Citrobacter rodentium-induced colitis: A robust model to study mucosal immune responses in the gut.

JIM-11970; No of Pages 12 Journal of Immunological Methods xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Journal of Immunological Methods journal homepage: www.elsevier.com/locate/jim

Research paper

Citrobacter rodentium-induced colitis: A robust model to study mucosal immune responses in the gut Ekaterina P. Koroleva a, Sydney Halperin a, Ekaterina O. Gubernatorova a, Elise Macho-Fernandez a, Cody M. Spencer a, Alexei V. Tumanov a,b,⁎ a b

Trudeau Institute, Saranac Lake, NY 12983, USA Engelhardt Institute of Molecular Biology, Moscow, Russia

a r t i c l e

i n f o

Article history: Received 28 November 2014 Received in revised form 11 February 2015 Accepted 11 February 2015 Available online xxxx Keywords: Citrobacter rodentium Mucosal model of inflammation Infection-induced colitis

a b s t r a c t Citrobacter rodentium is a natural mouse pathogen which reproducibly infects mice and causes intestinal disease. The C. rodentium model of infection is very useful for investigating host–pathogen immune interactions in the gut, and can also be used to understand the pathogenesis of several important human intestinal disorders, including Crohn's disease, ulcerative colitis, dysbiosis and colon tumorigenesis. Both innate and adaptive immune responses play a critical role in protection against C. rodentium. Here, we summarize the role of immune components in protection against C. rodentium and describe techniques for the analysis of innate and adaptive mucosal immune responses, including setting up the infection, analysis of colonic hyperplasia and bacterial dissemination, evaluation of antibody responses, and purification and analysis of intestinal epithelial and lymphoid cells. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Gastrointestinal bacterial infections including enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) are an important cause of morbidity and mortality worldwide (Croxen et al., 2013). EPEC and EHEC cause characteristic attaching and effacing (A/E) lesions in the infected intestine with tight attachment of bacteria to enterocytes, effacement of microvilli structures, and remodeling of the intestinal epithelium (Nataro and Kaper, 1998; Clements et al., 2012). Citrobacter rodentium is a natural mouse gram negative mucosal pathogen that shares several pathogenic mechanisms with human EPEC and EHEC infections (Collins et al., 2014). Therefore, C. rodentium infection of mice serves as an excellent tool to study the molecular basis of these pathogenic infections in vivo. Additionally, the ability of C. rodentium to regulate epithelial barrier integrity, mucosal ⁎ Corresponding author at: Trudeau Institute, Saranac Lake, NY 12983, USA. Tel.: +1 518 891 3080; fax: +1 518 891 5126. E-mail address: [email protected] (A.V. Tumanov).

healing, inflammation, and composition of commensal microbiota makes it a robust model to study the pathogenesis of human intestinal disorders including inflammatory bowel disease, dysbiosis, and tumorigenesis (Chandrakesan et al., 2014; Collins et al., 2014; Pickard et al., 2014). The molecular mechanisms of C. rodentium-induced pathogenesis have been summarized in recent reviews (Mundy et al., 2005; Borenshtein et al., 2008; Collins et al., 2014). Unfortunately, detailed experimental protocols for working with the C. rodentium model are limiting (Mundy et al., 2005; Smith et al., 2011; Bhinder et al., 2013). Therefore, in this manuscript we will describe techniques used for analyzing innate and adaptive mucosal immune responses, setting up a C. rodentium infection, analyzing colonic hyperplasia and bacterial dissemination, evaluation of antibody responses, and purification and analysis of intestinal epithelial and lymphoid cells. Oral challenge of C57BL6 mice with 108–109 cfu of C. rodentium provides a robust model of infectious colitis including development of transmissive murine crypt hyperplasia (TMCH), and infiltration of immune cells to the colon (Mundy et al., 2005; Borenshtein et al., 2008). C. rodentium-

http://dx.doi.org/10.1016/j.jim.2015.02.003 0022-1759/© 2015 Elsevier B.V. All rights reserved.

Please cite this article as: Koroleva, E.P., et al., Citrobacter rodentium-induced colitis: A robust model to study mucosal immune responses in the gut, J. Immunol. Methods (2015), http://dx.doi.org/10.1016/j.jim.2015.02.003

2

E.P. Koroleva et al. / Journal of Immunological Methods xxx (2015) xxx–xxx

induced colitis is influenced by the genetic background of the host: in some strains infection is lethal, whereas in others it causes only minimal inflammation and tissue damage (See Table 1). Immunocompetent mice, such as C57BL6 are resistant to C. rodentium and develop only mild disease, whereas various genetically modified mice display severe diarrhea and colon inflammation and ultimately succumb to infection (Mundy et al., 2005) (see Table 1). After oral injection of C. rodentium, the bacteria colonize the cecum during the first day of infection, progressing to the distal colon at days 2–3 post infection.

Increased growth of C. rodentium in the colon results in a pronounced dysbiosis and a reduction in the overall diversity of commensal microbiota (Lupp et al., 2007; Collins et al., 2014). In the absence of proper protective immune mechanisms, C. rodentium disseminates systemically and can be detected in the blood, and peripheral organs, such as the spleen and liver. Additionally, C. rodentium may induce liver damage after infection (Raczynski et al., 2012). The mechanisms inducing inflammation following infection with C. rodentium involve activation of cytokine production in

Table 1 Role of immune components in protection against C. rodentium.

Innate

Components

Genetic or biochemical inhibition

Sensitivity

References

Group 3 ILCs

Rorc−/−, Ahr−/−, Plzf−/−, Gata3−/−, Rag/IL2Rg−/−, Nfil3−/−, Cxcr6−/−, RORγt-Ltb−/−, RORγt-STAT3−/−, RORγt-Ahr−/−, Thy1 and NK1.1. antibody depletion in Rag1−/− mice CD11c-DTR, zDC-DTR, CD11cNotch2−/−, Zbtb46-DTR, Flt3l−/− LysmCre × Csf1rLsL-DTR, Ccr2−/−, CX3CR1GFP/GFP, CX3CR1-DTR c-kit−/− (w/Wv mice) Cxcr2−/−, Ly6G antibody depletion NK1.1 depletion Tcrd−/− Rag1−/−, Rag2−/− Cd4−/−, Tcrb−/−, CD4 antibody depletion μMT−/− CD8α−/−, CD8 antibody depletion Th17 cell transfer T-bet (Tbx21−/−) Lta−/−, Ltb−/−, Ltbr−/−, RORγt-Ltb−/− Il22−/−, IL-22 blocking antibody Il23a−/−, Il23r−/−

+++

(Satoh-Takayama et al., 2008; Cella et al., 2009; Wang et al., 2010; Kiss et al., 2011; Sonnenberg et al., 2011; Tumanov et al., 2011; Lee et al., 2012; Geiger et al., 2014; Guo et al., 2014; Serafini et al., 2014)

+/++

(Hirata et al., 2010; Satpathy et al., 2013; Schreiber et al., 2013) (Manta et al., 2013; Satpathy et al., 2013; Schreiber et al., 2013; Longman et al., 2014) Wei et al. (2005) (Spehlmann et al., 2009; Wang et al., 2010) Reid-Yu et al. (2013) Bry and Brenner (2004) (Vallance et al., 2002; Bry and Brenner, 2004) (Simmons et al., 2003; Bry and Brenner, 2004; Shiomi et al., 2010) (Simmons et al., 2003; Bry and Brenner, 2004) (Simmons et al., 2003; Bry and Brenner, 2004) Basu et al. (2012) Basu et al. (2012) (Spahn et al., 2004; Wang et al., 2010; Ota et al., 2011; Tumanov et al., 2011) Zheng et al. (2008) (Mangan et al., 2006; Zheng et al., 2008; Basu et al., 2012; Singh et al., 2014) (Simmons et al., 2002; Zheng et al., 2008) Song et al. (2011) (Zheng et al., 2008; Ishigame et al., 2009) (Dann et al., 2008; Basu et al., 2012) Lebeis et al. (2009) (Lebeis et al., 2009; Liu et al., 2012) (Simmons et al., 2002; Shiomi et al., 2010) Hirata et al. (2010) (Goncalves et al., 2001; Fritz et al., 2012) (Dann et al., 2014) (Lebeis et al., 2007; Gibson et al., 2008a) (Vallance et al., 2003; Khan et al., 2006) Gibson et al. (2008b) Geddes et al. (2011) Dennis et al. (2008) Hu et al. (2013) Guo et al. (2014) (Liu et al., 2012; Nordlander et al., 2014; Song-Zhao et al., 2014; Wlodarska et al., 2014) Bergstrom et al. (2010) Singh et al. (2014) (Vallance et al., 2003; Willing et al., 2011; Papapietro et al., 2013) (Lupp et al., 2007; Ivanov et al., 2009; Willing et al., 2011)

DC Monocytes/macrophages

Adaptive

Cytokines

Mast cells Neutrophils NK cells γδ T cells T and B cells CD4+ T cells B cells CD8+ T cells Th17 cells Th22 cells LTα, LTβ, LTβR IL-22 IL-23, IL-23R

