Author's Accepted Manuscript
Cis-regulatory elements involved in speciesspecific transcriptional regulation of the SVCT1 gene in rat and Human hepatoma cells Alejandra Muñoz, Marcelo Villagrán, Paula Guzmán, Carlos Solíz, Marcell Gatica, Carlos Aylwin, Karen Sweet, Mafalda Maldonado, Elizabeth Escobar, Alejandro M. Reyes, Jorge R. Toledo, Oliberto Sánchez, Sergio A. Oñate, Juan Carlos Vera, Coralia I. Rivas
www.elsevier.com/locate/freeradbiomed
PII: DOI: Reference:
S0891-5849(15)00187-2 http://dx.doi.org/10.1016/j.freeradbiomed.2015.04.024 FRB12403
To appear in:
Free Radical Biology and Medicine
Received date: 21 January 2015 Revised date: 9 April 2015 Accepted date: 20 April 2015 Cite this article as: Alejandra Muñoz, Marcelo Villagrán, Paula Guzmán, Carlos Solíz, Marcell Gatica, Carlos Aylwin, Karen Sweet, Mafalda Maldonado, Elizabeth Escobar, Alejandro M. Reyes, Jorge R. Toledo, Oliberto Sánchez, Sergio A. Oñate, Juan Carlos Vera, Coralia I. Rivas, Cis-regulatory elements involved in species-specific transcriptional regulation of the SVCT1 gene in rat and Human hepatoma cells, Free Radical Biology and Medicine, http://dx.doi.org/ 10.1016/j.freeradbiomed.2015.04.024 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1
Muñoz et al 2015
Cis-regulatory elements involved in species-specific transcriptional regulation of the SVCT1 gene in rat and human hepatoma cells !" # ! " $ % " & %$ ' (" # $ ( & ) *$ %+))
,- . - . / 0 1+ -0
/ 1+ 2 ( / 3 456 -0 # "
* / 7 " . 1+ #
- * ' ( / 3 859 + #
,- . . / 0 1+ -0
/ 1+ 2 ( / 3 456 -0 #
,- !- : . 1+ -0
/ 1+ 2 ( / 3 456 -0 # ) - # ; +< $ )) - # ; +< $
2
Muñoz et al 2015
""+ ; '4 = - " - 4> . ?@ A " - B " 4$ " " - " # = - + - A'B$ % " + ' 3- - 3 + - # # - # + # C '4 %D - + #- #
"+ # #- $ ' " # - + + - # - 3 - # $ E 4F95 "- # - 3 - # =+ - - " " - " = $ E 3 # - # - - GF**! # G-? #- 3- + + # =3- - # " 7 - # '4 - $ '# + # - = # - + # - 7 # "
3
Muñoz et al 2015
# - /#4 GD.F # - 7 + # # - $
+ GD.4 # # # # '4 - - # '4 - " #
- + $ '# - # + " # - # # - # " # # - # " " # # # - # # - - - '4 3- $
- > '4 - > " - 4 - > '4 - > - - - 3 $ *
3 # # "
C H= " A " B # 3 = C # =H= " A# " ,GB I4J$
+ " # " " # " - # # - - " - # - # 7 # + I4=FJ$ * # - # # # 3 A1H(B # # - # " ## I4=FJ$ - # # " " A # # - + B
4
Muñoz et al 2015
# # # #- # # # #+ # - I4=FJ$ Ascorbic acid is transported into cells by the sodium-coupled vitamin C transporters SVCT1 and SVCT2 that are the product of genes SLC23A1 and SLC23A2, respectively, and show differential expression at cellular and tissue levels [5-8]. SVCT2 is expressed in most cells and tissues [6-9], while SVCT1 shows high level expression in a restricted number of epithelial cells in organs that regulate the availability of ascorbic acid from the diet (intestine), antioxidant metabolism and synthesis of ascorbic acid (liver) and ascorbic acid reabsorption (kidneys) [612]. SVCT1 and SVCT2 expression is regulated during cell differentiation, aging and in response to oxidative stress [11-19]. Recently, we obtained evidence of differential regulation of SVCT expression in response to acute oxidative stress in cells from species that differ in their capacity to synthesize vitamin C, with a marked decrease in SVCT1 mRNA and protein levels in rat hepatoma cell that was not observed in human hepatoma cells [20]. Important advances in our current understanding of vitamin C cell and molecular biology have been obtained using rats, mice and cellular models derived from these species. These animal and cellular models are used as surrogates to investigate the control and regulatory aspects of the metabolism of vitamin C in humans. However, it is now becoming clear that the capacity for synthesizing their own ascorbic acid render these models poorly adequate to investigate and further our understanding of the physiology and pathophysiology of vitamin C in humans [21]. Similar to humans, guinea pigs lost the capacity to synthesize ascorbic acid in the course of evolution and may represent a better human-like model to study vitamin C metabolism and regulation [3, 4, 21]. There are also several rat and mice mutant models, of natural origin and also genetically engineered, that lack the capacity to synthesize ascorbic acid and are used to
5
Muñoz et al 2015
interrogate different areas of vitamin C metabolism related with the biological-biomedical significance of megadoses of vitamin C, studies of supplementation, depletion and repletions, in vivo adaptative responses to oxidative stress, and analysis of xenografted human tumor responses to changes in antioxidant status and oxidative stress [9, 10, 19, 21-28].
