Tumor Biol. DOI 10.1007/s13277-015-3476-1
RESEARCH ARTICLE
Clinicopathological significance and biological role of TCF21 mRNA in breast cancer Jie Wang 1 & Xueren Gao 1 & Mingxi Wang 2 & Jianqiong Zhang 1
Received: 30 March 2015 / Accepted: 17 April 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract TCF21 is known to function as a tumor suppressor and deregulated in several types of cancers; however, its role in breast cancer remains poorly understood. The aim of this study was to examine the expression of TCF21 messenger RNA (mRNA) in breast cancer and evaluate its clinical significance and biological role in tumor progression. TCF21 mRNA expression was analyzed in breast cancer cell lines and tissues by qRT-PCR. Overexpression approach was used to investigate the biological functions of TCF21 mRNA in breast cancer cell line (MDA-MB-231). A notably lower level of TCF21 mRNA expression was found in breast cancer cell lines and tissues. Furthermore, the low expression of TCF21 mRNA was associated with large tumor size and positive lymph node metastasis. Functional analysis showed that overexpression of TCF21 mRNA inhibited cell proliferation and epithelial-mesenchymal transition (EMT) of MDA-MB-231. In conclusion, our data provided the first evidence that TCF21 mRNA is significantly downregulated in breast cancer cell lines and tissues and regulates breast cancer cell proliferation and EMT. Thus, TCF21 may act as a potential therapeutic target for breast cancer intervention.
Jie Wang and Xueren Gao contributed equally to this work. * Jianqiong Zhang [email protected] 1
Key Laboratory of Developmental Genes and Human Disease, Ministry of Education; Department of Microbiology and Immunology, Medical School Southeast University, Nanjing, Jiangsu, China
2
Department of Medical Oncology, The First Affiliated Hospital of Bengbu Medical College, Bengbu, Anhui, China
Keywords TCF21 . mRNA . Breast cancer . Tumor suppressor . Proliferation
Introduction Breast cancer is the most common cancer in women in both developed and developing countries [1]. Despite advancements in early detection and treatment of breast cancer, breast cancer is still the leading cause of cancerrelated death among women in the world [2]. Previous studies showed that tumor markers, including genetic polymorphism and gene expression, played an important role in evaluating and predicting breast cancer progression. For example, a single nucleotide polymorphism (1307 T>C; rs9306160) in human ribosomal RNA processing1 homolog B (Rrp1B) gene was associated with the development and progression of breast cancer. The frequency of TT genotype of Rrp1B1307T>C polymorphism was significantly elevated in patients with advanced disease [3]. The largest subunit of remodeling and spacing factor (RSF), Rsf-1, mediates ATPasedependent chromatin remodeling. High expression of Rsf-1 was significantly associated with pathologic subtypes of breast cancer, bigger tumor size, higher TNM stage, and p53-positive expression [4]. Thus, identification and evaluation of novel tumor markers could help with early detection of breast cancer or the development of novel therapeutic targets for breast cancer intervention. The deregulation of tumor suppressor gene expression could contribute to carcinogenesis. Transcription factor 21 (TCF21) gene is located on chromosome 6q23-q24 and encodes a cell-type-specific class II basic helix-loop-helix transcription factor that binds DNA through the consensus E-box sequence as a heterodimer. Normally, TCF21 is expressed at
Tumor Biol.
its highest levels during normal embryogenesis, and the expression levels rapidly decrease in postnatal tissues, with the exception of a subset of interstitial cells in several organs including the lung, kidney, and intestine. TCF21 as a tumor suppressor involved in repression of epithelial-mesenchymal transition (EMT), which has been proved to be vital for the dissemination of carcinoma cells. Previous studies suggest that TCF21 expression is downregulated in several types of cancers, including head and neck cancer and lung cancer, by promoter hypermethylation [5, 6]. Frequent aberrant methylation of the promoter region of TCF21 in non-small-cell lung cancer (NSCLC) can act as a potential biomarker for earlystage NSCLC screening [7]. In addition, TCF21 expression in human renal cell carcinoma (RCC) cell line Caki-1 is downregulated at the translational level by miR-21, which subsequently inhibits expression of the metastasis suppressor KISS1 [8]. In this study, we determined TCF21 messenger RNA (mRNA) expression in breast cancer cell lines and tissues, and assessed the relationship between TCF21 mRNA expression and clinicopathologic characteristics. In addition, overexpression method was used to detect the influence of TCF21 mRNA on proliferation and EMT of breast cancer cell line MDA-MB-231.
were cultured in DMEM (Invitrogen, San Diego, CA, USA) supplemented with 10 % (v/v) fetal bovine serum (FBS; Invitrogen, San Diego, CA, USA). All the cells were cultured at 37 °C in a humidified atmosphere with 5 % CO2 and 95 % air.