Other

+ ++ + + +++ ++/+++ ++/+++ − + ++ +++ +++ +++ ++/+++ ++ −/+ ++ ++ + + + + − +++ ++ − + + + +++ +

Muc2 DOCK8 Inbred strains

Il12b−/− Il17re−/− Il17rc−/−, Il17a−/−, Il17f−/− IL6−/− IL1r−/− Il18−/− IFNγ−/− Csf2−/− Tnfrsf1a−/−,Tnf−/−Inos−/− Il10−/− Myd88−/− C3H/HeJ, C57BL/10ScNJ Tlr2−/− Nod1−/−Nod2−/− Nfkb1 −/− Otud7b−/− RORγt-Stat3–/– Casp1−/−, Nlrp3−/−, Nlrc4−/−, Nlrp6−/−, Asc−/− Muc2−/− Dock8−/− C3H/HeOuJ,C3H/HeOuJ, FVB, AKR

Commensal Microbiota

Germ-free mice

+

IL-12 IL-17C, IL-17RE IL-17A,F;IL-17RC IL-6 IL-1R IL-18 IFN-γ GM-CSF TNF, TNFR1 IL-10 MyD88 TLR4 TLR2 Nod1,2 NF-kB p50 NF-kB non-canonical STAT3 Inflammasome

++ +++ +++

Sensitivity. +++ 100% of mice succumb to infection. ++ reduced survival, increased pathology. + impaired clearance of bacteria, all mice survive infection. − not required for protection.



3

IL-22 production by CD4+ T cells (Th22) during the adaptive stage also contributes to protection against C. rodentium (Basu et al., 2012). In contrast to group 3 RORγt+ ILCs which produce IL-22 in response to IL-23, IL-22 production by CD4+ T cells is dependent on IL-6 and the transcription factors T-bet and Ahr (Basu et al., 2012). The composition of the intestinal microbiota has recently been recognized as an important factor influencing the immune response and susceptibility to C. rodentium infection (for an excellent review see Collins et al., 2014). C. rodentium infected mice develop colitis, associated with pronounced dysbiosis, overgrowth of C. rodentium and a consequent reduction in the abundance and overall diversity of the resident microbiota (Lupp et al., 2007). As a dysregulated immune response to microbiota can contribute to the pathogenesis of inflammatory bowel disease (IBD), C. rodentium infection in mice can help elucidate the potential mechanisms of IBD pathogenesis.

the epithelium coincident with bacterial attachment, and stimulation of the immune system by bacterial antigens. Importantly, both innate and adaptive immune components are critical for controlling C. rodentium. Table 1 summarizes the contribution of innate and adaptive immune cells, cytokines, and signaling pathways that contribute to protection against C. rodentium. Whereas some genetically mutant strains are extremely sensitive to C. rodentium and all succumb to infection, others show only a partial sensitivity and pathology. Recent studies highlight a critical role for group 3 innate lymphoid cells (ILCs) in protection against C. rodentium (Cella et al., 2009; Ivanov et al., 2009; Geddes et al., 2011; Sonnenberg et al., 2011; Tumanov et al., 2011; Basu et al., 2012; Fritz et al., 2012). Group 3 ILC development is dependent on the transcription factor RORγt, as such Rorc- and Rag/Il2rg-deficient mice succumb early to infection (Fig. 1a and (Satoh-Takayama et al., 2008; Wang et al., 2010)). The protective mechanism by which RORγt+ ILCs mediate mucosal protection includes expression of surface heterotrimeric lymphotoxin (LTβ2LTα1) which signals via lymphotoxin beta receptor (LTβR) on DCs, macrophages and epithelial cells to induce production of IL-23 (Wang et al., 2010; Tumanov et al., 2011; Macho-Fernandez et al., 2015). IL-23, in turn, activates IL-23R on ILCs to produce IL-22 which signals via IL-22R on intestinal epithelial cells to drive the expression of antibacterial proteins and promote epithelial barrier integrity and epithelial cell regeneration via a STAT3-dependent mechanism (Sugimoto et al., 2008; Cella et al., 2009; Grivennikov et al., 2009; Pickert et al., 2009). Additionally, LTβR signaling in intestinal epithelial cells contributes to protection by driving production of the chemokines CXCL1 and CXCL2, which recruit neutrophils to the lamina propria early following infection (Wang et al., 2010). As shown in Table 1, mice deficient in IL-22, LTβR, IL-23p19, IL-12p40, or IL-23R are extremely sensitive to C. rodentium. The expression of other transcription factors regulating ILCs, such as AHR, GATA3, Nfil3, and STAT3 also contributes to protection against C. rodentium (SatohTakayama et al., 2008; Wang et al., 2010; Kiss et al., 2011; Lee et al., 2012; Geiger et al., 2014; Guo et al., 2014; Serafini et al., 2014).

2. Methods 2.1. Animals C57BL/6, Rag1−/−, μMT−/− and Rorc−/− mice were originally obtained from The Jackson Laboratory (Bar Harbor) and bred at Trudeau Institute. RORγt-Ltb−/− mice were previously described (Wang et al., 2010; Kruglov et al., 2013). All mice used in this study were on a C57BL/6 background and maintained under specific pathogen free conditions. Mice that lost more than 20% of their initial body weight post infection were euthanized. All animal studies were performed in accordance with the National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of the Trudeau Institute. 2.2. Bacterial infection To induce bacterial colitis, mice were orally gavaged with 2 × 109 CFU C. rodentium strain DBS100 (ATCC 51459; American Type Culture Collection). Mice were fasted for 8

A

B

Survival, %

100

C57Bl6

C57Bl6 Rorc-/Rag1-/μMT-/-

80 60 40 20

RORγt-Ltb-/-

C

C57Bl6

RORγt-Ltb-/-

0 0

20

40

60

80

days post infection Innate

Adaptive

Fig. 1. Survival kinetics of different strains of mice infected with C. rodentium. Mice were orally infected with 2 × 109 CFU C. rodentium. A. Survival kinetics. Mice were monitored daily and euthanized when they lost 20% of initial body weight. Data represent three experiments, n = 8–14 mice per group. B. Representative images of colons at day 8 post infection. C. Representative hematoxylin and eosin staining of colon sections at day 8 post infection. Bars = 100 μm. Arrow indicates bacterial lesion.


4


hours prior to oral inoculation of C. rodentium in a total volume of 0.2 ml per mouse. Bacterial cultures used for infection were serially diluted in PBS and plated on MacConkey agar plates to confirm the colony-forming units (CFUs) administered. 2.3. Measurement of C. rodentium load in infected mice Fecal samples were collected and weighed, then homogenized in sterile PBS using a hand-held homogenizer (TissueTearor, BioSpec Products). Serially diluted homogenates were plated on MacConkey agar plates. C. rodentium colonies were identified as pink colonies with narrow white trim after 18–24 h of incubation at 37 °C. Spleens, livers and colons were aseptically removed from mice and homogenized in sterile PBS. Organ colonization was assessed as described for fecal specimens. 2.4. ELISA ELISA plates (Immulon 2HB, Thermo scientific) were coated with C. rodentium protein extract (5 μg/ml) (described below in Protocol 2), overnight at 4 °C. Plates were washed with PBS/0.2% Tween 20, blocked with 1% BSA/PBS for 1 h and washed again prior to addition of serially diluted serum samples. Plates were incubated overnight at 4 °C, washed, and then incubated with HRP-conjugated anti-mouse IgG, IgA, IgG1, IgG2c, IgG3 (Southern Biotech) for 1 h. After the final wash, plates were incubated with ABTS substrate (Thermo Scientific) and the absorbance at OD405 read using a Spectramax plus plate reader (Molecular Devices). Antibody titers were assigned by determining the highest dilution of serum that exhibited OD405 above 0.19. The minimum detectable titer was 33. 2.5. RNA isolation, reverse transcription, and real-time PCR Total RNA from frozen tissue was isolated using RNeasy Mini Kit (Qiagen). cDNA was synthesized using MLV Reverse Transcriptase (Promega) and random primers (Invitrogen). Quantitative real-time PCR reactions were performed using Power Sybr Green PCR master mix and a 7500 cycler (Applied Biosystems). Relative mRNA expression of the target gene was determined using the comparative 2−ΔΔCt method. The following primers were used to measure mRNA expression: RegIIIγ (ATGGCTCCTATTGCTATGCC, GATGTCCTGAGGGCCTCTT, 86 bp); RegIIIβ (ATGGCTCCTATTGCTATGCC, GATGTCCTGAGGG CCTCTT, 87 bp), and Gob5 (ACTAAGGTGGCCTACCTCCAA, GGAGGTGACAGTCAAGGTGAG, 101 bp). PCR conditions for all primers: 50C 2 min, 95C 10 min, (95C 15 s, 60C 60 s–40 cycles).