( - # # " # # # - A " B
# " -=- # # # # 3- # " - # 7 + # -# C + $ G # - # + " # + # # = - + " +" # # - # " I4 9 K ?4J$ D - # +
- I?LJ$ - # - + AM 44 N B " - A44=?K N B 7 AO ?K N B I@6=@FJ$ + - + = C + -- 3 86 P # 1 D Q I@4 @FJ @6 N I@6J = - - C + I@? @@J$ # A%,B + " F6 2 # 1 I@8J 98 L6 2 - + 1 I@5=@KJ 446 2 . / I@LJ$
# C " 7 #
-- + # - A B + I@5 @9J # -3 @=-# =-; B @6 466 2 #
6
Muñoz et al 2015
- #- " - A46=56 N - 4$?=@$K B> " 466=?66 2 - # - " 96=K6 N 4$?=F - + > O F66 2 # # - " I@5 @9J$ , A- -# -#B # + + # 3 # - 46 86= I@5 @9J$ *- -- # " A # 42 B - # - " # # + " 3 # " - # - 3 " I@5 @9J$ '# + -3 - " # # + + - + " -; " - A - CB - " - 3 $ '- # " - # - '4 3- # - " # " " # " - # - - '4 # - " - # # - 3 " I5 46=4?J$ # # + "
# + - # " - IF6= F8J # + # # - - # 7 " - + # $ ' - -- " " '? ##= " - # 3- # I5=K F5J$ G + +" " # 3 - " # 466= # " 3 - - " + # 3
7
Muñoz et al 2015
- I?4 F5J$ '# 7 + # # # #+ " C $ * # # -- + # @6 + - = - + " @6 P I@5 @9J # # +" + # # " - 3 # ?R # " # + A" ? B$ # - ## # + + - # + + # - - # " # # - " - # # " - IF9=86J$ '# - - # " - "C " " 3 # " - " - IF5=86J$
- # " + -
# # " #- IK ?4J$ C C A'4=2=B + # '4 " # C + 3 # - " # - " - I46J$ # C " -- " # + + # - + # =#- =- + #
"+ # I?8 ?K 84 8?J$ G + " F66=866 " 2 - AK=46 ?6= B 7 # - " - I8?J " - # K=46 ?6=
8
Muñoz et al 2015
" 7 + " 6$8F=6$59 96=C - I8@J$ '# # # #+ 7 + # 3 # # 7 I8? 8@J # " -" # - F86 + 2 - I8@ 8FJ$
(+ + # # " +" + #
- 7 3- + '4 # " # " +" # - # # + # + I?4J$ E # # - # # '4 - = # -=- - # # - 7
'4 3- # - 3- # '4
"+ # I?6J$ '# # - - # + - = # - 3 - # # = - - # -=- $ ( + # 3 = - # - + # - 3 - # # -=- > # " - # # $ - # - 7 /#4 " =4?562=4?86 GD.F " =K662 =9L8 - # - # $ '# # # + " # # - 7 '4 3- -- - 7 " +" # - -" # + $
9
Muñoz et al 2015
Material and Methods
'# #- " GF**! A'S %H=48FK' B # #
#- G-? A'S G/=K658' B % *=45F6 AG ' B -- # 46R " + -2 - I?6 88J$
'# - 7 # - "
# ! - / * # " " A# -;22 $"$ 2B I85=8KJ$ = # # - % =*' ?$6 A# -;22+ $ $ 2B " + + + " # - 86R # # - I8LJ$ Cloning of the promoter of the rat SLC23A1 gene and construction of truncated and mutant promoters
10
Muñoz et al 2015
4F95="- " % - ,D GF**!