Materials and methods
Expression vector construction and transient cell transfection
Real-time qPCR Total RNA from breast cancer tissues and cells was extracted using the TRIzol protocol (Invitrogen, San Diego, CA, USA). One micrograms of total RNA was reverse transcribed using PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Otsu, Japan) according to the manufacturer’s instructions. Quantitative PCR analysis was performed with an automated sequence detection system (StepOnePlus™ Real-time PCR System, Applied Biosystems, CA, USA). Expressions of human genes βactin, TCF21, vimentin (VIM), and snail family zinc finger 1 (SNAI1) were analyzed using Power SYBR Green PCR Master Mix (Roche, Mannheim, Germany). β-Actin was employed as an internal control gene. The primers used in this study are shown in Table 1. The data were analyzed using the 2−ΔΔCT relative quantitation method.
Clinical samples A total of 39 breast cancer tissues and corresponding noncancerous tissues were collected from the Affiliated Hospital of Bengbu Medical College. Medical records were used to ascertain patients’ medical histories, including age and pathology results, such as tumor size, lymph node status, TNM stage, tumor differentiation, human epidermal growth factor receptor-2 (HER2) status, estrogen receptor (ER) status, and progesterone receptor (PR) status. Informed consent was obtained from all patients, and the research protocol was approved by the local medical ethics committee. Cell culture The human breast cancer cell lines, including MDA-MB231, BT-474 and MCF-7, and normal breast epithelial cell line MCF-10A were all purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). MCF-10A cells were cultured in Dulbecco’s modified Eagle media/F12 (DMEM/F12; Invitrogen, San Diego, CA, USA) media supplemented with 5 % horse serum, 20 ng/ml epidermal growth factor (EGF), 100 ng/ml cholera toxin, 10 μg/ml insulin, 500 ng/ml hydrocortisone, and 1 % penicillin-streptomycin solution. The other cells
Oligonucleotide primers containing XhoI or HindIII site were synthesized, respectively, for amplification of coding sequence (CDS) of TCF21 from cDNA of MCF-10A cell. The primer sequences are shown in Table 1. PrimeSTAR® Max DNA Polymerase (Takara, Otsu, Japan) was used in DNA amplification. PCR product was digested with XhoI and HindIII and subcloned into the pcDNA3.1/myc-His (-) A vector (Invitrogen, San Diego, CA, USA). The expression vector
Table 1
Primer sequences of genes used in this study
Genes
Primer sequence (5′–3′)
TCF21
Forward: GCCTTCTCCAGACTCAAGACCAC Reverse: CATAAAGGGCCACGTCAGGTTG Forward: GCTGCTAACTACCAAGACAC Reverse: TCAGGTTCAGGGAGGAAAAG Forward: ACCCACACTGGCGAGAAG Reverse: ATTCCATGGCAGTGAGAAGG Forward: GTCATTCCAAATATGAGATGCGT Reverse: GCTATCACCTCCCCTGTGTG Forward: CCGCTCGAGGCCACCATGTCCACCGGCT CCCTCAGC Reverse: CCCAAGCTTTCAGGACGCGGTGGTTCCAC
VIM SNAI1 β-Actin TCF21 CDS
Tumor Biol.
was named pcDNA3.1-TCF21 and identified by sequencing. pcDNA3.1-TCF21 or pcDNA3.1 mock vectors were transfected into MDA-MB-231 cells using the Lipofectamine 2000 (Invitrogen, San Diego, CA, USA) according to the manufacturer’s instructions. After transfection, the expression of TCF21 was detected by quantitative polymerase chain reaction (qPCR) and the growth rate of pcDNA3.1-TCF21-transfected or pcDNA3.1-transfected cells was assayed.