then washed with flow cytometry staining buffer (FACS, 2% FBS in PBS) in the presence of brefeldin A (10 μg/ml) and centrifuged for 5 min at 310 g (1200 rpm). Following centrifugation the cells were incubated in Fc blocking agent (anti-CD16/CD32) diluted 1:500 in FACS buffer in the presence of brefeldin A (10 μg/ml) for 10 min on ice and centrifuged for 5 min at 310 g (1200 rpm). Cells then were incubated with fluorochrome-conjugated primary antibody in FACS buffer in the presence of brefeldin A (10 μg/ml) for 30 min on ice. Following primary antibody incubation cells were washed twice in 1× PBS and fixed/permeabilized in Foxp3 Fixation/ Permeabilization solution (eBioscience) overnight at 4 °C. Cells were then washed twice in 1× Permeabilization Buffer (eBioscience) and incubated in fluorochrome-conjugated antibody specific to IL-22 diluted in 1× Permeabilization Buffer at room temperature for 30 min. Finally, cells were washed twice with 1× PBS and resuspended in 1% paraformaldehyde solution. For evaluation of RORγt+ ILCs, Lineage cocktail (anti-mouse CD3, Ly-6G/Ly-6C, CD11b, CD45R/B220, TER-119, Biolegend) was used. Flow cytometry was performed using an LSRII flow cytometer (BD Biosciences). Data were analyzed using FlowJo vX software (TreeStar). 2.7. Histological analysis For immunohistochemistry, intestines were fixed in 10% neutral-buffered formalin solution for at least 72 h. All tissues samples were then dehydrated, cleared, embedded in paraffin, and sectioned (4- to 5-μm thick). For hematoxylin and eosin staining slides were deparaffinized using Xylene and hydrated to distilled water. Slides were then stained in Gill 3 hematoxylin (Richard-Allan Scientific) for 1 min, washed in running tap water, incubated in clarifying solution (2% Acetic acid) for 1 min, washed in running tap water, incubated in bluing solution (1% Sodium bicarbonate) for 1 min, washed in running tap water, incubated in 70% ethanol for 1 min, counter stained in eosin V (Richard-Allan Scientific) for 2 min, dehydrated to 100% ethanol, cleared in xylene, and mounted with Cytoseal 60 (Thermo Scientific) mounting medium. For Alcian Blue and nuclear fast red staining slides were deparaffinized using Xylene and hydrated to distilled water. Slides were then incubated in 3% acetic acid for 3 min, stained in Alcian Blue solution pH 2.5 (American MasterTech) for 45 min, washed in running tap water, counter stained in nuclear fast red solution (American MasterTech) for 5 min, washed in running tap water, dehydrated to 100% ethanol, cleared in xylene, and mounted with Cytoseal 60 (Thermo Scientific) mounting medium. Images were taken using Zeiss Axiophot 2 microscope equipped with Zess Axiocam digital camera.

2.6. Flow cytometry 3. Results Fluorochrome-conjugated antibodies against mouse CD45 (30-F11), CD3 (145-2C11), CD8 (53-6.7), B220 (RA3-6B2), CD11b (M1/70), CD11c (N418), Gr1 (RB6-8C5), TER119 (TER119), CD4 (RM4-5), RORγt (Q31-378), IL-22 (1H8PWSR), RORγt (2B2), and EpCAM (G8.8) were purchased from eBioscience, BD Pharmingen, or Biolegend. For intracellular IL-22 staining, cells were stimulated with IL-23 (50 ng/ml) in the presence of brefeldin A (10 μg/ml) for 4 h at 37 °C. Following stimulation the cells were centrifuged for 5 min at 310 g (1200 rpm) and the supernatant discarded. Cells were

3.1. Both innate and adaptive immune components are critical for protection against C. rodentium To define the relative role of distinct innate and adaptive immune cell types in the protection against C. rodentium, we infected several mutant mouse strains with C. rodentium and monitored their survival. 6–10 week old C57BL6 (WT controls), T and B-cell deficient (Rag1−/−) mice, B-cell deficient (μMT−/−) mice, mice lacking RORγt+ group 3 ILCs and Th17 cells (Rorc−/−



mice) and mice lacking surface lymphotoxin (LT) expression on RORγt+ cells (RORγt-Ltb−/− mice) were orally infected with 2 × 109 CFU. To prepare C. rodentium cultures for infection, the following protocol was developed: 3.1.1. Protocol 1. Preparation of C. rodentium for infection a. Thaw a frozen glycerol stock of C. rodentium and plate it on a MacConkey agar plate. Incubate the plate overnight at 37 °C. b. The following day inoculate 5 ml of sterile LB media with a single C. rodentium colony, incubate 6–8 h at 37 °C in an incubator shaker rotating at 200 rpm. c. Transfer 5 ml of culture into an Erlenmeyer flask containing 200 ml of sterile LB media. Incubate the flask overnight at 37 °C in an incubator shaker rotating at 200 rpm. d. The following day use a spectrophotometer to measure the absorbance of the culture at 600 nm and determine the concentration of bacteria by comparing the OD600 to a standard bacterial concentration curve for C. rodentium. Based on our experience, the bacterial concentration after 15 hours of growth is in the range of 5–10 × 108 CFU/ml. Centrifuge the culture for 10 min at 3480g (400rpm) and resuspend the pellet in sterile PBS. Following infection all Rorc−/− mice succumbed rapidly within the first 7–12 days. Remarkably, similar mortality kinetics are characteristic of mice deficient in components of the IL-23 and IL-22 pathways (Il22−/−, Il23a−/−, Il12b−/−, Il23r−/−) and the LT pathway (Lta−/−, Ltb−/−, Ltbr−/−) (Table 1). Interestingly, mice lacking both T and B cells (Rag1−/− mice) succumbed to infection thirty to forty days prior to B-cell deficient μMT−/− mice, pointing to a critical antibody independent role for T cells in protection against C. rodentium. CD4+ T cells contribute to protection via production of various cytokines including IL-22, IFN-γ, and IL17 (Basu et al., 2012). Gamma delta T cells have also been shown to contribute to early protection by producing IL-17 and IFNγ (Geddes et al., 2011; Rubino et al., 2012). In contrast to CD4+ T cells, cytotoxic CD8+ T cell responses are not critical for protection (Simmons et al., 2003). These results highlight the contribution of both innate and adaptive immune components during the course of infection. Therefore, monitoring the kinetics of survival and body weight loss of various genetically modified mice is a strategy that can be successfully used to reveal which aspect of the immune response, innate or adaptive, is mostly affected in a given strain of mice. 3.2. Colonization of the colon and the production of antibacterial proteins C. rodentium has an extraordinary ability to colonize the mouse colon; at the peak of infection it can replace up to 90% of the normal flora (Lupp et al., 2007). To determine the kinetics of C. rodentium colonization, we infected C57BL6 mice with C. rodentium and determined the bacterial load in the colon at different time points post infection using MacConkey agar plates. As shown in Fig. 2, C. rodentium can be detected in the colon 24–48 h after oral infection. The peak of colonic colonization is at 10–12 days post infection and can reach 108–109 CFU per colon (Fig. 2A). By day 15 post infection C. rodentium begins to be gradually eliminated from the colon and becomes undetectable by day 21. These colonization

5

kinetics largely correlate with the expression kinetics of antibacterial RegIIIγ and RegIIIβ proteins (Fig. 2B–C). IL-22dependent RegIIIγ secretion is crucial for protection against C. rodentium, as exogenously added RegIIIγ rescues IL-22deficient mice from mortality and morbidity (Zheng et al., 2008). We noticed that fasting mice for 8 h prior to infection increases the speed of initial colonization. Therefore, when analysis of early immunologic evens after infection is desired, we recommend fasting mice prior to infection. However, for long term survival experiments fasting mice is not necessary. We also found that several mouse strains including those sensitive to infection displayed similar bacterial titers in colon or feces during the first 10 days of infection (data not shown). Nevertheless, the kinetics of bacterial clearance from the colon at later time points (Nday 12) can be a valuable parameter to determine the sensitivity of mice to infection. In contrast to bacterial titers in colon, analysis of bacterial dissemination to different organs (such as the spleen, liver, draining lymph node or blood) can be used as a parameter to access the sensitivity of a particular mouse strain, since C57BL6 mice typically do not display detectable levels of C. rodentium in organs after days 7–10 post infection. 3.3. Transmissible colonic hyperplasia and goblet cell depletion after C. rodentium infection Transmissible murine colonic hyperplasia (TMCH) is a characteristic feature of C. rodentium infection. It presents as an elongation of the colonic crypts and thickening of the mucosa which is caused by excessive induction of epithelium regeneration and repair mechanisms (Luperchio and Schauer, 2001; Mundy et al., 2005). TMCH is triggered by the loss of epithelial barrier integrity and the translocation of bacteria into the lamina propria, and is associated with activation of the Wnt/b-catenin, Notch and NF-kB signaling pathways (Ahmed et al., 2012; Chandrakesan et al., 2012, 2014; Umar, 2012; Collins et al., 2014). Since the signaling pathways that regulate epithelial proliferation and reparation processes during TMCH are similar to those observed in human IBD (Higgins et al., 1999; Chandrakesan et al., 2014), C. rodentium infection in the mouse can be a useful model to investigate the mechanisms of epithelial injury and regeneration in human disease. TMCH is associated with a relative decrease in the number of goblet cells in the colon (Luperchio and Schauer, 2001). Hyperplasia does not depend on T or B cells, as it is found in Rag1−/− mice lacking both these cell populations (Vallance et al., 2002), suggesting a direct effect of the bacteria on epithelial cells. However, Rag1−/− mice do not exhibit a reduction in the number of goblet cells after C. rodentium infection (Bergstrom et al., 2008). To examine how the colon weight/colon length ratio changes during infection, we infected C57BL6 mice with C. rodentium. Although infection did not cause significant shortening of the colon in C57BL6 mice, colon weight started to increase at day 5 post infection, reaching a maximum at two weeks post infection, and gradually began to decline at 3 weeks post infection (Fig. 3A), which correlated with histological data and BrdU staining (data not shown). Infection of mice by several enteric pathogens, including C. rodentium, leads to a dramatic reduction in the number of goblet cells, which is referred to as “goblet cell depletion”