##= !" ** A B$ /C 7 # 4K # 8T '4 A'" 4B$ '# %=- " -%=** '(( + A*+ B
" " # -H@=/ + A B # + -'4=H # - $ 7 # # # - # - A'B " # # '4 %D 7 A/C D " D U649@48B$ 1 -'4=H # - # 7 # - + #$ * + - - " # V C=# ** =, C A B$ # 7 # " - - " - - " - # + # 7 # " - A'" 4B$ '# # - " ,D 7 $ " "
GF**! G-? -- 3 96R "
?F= - $ ' + ,D - #
11
Muñoz et al 2015
. A B$ / 866 - 46 + 3- # H - A-%H= > B -3 + @66 P # $ ' #+ FK # # , H A B$ , # + "$ # !# " "
'# - - ,D -- %D 3 GF**! $ '# %D -- #
%D C !$Q$D$ A( / = CB
+ - - # - W - '- %+ '- A B$ . % - - - - - /#4 GD.F GD.4 A'" 4B$ % - X= # %'=% # # -$ / ' ' # " C - - - - @6 L8 Y " @6 @6 L8 Y @6 56 Y @6 5K Y 3 - 8 5K Y$ '# % - - " -# ?R + " # # " $ % - - 3 - # # 1 ' ,D - A ( /*( H" B " - =- " 7 $
12
Muñoz et al 2015
$
- " = D( A -#
5B - # !%6$68$ '# ' C - # -- $
Results The rat SVCT1 proximal promoter possess putative species-specific cis-regulatory elements
E 4866 "- - # - 3 -
8Z # - A'B # - # # - = # # - '4 3- -=- $ '# + # # - 3 -
# ''= C =# A# -;22-$ $ 2B$
''= - A*B 7 A2'B A # - B # ' I85=8KJ$ '# - 3 - # 7 ''' # - + $ E # # - # 7 # - =
13
Muñoz et al 2015
# - 3 - # + - " # " A# #- -B - # # " A B$ '# A ?$6 !% / B I8LJ + 466R 7 + # = - # 4866 "- # - 3 - # - # 2#- # 2 # 2 A.$ 4B$ ( # # # # 98R + # 996 "- - # ' A =@962[4 =5562=866 =K?62=966B " + # =48662=K?6 # - # 2 - A.$ 4B$ E# - # 2# # # # + = A-- 3 98R + B =?662[4 =@962=@66 = 9662=586 + # ' # # + # 8Z=# # 4866 "- - 3 - A =48662=966B A.$ 4/B$ + +
"+ # - # 2 # A =?662[4 - # 'B # " 98R + A.$ 4/B$ - " + O K6R 7 + = # 4@66 "- - # ' # - 3 - # " + = # =48662=4@66 A. 4B$ '# + + "+ # - 2 - # A=?662[4 - # 'B # " 96R + A.$ 4B$
+ # 44 7
- - # - 3 - A.$ 4,B$ * #- # # ' # -
14
Muñoz et al 2015
7 # " /#4 - =4?562=4?86 GD.F - =K662=9L8 !/ - =9?92=94F GD.F - =5@42=54K =F?F2=F6K /#4 - =@F52=@@5 GD.F - =?KK2=?95 =4LL2=4LF GD.4 - =4852=4F? !/ - =4@52= 4?@ GD.4 - =4462=LF A.$ 4,B$ '# 44 7 # " - - # '4 - # ## + # - 2 # # + # - - A.$ 4,B$ ( # # # F 7 # " - - # '4 - GD.F - =4LL2=4LF GD.4 - =4852=4F? !/ - =4@52=4?@ GD.4 - =4462=LF + # - 2# A.$ 4,B$ "+ # - 2 - #
? 7 # " - - # '4 - !/ - =4@52=4?@ GD.4 - =4462=LF + # - - A.$ 4,B$ "&
'# - 3 - # - #
- # - -H@=" # 3- + -'4= H ## # - 3 - # - # $ ' GF**! # G-? #- # # # - 3 - - + 3-
15
Muñoz et al 2015
# -'4=H # "C + 3- # # - = -H@=" + A # B$ ' # = 7 '4 3- - - + # - 3 - $ . GF**! G-? # #- $ ?49 "- - # - =4F95 =4?8L # ' =4?8L "- - # - + " @5= K= # - + # - #" # # # - # A.$ ?B$ # 8FL "- - # =4?8L =946 # ' # 946 "- - 98R - + " # # # # 3 + # =4?8L =946 # 7 # # $ # =946 "- - - + # F K= ## # # # # - A.$ ?B$ '# - + =4?8L2=946 + # # - 8FL "- ,D " C - # #" + # '4 - # 3- # #- $ , =9462=FK8 A??8 "-B FK8 "- - # - + -- 3 F= ## # # # # - A.$ ?B$ , =FK62=?88 A?@6 "-B ?88 "- - # - + " ?$8= ## # # # - # #
16
Muñoz et al 2015
- # - 3 " =?88 [4 "- # '4 - # " - # A.$ ?B$ As mentioned before, conservation and cluster analysis allowed the identification of 11 consensus sequences containing potential transcription factor recognition sites in the rat SVCT1 proximal promoter. To functionally demonstrate that these potential cis-regulatory elements are important for the transcriptional activity of the rat SVCT1 promoter, we altered the putative transcription factor binding sites by introducing inactivating mutations that would remove or structurally alter the consensus sequences for nine consensus sequences for the binding of a total of four different transcription factors present in the SVCT1 rat promoter (one Bach1 site, five HNF4 sites, one HNF1 site and two CEBP sites). We generated individual mutant promoters with alterations in the Bach1 site at position -1,260/-1,250, the five HNF4 sites at positions 800/-795, -631/-618, -424/-408, -288/-276 and -199/-194, the two CEBP sites at positions -727/714 and -136/-123 and the HNF1 site at position -110/-94, to determine the relative contribution of each binding site to the transcriptional activity of the SVCT1 promoter. Vectors encoding the mutant promoters carrying