Table 2 TCF21 mRNA expression in breast cancer tissues and adjacent noncancerous tissues Total
39
Breast cancer tissue vs. adjacent noncancerous tissues Upregulation (>2-fold)
Unchanged (2–0.5-fold)
Downregulation (
RESEARCH ARTICLE
Clinicopathological significance and biological role of TCF21 mRNA in breast cancer Jie Wang 1 & Xueren Gao 1 & Mingxi Wang 2 & Jianqiong Zhang 1
Received: 30 March 2015 / Accepted: 17 April 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract TCF21 is known to function as a tumor suppressor and deregulated in several types of cancers; however, its role in breast cancer remains poorly understood. The aim of this study was to examine the expression of TCF21 messenger RNA (mRNA) in breast cancer and evaluate its clinical significance and biological role in tumor progression. TCF21 mRNA expression was analyzed in breast cancer cell lines and tissues by qRT-PCR. Overexpression approach was used to investigate the biological functions of TCF21 mRNA in breast cancer cell line (MDA-MB-231). A notably lower level of TCF21 mRNA expression was found in breast cancer cell lines and tissues. Furthermore, the low expression of TCF21 mRNA was associated with large tumor size and positive lymph node metastasis. Functional analysis showed that overexpression of TCF21 mRNA inhibited cell proliferation and epithelial-mesenchymal transition (EMT) of MDA-MB-231. In conclusion, our data provided the first evidence that TCF21 mRNA is significantly downregulated in breast cancer cell lines and tissues and regulates breast cancer cell proliferation and EMT. Thus, TCF21 may act as a potential therapeutic target for breast cancer intervention.
Jie Wang and Xueren Gao contributed equally to this work. * Jianqiong Zhang [email protected] 1
Key Laboratory of Developmental Genes and Human Disease, Ministry of Education; Department of Microbiology and Immunology, Medical School Southeast University, Nanjing, Jiangsu, China
2
Department of Medical Oncology, The First Affiliated Hospital of Bengbu Medical College, Bengbu, Anhui, China
Keywords TCF21 . mRNA . Breast cancer . Tumor suppressor . Proliferation
Introduction Breast cancer is the most common cancer in women in both developed and developing countries [1]. Despite advancements in early detection and treatment of breast cancer, breast cancer is still the leading cause of cancerrelated death among women in the world [2]. Previous studies showed that tumor markers, including genetic polymorphism and gene expression, played an important role in evaluating and predicting breast cancer progression. For example, a single nucleotide polymorphism (1307 T>C; rs9306160) in human ribosomal RNA processing1 homolog B (Rrp1B) gene was associated with the development and progression of breast cancer. The frequency of TT genotype of Rrp1B1307T>C polymorphism was significantly elevated in patients with advanced disease [3]. The largest subunit of remodeling and spacing factor (RSF), Rsf-1, mediates ATPasedependent chromatin remodeling. High expression of Rsf-1 was significantly associated with pathologic subtypes of breast cancer, bigger tumor size, higher TNM stage, and p53-positive expression [4]. Thus, identification and evaluation of novel tumor markers could help with early detection of breast cancer or the development of novel therapeutic targets for breast cancer intervention. The deregulation of tumor suppressor gene expression could contribute to carcinogenesis. Transcription factor 21 (TCF21) gene is located on chromosome 6q23-q24 and encodes a cell-type-specific class II basic helix-loop-helix transcription factor that binds DNA through the consensus E-box sequence as a heterodimer. Normally, TCF21 is expressed at
Tumor Biol.
its highest levels during normal embryogenesis, and the expression levels rapidly decrease in postnatal tissues, with the exception of a subset of interstitial cells in several organs including the lung, kidney, and intestine. TCF21 as a tumor suppressor involved in repression of epithelial-mesenchymal transition (EMT), which has been proved to be vital for the dissemination of carcinoma cells. Previous studies suggest that TCF21 expression is downregulated in several types of cancers, including head and neck cancer and lung cancer, by promoter hypermethylation [5, 6]. Frequent aberrant methylation of the promoter region of TCF21 in non-small-cell lung cancer (NSCLC) can act as a potential biomarker for earlystage NSCLC screening [7]. In addition, TCF21 expression in human renal cell carcinoma (RCC) cell line Caki-1 is downregulated at the translational level by miR-21, which subsequently inhibits expression of the metastasis suppressor KISS1 [8]. In this study, we determined TCF21 messenger RNA (mRNA) expression in breast cancer cell lines and tissues, and assessed the relationship between TCF21 mRNA expression and clinicopathologic characteristics. In addition, overexpression method was used to detect the influence of TCF21 mRNA on proliferation and EMT of breast cancer cell line MDA-MB-231.
were cultured in DMEM (Invitrogen, San Diego, CA, USA) supplemented with 10 % (v/v) fetal bovine serum (FBS; Invitrogen, San Diego, CA, USA). All the cells were cultured at 37 °C in a humidified atmosphere with 5 % CO2 and 95 % air.