6


B RegIIIγ/Hprt mRNA

Bacterial load, Log10 CFU/colon

10 8 6 4 2

C 5

RegIIIβ/Hprt mRNA

A

4 3 2 1 0

0 0

1

2

3

5

8 10 12 15 18 21

days post infection

0

1

2

3

5

8 10 12 15 18

days post infection

5 4 3 2 1 0 0

1

2

3

5

8 10 12 15 18

days post infection

Fig. 2. C. rodentium load in the colon correlates with the colonic expression of antibacterial proteins. C57BL6 mice were orally infected with 2 × 109 CFU C. rodentium. Bacterial load in the colon (A) and mRNA expression of antibacterial proteins RegIIIγ (B) and RegIIIβ (C) were measured at the indicated time points. The dotted line represents the minimum detection level. Ct values were normalized to hprt expression. Data represent mean ± SEM.

(Luperchio and Schauer, 2001). Intestinal goblet cells are most abundant in the distal colon and rectum, and play an important protective role in the intestine by synthesizing and secreting mucins (Kim and Ho, 2010; McGuckin et al., 2011). Muc2, the major mucin in the gut contributes to protection against C. rodentium (Bergstrom et al., 2010). Despite the protective role of mucins produced by goblet cells in host defense against C. rodentium (Bergstrom et al., 2010; Wlodarska et al., 2014),

transient goblet cell depletion during infection can also be beneficial (Chan et al., 2013). In fact, it has been demonstrated that CD4+ T cells and IFN-γ induced goblet cell depletion during C. rodentium infection correlates with increased proliferation of intestinal epithelial cells and protection against C. rodentium (Chan et al., 2013). Interestingly, we found that the colonic expression of Gob5 (mClca3), a goblet cell marker associated with goblet cell metaplasia in asthmatic airways

Fig. 3. C. rodentium infection leads to transient epithelial cell hyperplasia and goblet cell depletion. C57BL6 mice were orally infected with 2 × 109 CFU C. rodentium. Colon thickness (ratio of colon weight per colon length) (A) and mRNA expression of the goblet cell marker Clca1 (Gob5) in the colon (B) were measured at the indicated time points. Ct values were normalized to hprt expression. Data represent mean ± SEM. (C) Representative hematoxylin and eosin and Alcian Blue staining of colon sections at days 0 and 12 post infection.



(Nakanishi et al., 2001), correlated with transient goblet cell depletion caused by C. rodentium infection (Fig. 3B). TMCH and goblet cell depletion during C. rodentium infection was confirmed histologically (Fig. 3C). Therefore, evaluation of colon thickness and goblet cell depletion during C. rodentium infection can be useful to evaluate the sensitivity of different mouse strains to infection.

3.4. Analysis of specific antibody responses C. rodentium has been widely used as a tool to investigate the adaptive mucosal immune responses to bacterial infection (Mundy et al., 2005; Borenshtein et al., 2008). B cells and CD4+ T cells are crucial for the development of sterilizing immunity and resistance to C. rodentium infection, as mice lacking CD4+ T cells or B cells but not CD8+ T cells show an increased sensitivity to infection, display colonic pathology, and systemic dissemination of the bacterium (Vallance et al., 2002; Simmons et al., 2003) (Table 1, Fig. 1). CD4+ T cell-dependent humoral immunity is essential for the clearance of C. rodentium, and C. rodentium colonization elicits a robust T-helper response in the gut, which is characterized by the production of IFN-γ and TNF (Higgins et al., 1999). Both CD4- and IFN-γ-deficient mice display a compromised ability to limit the systemic dissemination of C. rodentium (Simmons et al., 2002; Shiomi et al., 2010). Serum IgG appears to mediate elimination of C. rodentium, as passive immunization with serum IgG is sufficient to protect CD4-deficient mice from fatal infection (Bry and Brenner, 2004). Although the primary antibody response at the mucosal level is secretory IgA, and an antibacterial mucosal IgA response is elicited by C. rodentium infection (Frankel et al., 1996), mice lacking IgA or secreted IgM are capable of clearing C. rodentium infection (Maaser et al., 2004). IgA- and secreted IgM-deficient mice also develop effective acquired immunity against a secondary challenge with C. rodentium (Maaser et al., 2004). In addition, recent data suggest that TNF/iNOS producing IgA+ plasma cells contribute to the optimum control of C. rodentium (Fritz et al., 2012). To study the dynamics of specific antiC. rodentium antibody responses, we developed the following protocol for the preparation of C. rodentium protein extract:

7

3.4.1. Protocol 2. C. rodentium protein extract preparation for ELISA a. Inoculate 200 ml of sterile LB media with C. rodentium. Grow culture overnight at 37 °C in an incubator shaker rotating at 200 rpm. b. The following day transfer cultures to 50 ml tubes, centrifuge at 3480 g (4000 rpm) for 10 min, and freeze the pellets at −80 °C. c. Freeze-shock bacterial pellets 3 times in liquid nitrogen with subsequent thawing in a 37 °C water bath. To ensure full lysis of bacteria sonicate pellets on ice (3 × 1 min). d. Transfer the sonicated pellets to 15 ml round-bottom tubes (total volume ~ 1.2 ml), add 5 ml of B-PER reagent (Thermo Scientific) and incubate for 30 min at RT in an incubator shaker rotating at 100 rpm. e. Centrifuge lysates for 20 min at 16,800 g (14,000 rpm), 4 °C. Collect cleared supernatant, determine protein concentration, aliquot and store at −80 °C. f. Coat ELISA plates (Immulon 2HB, Thermo scientific) with C. rodentium protein extract diluted to 5 μg/ml.

To evaluate the C. rodentium specific IgG response, we orally infected C57BL6 mice with 2 × 109 CFU C. rodentium. Mice were bled at the indicated time points, and levels of specific antibodies were measured in the sera samples (Fig. 4). Our analysis revealed that specific IgGs can be detected in some mice at days 7–10 post infection, but levels increase significantly until day 21 (Fig. 4A). Serum IgA titers follow the same kinetics, but at much lower levels (Fig. 4B). Determining the C. rodentium-specific fecal IgA levels can be challenging due to the cross-reactivity of C. rodentium protein extract with antibodies reactive to other enterobacteria (data not shown). In order to determine which IgG subclasses are more abundant during C. rodentium infection, we measured specific IgG isotypes in sera samples during the course of infection (Fig. 4C). Our analysis revealed that pathogen-specific IgG3 and IgG2c antibodies followed the same kinetic as IgG responses, with IgG1 isotype responses developing later and at lower levels (Fig. 4C).

Fig. 4. C. rodentium infection induces a specific IgG response. C57BL6 mice were orally infected with 2 × 10^9 CFU C. rodentium. Mice were bled at indicated time points and specific antibody titers in serum were determined. (A) IgG, serum dilution 1:330. (B) IgA, serum dilution 1:33. (C) Serum IgG, IgG1, IgG2c and IgG3, titers. Data represent mean ± SEM, *, p b 0.05, **, p b 0.01, ***, p b 0.001.