altered consensus binding sites were transiently transfected in H4IIE and HepG2 cells, and the effects of the specific mutations on the transcriptional activity of the SVCT1 promoter was analyzed by measuring luciferase activity. The consensus sequence of the Bach1 binding site at position -1,260/-1,250 that contains 11 bp was modified by random exchange of three bp of the ARE (antioxidant response element) sequence described as the core of the Bach1 site [60] (random TCA to GAG mutation), alteration that caused a 100% increase in the transcriptional activity of the mutated rat SVCT1 promoter expressed in H4IIE cells. Next, we produced a 7 bp deletion that eliminated the core and the Bach1 binding site causing a 200% increase in the promoter transcriptional activity in the H4IIE
17
Muñoz et al 2015
cells. To confirm the implication of the Bach1 site in the SVCT1 promoter regulation, we generated a third construct by eliminating the remaining 5'-sequence by exonuclease digestion in the Bach1 mutant GAG, generating a truncated (1,250 bp long) and mutant promoter that showed a 100% increase in transcriptional activity compared with the control SVCT1 promoter (Fig. 3). Interestingly, each of these effects on the transcriptional activity of the mutated SVCT1 promoters in the rat H4IIE cells were also observed when the mutant promoters were expressed in human HepG2 cells (Fig. 3). Most importantly, our data indicate that the transcriptional activation of the SVCT1 promoter is maintained regardless of the method used to inactivate the Bach1 site. Thus, the mutagenesis data confirmed the results obtained with truncated transporters that suggested the presence of a transcriptional repressor motif in the segment encompassing the deletion -1,476/-1,259 that may correspond to a consensus sequence for a Bach1 binding site at position -1,260/-1,250 in the rat SVCT1 promoter.
'# + GD.F " - # # #
+ # - + # - + - 3- # GF**! #- $ # GD.F =K662=9L8 =F?F2=F6K # '4 - - + " L8 56R - + - # # + # '4 - A.$ @B$ * # GD.F =5@42=54K =?KK2=?95 # - + " 466 K6R - + A.$ @B$ ( # # # # GD.F =4LL2=4LF - # + - # # - GF**! A.$ @B$ E# # - 3- # # G-? # - GD.F =K662=9LF # - + A@6R # # '4 - B # "+ GF**! A.$ @B$ '#
18
Muñoz et al 2015
AGD.F =5@42=54K =F?F2=F6K =?KK2=?95 =4LL2=4LFB # - + + # # '4 - AL6 4@6RB A.$ @B$ '# - -- # " - # - - + # - # = 4?8L2=946 # - 7 GD.F " - =K662=9L8 # '4 - $
'# + # 2# # + 466R
# " 7 # " GD.4 # # '4 - $ * # '4 - # GD.4 9 "- A =46K =46?B - # - + - # # - # 3- GF**! G-? # # GD.4 # # '4 7 - + A.$ @B$ * GD.4 3- # # '4 I54 5?J ## + # # 3 " GD.4 " -$
# !/X A=9?92=94FB " 8 "- =9?6 =
945 - 3- " 56R - # # '4 - GF**! $ ( # # # # !/X " - =4@52=4?@ " 9 "- =4@6 =4?F # + A.$ @B$ (+ # '4 " # 8Z= # '4 - $
19
Muñoz et al 2015
To further examine the importance of the Bach1 -1,260/-1,250 and HNF4 -800/-795 consensus binding sequences in regulating the SVCT1 rat promoter, we produced a double mutant containing simultaneous mutations at the Bach1 -1,260/-1,250 site (triple TCA to GAG mutation at position -1,254/-1,252) and the HNF4 -800/-795 site (6 bp deletion at position -800/795). As expected from our previous results, the single Bach1 mutant showed a similarly increased transcriptional activity (about two-fold) in both the rat H4IIE and human HepG2 cells, compared with control SVCT1 promoter. The single HNF4 mutant showed a markedly decreased transcriptional activity when expressed in H4IIE cells (less than 10% the activity of the control promoter), with a minor decrease (about 70% the activity of the control promoter) when expressed in human HepG2 cells. Interestingly, further results showed that the double mutation caused a three-fold increase in transcriptional activity compared with the control SVCT1 promoter in both the rat H4IIE and human HepG2 cells, indicating dominance of transcriptional activation resulting from the removal of the highly repressive Bach1 motif at position -1,260/1,250 (Fig. 4).