Materials and methods
Expression vector construction and transient cell transfection
Real-time qPCR Total RNA from breast cancer tissues and cells was extracted using the TRIzol protocol (Invitrogen, San Diego, CA, USA). One micrograms of total RNA was reverse transcribed using PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Otsu, Japan) according to the manufacturer’s instructions. Quantitative PCR analysis was performed with an automated sequence detection system (StepOnePlus™ Real-time PCR System, Applied Biosystems, CA, USA). Expressions of human genes βactin, TCF21, vimentin (VIM), and snail family zinc finger 1 (SNAI1) were analyzed using Power SYBR Green PCR Master Mix (Roche, Mannheim, Germany). β-Actin was employed as an internal control gene. The primers used in this study are shown in Table 1. The data were analyzed using the 2−ΔΔCT relative quantitation method.
Clinical samples A total of 39 breast cancer tissues and corresponding noncancerous tissues were collected from the Affiliated Hospital of Bengbu Medical College. Medical records were used to ascertain patients’ medical histories, including age and pathology results, such as tumor size, lymph node status, TNM stage, tumor differentiation, human epidermal growth factor receptor-2 (HER2) status, estrogen receptor (ER) status, and progesterone receptor (PR) status. Informed consent was obtained from all patients, and the research protocol was approved by the local medical ethics committee. Cell culture The human breast cancer cell lines, including MDA-MB231, BT-474 and MCF-7, and normal breast epithelial cell line MCF-10A were all purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). MCF-10A cells were cultured in Dulbecco’s modified Eagle media/F12 (DMEM/F12; Invitrogen, San Diego, CA, USA) media supplemented with 5 % horse serum, 20 ng/ml epidermal growth factor (EGF), 100 ng/ml cholera toxin, 10 μg/ml insulin, 500 ng/ml hydrocortisone, and 1 % penicillin-streptomycin solution. The other cells
Oligonucleotide primers containing XhoI or HindIII site were synthesized, respectively, for amplification of coding sequence (CDS) of TCF21 from cDNA of MCF-10A cell. The primer sequences are shown in Table 1. PrimeSTAR® Max DNA Polymerase (Takara, Otsu, Japan) was used in DNA amplification. PCR product was digested with XhoI and HindIII and subcloned into the pcDNA3.1/myc-His (-) A vector (Invitrogen, San Diego, CA, USA). The expression vector
Table 1
Primer sequences of genes used in this study
Genes
Primer sequence (5′–3′)
TCF21
Forward: GCCTTCTCCAGACTCAAGACCAC Reverse: CATAAAGGGCCACGTCAGGTTG Forward: GCTGCTAACTACCAAGACAC Reverse: TCAGGTTCAGGGAGGAAAAG Forward: ACCCACACTGGCGAGAAG Reverse: ATTCCATGGCAGTGAGAAGG Forward: GTCATTCCAAATATGAGATGCGT Reverse: GCTATCACCTCCCCTGTGTG Forward: CCGCTCGAGGCCACCATGTCCACCGGCT CCCTCAGC Reverse: CCCAAGCTTTCAGGACGCGGTGGTTCCAC
VIM SNAI1 β-Actin TCF21 CDS
Tumor Biol.
was named pcDNA3.1-TCF21 and identified by sequencing. pcDNA3.1-TCF21 or pcDNA3.1 mock vectors were transfected into MDA-MB-231 cells using the Lipofectamine 2000 (Invitrogen, San Diego, CA, USA) according to the manufacturer’s instructions. After transfection, the expression of TCF21 was detected by quantitative polymerase chain reaction (qPCR) and the growth rate of pcDNA3.1-TCF21-transfected or pcDNA3.1-transfected cells was assayed.
Table 2 TCF21 mRNA expression in breast cancer tissues and adjacent noncancerous tissues Total
39
Breast cancer tissue vs. adjacent noncancerous tissues Upregulation (>2-fold)
Unchanged (2–0.5-fold)
Downregulation (