8


3.5. Isolation of epithelial cells and intestinal lymphoid cells for FACS analysis Epithelial cells play a critical role in the mucosal immune response to pathogens by segregating commensal microbiota and activating the underlying innate and adaptive immune responses (for a recent comprehensive review see Peterson and Artis, 2014). In fact, epithelial cells produce antibacterial RegIII proteins which are necessary for protection against C. rodentium (Zheng et al., 2008; Gallo and Hooper, 2012; Abt and Pamer, 2014; Mukherjee et al., 2014). Recent studies revealed that coordinated cross-talk between gut epithelial cells, RORγt+ ILCs, DCs and macrophages is necessary for mucosal healing, control of commensal microbiota and for generation of effective immune responses against gut pathogens (Kruglov et al., 2013; Belkaid and Hand, 2014; Longman et al., 2014; Macho-Fernandez et al., 2015; Mortha et al., 2014). Therefore, the ability to isolate primary intestinal epithelial cells and lymphoid cells from the gut during infection is key in understanding the molecular mechanisms of immune cellmediated mucosal protection. However, preparation of single epithelial cell suspensions for downstream flow cytometry analysis and in vitro cell culture can be challenging. Optimal tissue digestion conditions are imperative in that non-sufficient digestion will not allow the release of single cells from intestinal crypts, while over digestion can lead to increased epithelial cell death. We have developed the following protocol which has allowed us to obtain sufficient amounts of primary colonic epithelial cells for use in flow cytometry based applications and for in vitro cell culture. 3.5.1. Protocol 3. Isolation of intestinal epithelial cells (EC) a. To isolate EC, open intestines longitudinally, wash with cold PBS, cut into 1 cm pieces and transfer to 50 ml tubes containing 20 ml of DMEM supplemented with 5% FBS and 1 mM DTT. Briefly vortex tissues and incubate at 37 °C with slow rotation (100rpm) in incubator shaker for 20 min. Vortex vigorously for 20 s and transfer tissue pieces to a new 50 ml tube containing 20 ml PBS/15 mM EDTA. Incubate for 20 min with 170 rpm rotation (37 °C) and vortex vigorously. Separate large tissue pieces from cryptcontaining media using a 1 mm tea strainer. Remaining large tissue pieces can be used to isolate LP cells (see Protocol 4). b. Centrifuge the crypt-containing fraction at 218 g (800 rpm), wash with serum-free DMEM and resuspend in 3 ml DMEM containing 2 mg/ml of Collagenase D (Roche, #11 088 866 001, 0.155 U/mg). Incubate for 20–40 min at 37 °C with rotation (100 rpm). Control the efficiency of digestion by checking the cell suspension under a microscope. Digestion is effective when 80–90% of the crypts are degraded. Do not over digest as this will kill the epithelial cells. c. After completion of digestion, add 3 ml of DMEM containing 5% FBS and pass EC suspension through a 40 μm cell strainer. Centrifuge at 218 g (1000 rpm) for 7 min, wash once and resuspend the cells in 3 ml of complete media. d. Prepare 100% isotonic Percoll by mixing 40 ml of Percoll (GE Healthcare) with 4.4 ml of 10× PBS. Dilute isotonic 100% Percoll with 1× PBS to prepare 40% and 20% Percoll solutions. To perform the Percoll gradient separation, add 3 ml of 20% Percoll to a 15 ml tube and then pipet 3 ml of

40% Percoll underneath the 20% Percoll using a Paster pipet. Overlay the EC suspension from step c. on the top of the Percoll gradient. Centrifuge at 600 g (1650 rpm) for 30 min at room temperature (no brakes). e. Collect EC at the 20%:40% Percoll interphase (Fig. 5A), wash once with media and resuspend cells in DMEM containing 5% FBS. Avoid collecting the upper interphase which contains dying epithelial cells and debris. To isolate intestinal epithelial cells, we collected small intestines and colons with cecums from naïve and C. rodentium infected C57BL6 mice following the methods outlined in Protocol 3. In our experience, a slightly increased concentration of collagenase is required for efficient digestion of colon crypts, compared to crypts isolated from the small intestine. Increased incubation time with collagenase was required for samples collected at days 10–12 post infection since these mice developed colonic hyperplasia (Fig. 3). The enriched population of intestinal epithelial cells contained approximately 90% EpCAM+ CD45− epithelial cells and 10% EpCAM− CD45+ lymphoid cells (Fig. 5D). To further purify epithelial cells, we sorted EpCAM+ CD45− cell population using a BD influx cell sorter. An example of sorted intestinal epithelial cells in culture is shown in Fig. 5B. Both innate and adaptive immune cells participate in the protection against C. rodentium (see Table 1). Therefore, purification and analysis of distinct lymphoid cells in the gut after infection by flow cytometry are critical for understanding the role of these cells in mucosal protection. However, the protocols for purification of colonic intraepithelial lymphocytes (IELs) and lamina propria (LP) cells are still limiting (Sheridan and Lefrancois, 2012; Sanos and Diefenbach, 2010). To isolate intraepithelial lymphocytes and lamina propria cells, we developed the following protocol: 3.5.2. Protocol 4. Isolation of colonic intraepithelial lymphocytes (IELs) and lamina propria (LP) cells a. Collect large intestines from mice, cut open longitudinally, wash with ice-cold PBS and cut into 1 cm pieces. b. Incubate tissue pieces in 20 ml of pre-warmed RPMI supplemented with 3% FBS, 5 mM EDTA and 0.145 mg/ml DTT for 20 min at 37 °C with slow rotation (100 rpm). Up to three colons can be combined together during the isolation process. Add 10 ml of pre-warmed RPMI supplemented with 2 mM EDTA, vortex tissue vigorously for 30 seconds. Separate large LP containing tissue pieces from the IELcontaining fraction using a 1 mm tea strainer. Add another 10 ml of RPMI/2 mM EDTA to the large tissue pieces, vortex and separate IEL-containing media from LP-containing tissue pieces for a second time as described above. Repeat this wash/vortex step one more time and combine all IEL-containing fractions together. c. To isolate LP cells, cut remaining large colon pieces into small 1 mm2 pieces and place them in 5 ml serum-free RPMI containing 200 μg/ml Liberase (Roche) and 0.05% DNAse I (Sigma). Incubate the tissue pieces for 20 min at 37 °C with slow rotation (100 rpm). After the incubation, vortex intensely and pass cells through a 100 μm cell strainer into a clean 50 ml tube, keep tube on ice. Mix the remaining tissue pieces (that did not pass through the 100 μm cell strainer) to 5 ml of fresh RPMI/Liberase/DNAse I and digest for another



9

Fig. 5. Isolation of epithelial cells and lymphoid cells from the colon. A. Separation of epithelial cells (EC) after Percoll gradient centrifugation. B. EC in culture 12 h after sorting. C. Separation of lamina priopria lymphocytes (LPL) by Percoll gradient centrifugation. D. Flow cytometric analysis of EC after Percoll purification and post-sort purity. E. Flow cytometric analysis of IL-22 producing RORγt+ ILCs purified from colon lamina propria. IL-22 production was induced by administration of DSS to mice for 5 days.

20 minutes. Add 10 ml of RPMI supplemented with 3% FBS and 0.05% DNAse I. Pour media through cell strainer and mash larger pieces through with a syringe plunger. Combine this fraction with the first fraction of LP-containing media. d. Centrifuge IEL-and LP fractions at 500 g (1500 rpm) for 5 minutes and resuspend cells in 5 ml RPMI (3% FBS). Add 5 ml of 80% Percoll prepared from isotonic 100% Percoll, see Protocol 3 (40% Percoll fraction), mix thoroughly. Add 5 ml of 80% Percoll solution to a fresh 15 ml tube. Overlay 10 ml of 40% Percoll fraction on the top of the 80% Percoll solution. We recommend purifying LPL and IEL separately since combining the IEL and LP fractions prior to Percoll purification may reduce cell separation efficiency and yield. e. Centrifuge at 1360 g (2500 rpm) for 20 min at room temperature (no brakes). f. Collect IEL and LP cells at the 40%:80% Percoll interphase (Fig. 5C), wash cells once with PBS, and resuspend in complete RPMI media.

C57BL6 naïve and C. rodentium infected mice were euthanized, colons were removed, and colonic lymphocytes were isolated as described in Protocol 4. IL-22 production by RORγt+ group 3 ILCs is critical for protection against C. rodentium (Sonnenberg et al., 2011; Tumanov et al., 2011). An example of flow cytometric analysis of IL-22 producing RORγt+ ILCs is shown in Fig. 5E. The above protocol for IEL and LP cell isolation can be also used for purification of DCs, macrophages and neutrophils from the colon after C. rodentium infection. 4. Conclusions C. rodentium-induced colitis represents a robust model to study mucosal immune responses in the gut. C. rodentium has become a model microorganism to study not only the pathogenesis of attaching and effacing bacteria, but an extremely valuable tool to investigate the mechanisms of intestinal inflammation and mucosal healing, epithelial cell


