to be catalyzed. A consensus recognition mechanism was observed from the results. This enzyme recognized pyrocatechol and pyrogallol structures, which are substituted by any atom
O-Methyltransferase from Flammulina velutipes
7
Table 1. The LC–TOF–MS analysis of the polyphenolic compounds which were methylated or nonmethylated using crude recombinant enzyme Fv-OMT. Substrate
Di-methylated
[M-H] (m/z)
R.Time (min)
[M-H] (m/z)
R.Time (min)
[M-H] (m/z)
R.Time (min)
[M-H]− (m/z)
(–)-epicatechin -3-O-gallate (–)-gallocatechin -3-O-gallate (–)-catechin -3-O-gallate Caffeic acid
20.8
441.4
22.6
455.4
483.4
457.4
22.5
471.4
22.1
441.4
24.5
455.4
469.4 469.4 485.4 485.4 469.4 469.4
26.0
19.8
24.1 25.0 24.5 25.5 26.5 27.5
26.4 27.5 28.9 30.0
499.4 499.4 483.4 483.4
16.9
179.2
Chlorogenic acid
16.9
353.3
Rosmarinic acid Ellagic acid
25.3 21.8
359.3 301.2
Myricetin
25.0
317.2
387.3 329.2 329.2 345.2 345.2
27.8 29.4 26.8
285.2 271.3 269.3
Procyanidin B2
17.5
557.5
193.2 193.2 367.3 367.3 373.3 315.2 315.2 331.2 331.2 299.2 285.3 283.3 283.3 591.5 591.5
30.2 27.3 28.0 30.7 31.6
Luteolin Butein Sulfuretin
22.2 25.3 21.2 22.1 27.8 24.6 25.2 27.7 28.0 30.7 32.8 30.0 31.3 20.5 21.7
Nonmethylated compounds Phloretin Apigenin
Astragalin Daidzein
−
Tri-methylated
R.Time (min)
Methylated compounds
Downloaded by [University of Arizona] at 18:10 19 April 2015
Methylated −
Genistein Resveratrol
−
p-coumaric acid 3,4-dihydroxycinnamic acid
determined by LC–TOF–MS. Taken together, these results suggested that this enzyme preferentially recognized the galloyl moiety. In conclusion, this is the first study to have successfully isolated Fv-OMT from F. velutipe. We characterized Fv-OMT and its substrate specificity to polyphenols. In our previous study, the O-methylated teaflavins, teaflavin 3-O-(3-O-methyl)gallate and teaflavin 3-O-(3,5-di-O-methyl)gallate, were synthesized via the O-methylation of teaflavin 3-O-gallate using a crude enzyme containing Fv-OMT.15) The inhibitory effects of these compounds on the intracellular accumulation of triglycerides from terminally differentiated human visceral adipocytes were investigated. Therefore, this enzyme may be a useful tool for the production of O-methylated polyphenols, which are present at low levels in plants, as well as the elucidation of their functions. Fig. 5. Chemical structures that can and cannot be catalyzed by FvOMT. Pyrogallol and pyrocatechol were recognized, whereas resorcinol, phloroglucinol, and phenol were not.
without a proton at 1 position (Fig. 5). On the other hand, several compounds, such as resorcinol, phloroglucinol, and phenol structures, were not methylated by Fv-OMT. Although an EGCG4′,3″,5″triMe peak was detected when EGCG was used as a substrate, no peaks by the methylated compounds of (–)-epicatechin, (–)-epigallocatechin, (+)-catechin, and (–)-gallocatechin were detected by HPLC. However, the molecular weights of these methylated compounds were
References [1] Manach C, Williamson G, Morand C, Scalbert A, Rémésy C. Bioavailability and bioefficacy of polyphenols in humans. I. Review of 97 bioavailability studies. Am. J. Clin. Nutr. 2005;81:230S–242S. [2] Williamson G, Manach C. Bioavailability and bioefficacy of polyphenols in humans. II. Review of 93 intervention studies. Am. J. Clin. Nutr. 2005;81:243S–255S. [3] Otake Y, Hsieh F, Walle T. Glucuronidation versus oxidation of the flavonoid galangin by human liver microsomes and hepatocytes. Drug Metab. Dispos. 2002;30:576–581. [4] Wen X, Walle T. Methylated flavonoids have greatly improved intestinal absorption and metabolic stability. Drug Metab. Dispos. 2006;34:1786–1792.
Downloaded by [University of Arizona] at 18:10 19 April 2015
8
M. Kirita et al.
[5] Sano M, Suzuki M, Miyase T, Yoshino K, Maeda-Yamamoto M. Novel antiallergic catechin derivatives isolated from oolong tea. J. Agric. Food. Chem. 1999;47:1906–1910. [6] Maeda-Yamamoto M, Ema K, Shibuichi T. In vitro and in vivo anti-allergic effect of `benifuuki` green tea containing O-methylated catechin and ginger extract enhancement. Cytotechnology. 2007;55:135–142. [7] Kirita M, Tanaka Y, Tagashira M, Kanda T, Maeda-Yamamoto M. Purification and characterization of a novel O-methyltransferase from Flammulina velutipes. Biosci. Biotechnol., Biochem. 2014;78:806–811. [8] Coulter C, Kennedy JT, McRoberts WC, Harper DB. Purification and properties of an S-adenosylmethionine: 2,4-Disubstituted phenol O-methyltransferase from Phanerochaete chrysosporium. Appl. Environ. Microbiol. 1993;59:706–711. [9] Jeffers MR, McRoberts WC, Harper DB. Identification of a phenolic 3-O-methyltransferase in the lignin-degrading fungus Phanerochaete chrysosporium. Microbiology. 1997;143: 1975–1981. [10] Kirita M, Honma D, Tanaka Y, Usui S, Shoji T, Sami M, Yokota T, Tagashira M, Muranaka A, Uchiyama M, Kanda T, MaedaYamamoto M. Cloning of a novel O-methyltransferase from Camellia sinensis and synthesis of O-methylated EGCG and evaluation of their bioactivity. J. Agric. Food. Chem. 2010;58: 7196–7201.
[11] Tanaka H, Yamanouchi M, Miyoshi H, Hirotsu K, Tachibana H, Takahashi T. Solid-phase synthesis of a combinatorial methylated (±)-epigallocatechin gallate library and the growth-inhibitory effects of these compounds on melanoma B16 cells. Chem. Asian J. 2010;5:2231–2248. [12] Joshi CP, Chiang VL. Conserved sequence motifs in plant S-adenosyl-L-methionine-dependent methyltransferases. Plant. Mol. Biol. 1998;37:663–674. [13] Ferrer JL, Zubieta C, Dixon RA, Noel JP. Crystal structures of alfalfa caffeoyl coenzyme a 3-o-methyltransferase. Plant Physiol. 2005;137:1009–1017. [14] Wymelenberg AV, Minges P, Sabat G, Martinez D, Aerts A, Salamov A, Grigoriev I, Shapiro H, Putnam N, Belinky P, Dosoretz C, Gaskell J, Kersten P, Cullen D. Computational analysis of the Phanerochaete chrysosporium v2.0 genome database and mass spectrometry identification of peptides in ligninolytic cultures reveal complex mixtures of secreted proteins. Fungal Genet. Biol. 2006;43: 343–356. [15] Tanaka Y, Kirita M, Miyata S, Abe Y, Tagashira M, Kanda T, Maeda-Yamamoto M. O-methylated theaflavins suppress the intracellular accumulation of triglycerides from terminally differentiated human visceral adipocytes. J. Agric. Food. Chem. 2013;61:12634–12639.