10


physiology and the regulation of commensal microbiota. In fact, the use of C. rodentium infection has facilitated the discovery and function of new immune cell subsets in mice (such as ILC group 3, Th17, Th22, innate γδ T cells, IgA+ plasma cells) (Cella et al., 2009; Ivanov et al., 2009; Geddes et al., 2011; Sonnenberg et al., 2011; Tumanov et al., 2011; Basu et al., 2012; Fritz et al., 2012). In the current study we presented protocols successfully used in our lab to study the different aspects of the immune response to C. rodentium infection. Future studies utilizing C. rodentium model of infection will bring new insights to improve our understanding of potential mechanisms of IBD and intestinal infection. Acknowledgments This work was supported by the Crohn and Colitis Foundation of America SRA#294083 to A.V.T. A.V.T. was supported by Russian Scientific Fund #14-50-00060. We thank E. Leadbetter for the help with ELISA. References Abt, M.C., Pamer, E.G., 2014. Commensal bacteria mediated defenses against pathogens. Curr. Opin. Immunol. 29, 16. Ahmed, I., Chandrakesan, P., Tawfik, O., Xia, L., Anant, S., Umar, S., 2012. Critical roles of Notch and Wnt/beta-catenin pathways in the regulation of hyperplasia and/or colitis in response to bacterial infection. Infect. Immun. 80, 3107. Basu, R., O'Quinn, D.B., Silberger, D.J., Schoeb, T.R., Fouser, L., Ouyang, W., Hatton, R.D., Weaver, C.T., 2012. Th22 cells are an important source of IL-22 for host protection against enteropathogenic bacteria. Immunity 37, 1061. Belkaid, Y., Hand, T.W., 2014. Role of the microbiota in immunity and inflammation. Cell 157, 121. Bergstrom, K.S., Guttman, J.A., Rumi, M., Ma, C., Bouzari, S., Khan, M.A., Gibson, D.L., Vogl, A.W., Vallance, B.A., 2008. Modulation of intestinal goblet cell function during infection by an attaching and effacing bacterial pathogen. Infect. Immun. 76, 796. Bergstrom, K.S., Kissoon-Singh, V., Gibson, D.L., Ma, C., Montero, M., Sham, H.P., Ryz, N., Huang, T., Velcich, A., Finlay, B.B., Chadee, K., Vallance, B.A., 2010. Muc2 protects against lethal infectious colitis by disassociating pathogenic and commensal bacteria from the colonic mucosa. PLoS Pathog. 6, e1000902. Bhinder, G., Sham, H.P., Chan, J.M., Morampudi, V., Jacobson, K., Vallance, B.A., 2013. The Citrobacter rodentium mouse model: studying pathogen and host contributions to infectious colitis. J. Vis. Exp. e50222. Borenshtein, D., McBee, M.E., Schauer, D.B., 2008. Utility of the Citrobacter rodentium infection model in laboratory mice. Curr. Opin. Gastroenterol. 24, 32. Bry, L., Brenner, M.B., 2004. Critical role of T cell-dependent serum antibody, but not the gut-associated lymphoid tissue, for surviving acute mucosal infection with Citrobacter rodentium, an attaching and effacing pathogen. J. Immunol. 172, 433. Cella, M., Fuchs, A., Vermi, W., Facchetti, F., Otero, K., Lennerz, J.K., Doherty, J.M., Mills, J.C., Colonna, M., 2009. A human natural killer cell subset provides an innate source of IL-22 for mucosal immunity. Nature 457, 722. Chan, J.M., Bhinder, G., Sham, H.P., Ryz, N., Huang, T., Bergstrom, K.S., Vallance, B.A., 2013. CD4+ T cells drive goblet cell depletion during Citrobacter rodentium infection. Infect. Immun. 81, 4649. Chandrakesan, P., Ahmed, I., Chinthalapally, A., Singh, P., Awasthi, S., Anant, S., Umar, S., 2012. Distinct compartmentalization of NF-kappaB activity in crypt and crypt-denuded lamina propria precedes and accompanies hyperplasia and/or colitis following bacterial infection. Infect. Immun. 80, 753. Chandrakesan, P., Roy, B., Jakkula, L.U., Ahmed, I., Ramamoorthy, P., Tawfik, O., Papineni, R., Houchen, C., Anant, S., Umar, S., 2014. Utility of a bacterial infection model to study epithelial–mesenchymal transition, mesenchymal–epithelial transition or tumorigenesis. Oncogene 33, 2639. Clements, A., Young, J.C., Constantinou, N., Frankel, G., 2012. Infection strategies of enteric pathogenic Escherichia coli. Gut Microbes 3, 71. Collins, J.W., Keeney, K.M., Crepin, V.F., Rathinam, V.A., Fitzgerald, K.A., Finlay, B.B., Frankel, G., 2014. Citrobacter rodentium: infection, inflammation and the microbiota. Nat. Rev. Microbiol. 12, 612.

Croxen, M.A., Law, R.J., Scholz, R., Keeney, K.M., Wlodarska, M., Finlay, B.B., 2013. Recent advances in understanding enteric pathogenic Escherichia coli. Clin. Microbiol. Rev. 26, 822. Dann, S.M., Spehlmann, M.E., Hammond, D.C., Iimura, M., Hase, K., Choi, L.J., Hanson, E., Eckmann, L., 2008. IL-6-dependent mucosal protection prevents establishment of a microbial niche for attaching/effacing lesion-forming enteric bacterial pathogens. J. Immunol. 180, 6816. Dann, S.M., Le, C., Choudhury, B.K., Liu, H., Saldarriaga, O., Hanson, E.M., Cong, Y., Eckmann, L., 2014. Attenuation of intestinal inflammation in interleukin10-deficient mice infected with Citrobacter rodentium. Infect. Immun. 82, 1949. Dennis, A., Kudo, T., Kruidenier, L., Girard, F., Crepin, V.F., MacDonald, T.T., Frankel, G., Wiles, S., 2008. The p50 subunit of NF-kappaB is critical for in vivo clearance of the noninvasive enteric pathogen Citrobacter rodentium. Infect. Immun. 76, 4978. Frankel, G., Phillips, A.D., Novakova, M., Field, H., Candy, D.C., Schauer, D.B., Douce, G., Dougan, G., 1996. Intimin from enteropathogenic Escherichia coli restores murine virulence to a Citrobacter rodentium eaeA mutant: induction of an immunoglobulin A response to intimin and EspB. Infect. Immun. 64, 5315. Fritz, J.H., Rojas, O.L., Simard, N., McCarthy, D.D., Hapfelmeier, S., Rubino, S., Robertson, S.J., Larijani, M., Gosselin, J., Ivanov, I.I., Martin, A., Casellas, R., Philpott, D.J., Girardin, S.E., McCoy, K.D., Macpherson, A.J., Paige, C.J., Gommerman, J.L., 2012. Acquisition of a multifunctional IgA+ plasma cell phenotype in the gut. Nature 481, 199. Gallo, R.L., Hooper, L.V., 2012. Epithelial antimicrobial defence of the skin and intestine. Nat. Rev. Immunol. 12, 503. Geddes, K., Rubino, S.J., Magalhaes, J.G., Streutker, C., Le Bourhis, L., Cho, J.H., Robertson, S.J., Kim, C.J., Kaul, R., Philpott, D.J., Girardin, S.E., 2011. Identification of an innate T helper type 17 response to intestinal bacterial pathogens. Nat. Med. 17, 837. Geiger, T.L., Abt, M.C., Gasteiger, G., Firth, M.A., O'Connor, M.H., Geary, C.D., O'Sullivan, T.E., van den Brink, M.R., Pamer, E.G., Hanash, A.M., Sun, J.C., 2014. Nfil3 is crucial for development of innate lymphoid cells and host protection against intestinal pathogens. J. Exp. Med. 211, 1723. Gibson, D.L., Ma, C., Bergstrom, K.S., Huang, J.T., Man, C., Vallance, B.A., 2008a. MyD88 signalling plays a critical role in host defence by controlling pathogen burden and promoting epithelial cell homeostasis during Citrobacter rodentium-induced colitis. Cell. Microbiol. 10, 618. Gibson, D.L., Ma, C., Rosenberger, C.M., Bergstrom, K.S., Valdez, Y., Huang, J.T., Khan, M.A., Vallance, B.A., 2008b. Toll-like receptor 2 plays a critical role in maintaining mucosal integrity during Citrobacter rodentium-induced colitis. Cell. Microbiol. 10, 388. Goncalves, N.S., Ghaem-Maghami, M., Monteleone, G., Frankel, G., Dougan, G., Lewis, D.J., Simmons, C.P., MacDonald, T.T., 2001. Critical role for tumor necrosis factor alpha in controlling the number of lumenal pathogenic bacteria and immunopathology in infectious colitis. Infect. Immun. 69, 6651. Grivennikov, S., Karin, E., Terzic, J., Mucida, D., Yu, G.Y., Vallabhapurapu, S., Scheller, J., Rose-John, S., Cheroutre, H., Eckmann, L., Karin, M., 2009. IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancer. Cancer Cell 15, 103. Guo, X., Qiu, J., Tu, T., Yang, X., Deng, L., Anders, R.A., Zhou, L., Fu, Y.X., 2014. Induction of innate lymphoid cell-derived interleukin-22 by the transcription factor STAT3 mediates protection against intestinal infection. Immunity 40, 25. Higgins, L.M., Frankel, G., Douce, G., Dougan, G., MacDonald, T.T., 1999. Citrobacter rodentium infection in mice elicits a mucosal Th1 cytokine response and lesions similar to those in murine inflammatory bowel disease. Infect. Immun. 67, 3031. Hirata, Y., Egea, L., Dann, S.M., Eckmann, L., Kagnoff, M.F., 2010. GM-CSFfacilitated dendritic cell recruitment and survival govern the intestinal mucosal response to a mouse enteric bacterial pathogen. Cell Host Microbe 7, 151. Hu, H., Brittain, G.C., Chang, J.H., Puebla-Osorio, N., Jin, J., Zal, A., Xiao, Y., Cheng, X., Chang, M., Fu, Y.X., Zal, T., Zhu, C., Sun, S.C., 2013. OTUD7B controls noncanonical NF-kappaB activation through deubiquitination of TRAF3. Nature 494, 371. Ishigame, H., Kakuta, S., Nagai, T., Kadoki, M., Nambu, A., Komiyama, Y., Fujikado, N., Tanahashi, Y., Akitsu, A., Kotaki, H., Sudo, K., Nakae, S., Sasakawa, C., Iwakura, Y., 2009. Differential roles of interleukin-17A and -17F in host defense against mucoepithelial bacterial infection and allergic responses. Immunity 30, 108. Ivanov, I.I., Atarashi, K., Manel, N., Brodie, E.L., Shima, T., Karaoz, U., Wei, D., Goldfarb, K.C., Santee, C.A., Lynch, S.V., Tanoue, T., Imaoka, A., Itoh, K., Takeda, K., Umesaki, Y., Honda, K., Littman, D.R., 2009. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139, 485. Khan, M.A., Ma, C., Knodler, L.A., Valdez, Y., Rosenberger, C.M., Deng, W., Finlay, B.B., Vallance, B.A., 2006. Toll-like receptor 4 contributes to colitis development but not to host defense during Citrobacter rodentium infection in mice. Infect. Immun. 74, 2522.


E.P. Koroleva et al. / Journal of Immunological Methods xxx (2015) xxx–xxx Kim, Y.S., Ho, S.B., 2010. Intestinal goblet cells and mucins in health and disease: recent insights and progress. Curr. Gastroenterol. Rep. 12, 319. Kiss, E.A., Vonarbourg, C., Kopfmann, S., Hobeika, E., Finke, D., Esser, C., Diefenbach, A., 2011. Natural aryl hydrocarbon receptor ligands control organogenesis of intestinal lymphoid follicles. Science 334, 1561. Kruglov, A.A., Grivennikov, S.I., Kuprash, D.V., Winsauer, C., Prepens, S., Seleznik, G.M., Eberl, G., Littman, D.R., Heikenwalder, M., Tumanov, A.V., Nedospasov, S.A., 2013. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science 342, 1243. Lebeis, S.L., Bommarius, B., Parkos, C.A., Sherman, M.A., Kalman, D., 2007. TLR signaling mediated by MyD88 is required for a protective innate immune response by neutrophils to Citrobacter rodentium. J. Immunol. 179, 566. Lebeis, S.L., Powell, K.R., Merlin, D., Sherman, M.A., Kalman, D., 2009. Interleukin-1 receptor signaling protects mice from lethal intestinal damage caused by the attaching and effacing pathogen Citrobacter rodentium. Infect. Immun. 77, 604. Lee, J.S., Cella, M., McDonald, K.G., Garlanda, C., Kennedy, G.D., Nukaya, M., Mantovani, A., Kopan, R., Bradfield, C.A., Newberry, R.D., Colonna, M., 2012. AHR drives the development of gut ILC22 cells and postnatal lymphoid tissues via pathways dependent on and independent of Notch. Nat. Immunol. 13, 144. Liu, Z., Zaki, M.H., Vogel, P., Gurung, P., Finlay, B.B., Deng, W., Lamkanfi, M., Kanneganti, T.D., 2012. Role of inflammasomes in host defense against Citrobacter rodentium infection. J. Biol. Chem. 287, 16955. Longman, R.S., Diehl, G.E., Victorio, D.A., Huh, J.R., Galan, C., Miraldi, E.R., Swaminath, A., Bonneau, R., Scherl, E.J., Littman, D.R., 2014. CX(3)CR1(+) mononuclear phagocytes support colitis-associated innate lymphoid cell production of IL-22. J. Exp. Med. 211, 1571. Luperchio, S.A., Schauer, D.B., 2001. Molecular pathogenesis of Citrobacter rodentium and transmissible murine colonic hyperplasia. Microbes Infect. 3, 333. Lupp, C., Robertson, M.L., Wickham, M.E., Sekirov, I., Champion, O.L., Gaynor, E.C., Finlay, B.B., 2007. Host-mediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe 2, 204. Maaser, C., Housley, M.P., Iimura, M., Smith, J.R., Vallance, B.A., Finlay, B.B., Schreiber, J.R., Varki, N.M., Kagnoff, M.F., Eckmann, L., 2004. Clearance of Citrobacter rodentium requires B cells but not secretory immunoglobulin A (IgA) or IgM antibodies. Infect. Immun. 72, 3315. Macho-Fernandez, E., Koroleva, E.P., Spencer, C.M., Tighe, M., Torrado, E., Cooper, A.M., Fu, Y.X., Tumanov, A.V., 2015. Lymphotoxin beta receptor signaling limits mucosal damage through driving IL-23 production by epithelial cells. Mucosal. Immunol 8, 403. Mangan, P.R., Harrington, L.E., O'Quinn, D.B., Helms, W.S., Bullard, D.C., Elson, C.O., Hatton, R.D., Wahl, S.M., Schoeb, T.R., Weaver, C.T., 2006. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 441, 231. Manta, C., Heupel, E., Radulovic, K., Rossini, V., Garbi, N., Riedel, C.U., Niess, J.H., 2013. CX(3)CR1(+) macrophages support IL-22 production by innate lymphoid cells during infection with Citrobacter rodentium. Mucosal Immunol. 6, 177. McGuckin, M.A., Linden, S.K., Sutton, P., Florin, T.H., 2011. Mucin dynamics and enteric pathogens. Nat. Rev. Microbiol. 9, 265. Mortha, A., Chudnovskiy, A., Hashimoto, D., Bogunovic, M., Spencer, S.P., Belkaid, Y., Merad, M., 2014. Microbiota-dependent crosstalk between macrophages and ILC3 promotes intestinal homeostasis. Science 343, 1249288. Mukherjee, S., Zheng, H., Derebe, M.G., Callenberg, K.M., Partch, C.L., Rollins, D., Propheter, D.C., Rizo, J., Grabe, M., Jiang, Q.X., Hooper, L.V., 2014. Antibacterial membrane attack by a pore-forming intestinal C-type lectin. Nature 505, 103. Mundy, R., MacDonald, T.T., Dougan, G., Frankel, G., Wiles, S., 2005. Citrobacter rodentium of mice and man. Cell. Microbiol. 7, 1697. Nakanishi, A., Morita, S., Iwashita, H., Sagiya, Y., Ashida, Y., Shirafuji, H., Fujisawa, Y., Nishimura, O., Fujino, M., 2001. Role of gob-5 in mucus overproduction and airway hyperresponsiveness in asthma. Proc. Natl. Acad. Sci. U. S. A. 98, 5175. Nataro, J.P., Kaper, J.B., 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11, 142. Nordlander, S., Pott, J., Maloy, K.J., 2014. NLRC4 expression in intestinal epithelial cells mediates protection against an enteric pathogen. Mucosal Immunol. 7, 775. Ota, N., Wong, K., Valdez, P.A., Zheng, Y., Crellin, N.K., Diehl, L., Ouyang, W., 2011. IL-22 bridges the lymphotoxin pathway with the maintenance of colonic lymphoid structures during infection with Citrobacter rodentium. Nat. Immunol. 12, 941. Papapietro, O., Teatero, S., Thanabalasuriar, A., Yuki, K.E., Diez, E., Zhu, L., Kang, E., Dhillon, S., Muise, A.M., Durocher, Y., Marcinkiewicz, M.M., Malo, D., Gruenheid, S., 2013. R-spondin 2 signalling mediates susceptibility to fatal infectious diarrhoea. Nat. Commun. 4, 1898.

11

Peterson, L.W., Artis, D., 2014. Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 14, 141. Pickard, J.M., Maurice, C.F., Kinnebrew, M.A., Abt, M.C., Schenten, D., Golovkina, T.V., Bogatyrev, S.R., Ismagilov, R.F., Pamer, E.G., Turnbaugh, P.J., Chervonsky, A.V., 2014. Rapid fucosylation of intestinal epithelium sustains host-commensal symbiosis in sickness. Nature 514, 638. Pickert, G., Neufert, C., Leppkes, M., Zheng, Y., Wittkopf, N., Warntjen, M., Lehr, H.A., Hirth, S., Weigmann, B., Wirtz, S., Ouyang, W., Neurath, M.F., Becker, C., 2009. STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal wound healing. J. Exp. Med. 206, 1465. Raczynski, A.R., Muthupalani, S., Schlieper, K., Fox, J.G., Tannenbaum, S.R., Schauer, D.B., 2012. Enteric infection with Citrobacter rodentium induces coagulative liver necrosis and hepatic inflammation prior to peak infection and colonic disease. PLoS One 7, e33099. Reid-Yu, S.A., Small, C.L., Coombes, B.K., 2013. CD3(−)NK1.1(+) cells aid in the early induction of a Th1 response to an attaching and effacing enteric pathogen. Eur. J. Immunol. 43, 2638. Rubino, S.J., Geddes, K., Girardin, S.E., 2012. Innate IL-17 and IL-22 responses to enteric bacterial pathogens. Trends Immunol. 33, 112. Sanos, S.L., Diefenbach, A., 2010. Isolation of NK cells and NK-like cells from the intestinal lamina propria. Methods Mol. Biol. 612, 505. Satoh-Takayama, N., Vosshenrich, C.A., Lesjean-Pottier, S., Sawa, S., Lochner, M., Rattis, F., Mention, J.J., Thiam, K., Cerf-Bensussan, N., Mandelboim, O., Eberl, G., Di Santo, J.P., 2008. Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense. Immunity 29, 958. Satpathy, A.T., Briseno, C.G., Lee, J.S., Ng, D., Manieri, N.A., Kc, W., Wu, X., Thomas, S.R., Lee, W.L., Turkoz, M., McDonald, K.G., Meredith, M.M., Song, C., Guidos, C.J., Newberry, R.D., Ouyang, W., Murphy, T.L., Stappenbeck, T.S., Gommerman, J.L., Nussenzweig, M.C., Colonna, M., Kopan, R., Murphy, K.M., 2013. Notch2dependent classical dendritic cells orchestrate intestinal immunity to attaching-and-effacing bacterial pathogens. Nat. Immunol. 14, 937. Schreiber, H.A., Loschko, J., Karssemeijer, R.A., Escolano, A., Meredith, M.M., Mucida, D., Guermonprez, P., Nussenzweig, M.C., 2013. Intestinal monocytes and macrophages are required for T cell polarization in response to Citrobacter rodentium. J. Exp. Med. 210, 2025. Serafini, N., Klein Wolterink, R.G., Satoh-Takayama, N., Xu, W., Vosshenrich, C.A., Hendriks, R.W., Di Santo, J.P., 2014. Gata3 drives development of RORgammat + group 3 innate lymphoid cells. J. Exp. Med. 211, 199. Sheridan, B.S., Lefrancois, L., 2012. Isolation of mouse lymphocytes from small intestine tissues. Curr. Protoc. Immunol http://dx.doi.org/10.1002/ 0471142735.im0319s99. Shiomi, H., Masuda, A., Nishiumi, S., Nishida, M., Takagawa, T., Shiomi, Y., Kutsumi, H., Blumberg, R.S., Azuma, T., Yoshida, M., 2010. Gamma interferon produced by antigen-specific CD4+ T cells regulates the mucosal immune responses to Citrobacter rodentium infection. Infect. Immun. 78, 2653. Simmons, C.P., Goncalves, N.S., Ghaem-Maghami, M., Bajaj-Elliott, M., Clare, S., Neves, B., Frankel, G., Dougan, G., MacDonald, T.T., 2002. Impaired resistance and enhanced pathology during infection with a noninvasive, attaching-effacing enteric bacterial pathogen, Citrobacter rodentium, in mice lacking IL-12 or IFN-gamma. J. Immunol. 168, 1804. Simmons, C.P., Clare, S., Ghaem-Maghami, M., Uren, T.K., Rankin, J., Huett, A., Goldin, R., Lewis, D.J., MacDonald, T.T., Strugnell, R.A., Frankel, G., Dougan, G., 2003. Central role for B lymphocytes and CD4+ T cells in immunity to infection by the attaching and effacing pathogen Citrobacter rodentium. Infect. Immun. 71, 5077. Singh, A.K., Eken, A., Fry, M., Bettelli, E., Oukka, M., 2014. DOCK8 regulates protective immunity by controlling the function and survival of RORgammat + ILCs. Nat. Commun. 5, 4603. Smith, A.D., Botero, S., Shea-Donohue, T., Urban Jr., J.F., 2011. The pathogenicity of an enteric Citrobacter rodentium infection is enhanced by deficiencies in the antioxidants selenium and vitamin E. Infect. Immun. 79, 1471. Song, X., Zhu, S., Shi, P., Liu, Y., Shi, Y., Levin, S.D., Qian, Y., 2011. IL-17RE is the functional receptor for IL-17C and mediates mucosal immunity to infection with intestinal pathogens. Nat. Immunol. 12, 1151. Song-Zhao, G.X., Srinivasan, N., Pott, J., Baban, D., Frankel, G., Maloy, K.J., 2014. Nlrp3 activation in the intestinal epithelium protects against a mucosal pathogen. Mucosal Immunol. 7, 763. Sonnenberg, G.F., Monticelli, L.A., Elloso, M.M., Fouser, L.A., Artis, D., 2011. CD4(+) lymphoid tissue-inducer cells promote innate immunity in the gut. Immunity 34, 122. Spahn, T.W., Maaser, C., Eckmann, L., Heidemann, J., Lugering, A., Newberry, R., Domschke, W., Herbst, H., Kucharzik, T., 2004. The lymphotoxin-beta receptor is critical for control of murine Citrobacter rodentium-induced colitis. Gastroenterology 127, 1463. Spehlmann, M.E., Dann, S.M., Hruz, P., Hanson, E., McCole, D.F., Eckmann, L., 2009. CXCR2-dependent mucosal neutrophil influx protects against colitis-associated diarrhea caused by an attaching/effacing lesion-forming bacterial pathogen. J. Immunol. 183, 3332.


12


Sugimoto, K., Ogawa, A., Mizoguchi, E., Shimomura, Y., Andoh, A., Bhan, A.K., Blumberg, R.S., Xavier, R.J., Mizoguchi, A., 2008. IL-22 ameliorates intestinal inflammation in a mouse model of ulcerative colitis. J. Clin. Invest. 118, 534. Tumanov, A.V., Koroleva, E.P., Guo, X., Wang, Y., Kruglov, A., Nedospasov, S., Fu, Y.X., 2011. Lymphotoxin controls the IL-22 protection pathway in gut innate lymphoid cells during mucosal pathogen challenge. Cell Host Microbe 10, 44. Umar, S., 2012. Citrobacter infection and Wnt signaling. Curr. Colorectal Cancer Rep. 8. Vallance, B.A., Deng, W., Knodler, L.A., Finlay, B.B., 2002. Mice lacking T and B lymphocytes develop transient colitis and crypt hyperplasia yet suffer impaired bacterial clearance during Citrobacter rodentium infection. Infect. Immun. 70, 2070. Vallance, B.A., Deng, W., Jacobson, K., Finlay, B.B., 2003. Host susceptibility to the attaching and effacing bacterial pathogen Citrobacter rodentium. Infect. Immun. 71, 3443. Wang, Y., Koroleva, E.P., Kruglov, A.A., Kuprash, D.V., Nedospasov, S.A., Fu, Y.X., Tumanov, A.V., 2010. Lymphotoxin beta receptor signaling in intestinal epithelial cells orchestrates innate immune responses against mucosal bacterial infection. Immunity 32, 403.

Wei, O.L., Hilliard, A., Kalman, D., Sherman, M., 2005. Mast cells limit systemic bacterial dissemination but not colitis in response to Citrobacter rodentium. Infect. Immun. 73, 1978. Willing, B.P., Vacharaksa, A., Croxen, M., Thanachayanont, T., Finlay, B.B., 2011. Altering host resistance to infections through microbial transplantation. PLoS One 6, e26988. Wlodarska, M., Thaiss, C.A., Nowarski, R., Henao-Mejia, J., Zhang, J.P., Brown, E.M., Frankel, G., Levy, M., Katz, M.N., Philbrick, W.M., Elinav, E., Finlay, B.B., Flavell, R.A., 2014. NLRP6 inflammasome orchestrates the colonic host– microbial interface by regulating goblet cell mucus secretion. Cell 156, 1045. Zheng, Y., Valdez, P.A., Danilenko, D.M., Hu, Y., Sa, S.M., Gong, Q., Abbas, A.R., Modrusan, Z., Ghilardi, N., de Sauvage, F.J., Ouyang, W., 2008. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat. Med. 14, 282.


The cell surface receptor Slamf6 modulates innate immune responses during Citrobacter rodentium-induced colitis.

Dectin-3 Deficiency Promotes Colitis Development due to Impaired Antifungal Innate Immune Responses in the Gut.

Eosinophils in mucosal immune responses.

Fetal intestinal transplant model for mucosal immune responses.

Histamine and gut mucosal immune regulation.

Epithelium-innate immune cell axis in mucosal responses to SIV.

Interaction between the gut microbiome and mucosal immune system.

The Reticular Cell Network: A Robust Backbone for Immune Responses.

Immune responses to infections with coccidia in chickens: gut hypersensitivity.

Selective enrichment of commensal gut bacteria protects against Citrobacter rodentium-induced colitis.

The role of Galectin-1 and Galectin-3 in the mucosal immune response to Citrobacter rodentium infection.

Systemic and Mucosal Immune Responses to Cryptosporidium-Vaccine Development.

Polymeric penetration enhancers promote humoral immune responses to mucosal vaccines.

Multiscale modeling of mucosal immune responses.

Intravaginal immunisation using a novel antigen-releasing ring device elicits robust vaccine antigen-specific systemic and mucosal humoral immune responses.

Does Vitamin D Protect the Gut Mucosal Barrier? Mechanistic Insights from Experimental Colitis.

Humoral immune responses to HIV in the mucosal secretions and sera of HIV-infected women.

Regulation of the gut microbiota by the mucosal immune system in mice.

CBLB502 administration protects gut mucosal tissue in ulcerative colitis by inhibiting inflammation.

Discordance between changes in the gut microbiota and pathogenicity in a mouse model of spontaneous colitis.

Chronic Gastrointestinal Nematode Infection Mutes Immune Responses to Mycobacterial Infection Distal to the Gut.

Branched Fatty Acid Esters of Hydroxy Fatty Acids (FAHFAs) Protect against Colitis by Regulating Gut Innate and Adaptive Immune Responses.

IgA B Cell Responses to Gut Mucosal Antigens: Do We Know it all?

B cells modulate mucosal associated invariant T cell immune responses.