Bach1 represses and HNF4 activates transcription of the SVCT1 rat promoter
We tested whether Bach1 represses the transcriptional activity of the rat SVCT1 promoter by co-transfecting H4IIE cells with plasmids encoding the Bach1 cDNA simultaneously with the rat SVCT1 promoter. The results of these experiments revealed that co-transfection of H4IIE cells with expression plasmids encoding the transcription factor Bach1 and the full length SVCT1 rat promoter caused a marked decrease in the transcriptional activity of the rat SVCT1 promoter, to about 35% of the respective control (Fig. 5A). The specificity of the repression was
20
Muñoz et al 2015
demonstrated in H4IIE cells co-transfected with plasmids encoding the Bach1 cDNA and a mutated form of the SVCT1 promoter carrying an inactivating mutation at the Bach1 consensus binding sequence (triple TCA to GAG mutation at position -1,254/-1,252). As expected, H4IIE cells transfected with the mutated SVCT1 promoter showed an increased transcriptional activity that was about 2.5-fold higher than cells transfected with the control SVCT1 promoter. Cotransfected cells showed a luciferase level similar to that of cells transfected with mutant SVCT1, indicating that Bach1 expression failed to affect the transcriptional activity of the Bach1-inactivated SVCT1 promoter, an observation that we propose is due to the mutated Bach1 binding sequences (Fig. 5B). Sequence comparison between rat/human SVCT1 orthologs promoters indicated that sequence homology decreases along the more distal 5'-regions of the promoter, including the absence of a Bach1 consensus sequence in the human SVCT1 promoter. Accordingly, H4IIE cells simultaneously co-transfected with a plasmid encoding Bach1 and a plasmid encoding a 1,485 pb human SVCT1 (Bach1-less) promoter, showed no changes in luciferase activity, indicating that Bach1 overexpression produced no alterations of the transcriptional activity of the human SVCT1 promoter (Fig. 5C). Almost identical results were observed in human HepG2 cells (Fig. 5D-F). As a positive control for the activity of the human SVCT1 promoter, we transfected the H4IIE cells with a plasmid encoding the transcription factor HNF1 simultaneously with a plasmid encoding a 1,485 pb human SVCT1 promoter that contains a consensus site for the binding of HNF1 at -124/-108. As expected, HNF1 activated human SVCT1 promoter transcriptional activity in co-transfected H4IIE cells as assessed by a five-fold increase in luciferase activity compared with control cells transfected with the plasmid encoding the human SVCT1 promoter alone, and cells transfected with a plasmid encoding the human
21
Muñoz et al 2015
SVCT1 promoter with an inactivating mutation in the HNF1 site failed to show any luciferase activity (data not shown). A similar strategy was used to assess the role of HNF4 in regulating the transcriptional activity of the rat SVCT1 promoter. Co-transfection of rat H4IIE and human HepG2 cells with expression plasmids encoding the transcription factor HNF4 and the full length SVCT1 rat promoter caused a 3.5 to 2.5-fold increase in the transcriptional activity of the rat SVCT1 promoter, compared with the respective control (Fig. 6). The specificity of the activation was demonstrated in H4IIE cells co-transfected with plasmids encoding the HNF4 cDNA and a mutated form of the SVCT1 promoter carrying an inactivating mutation at the HNF4 consensus binding sequence (six bp deletion at position -800/-795). As expected, H4IIE cells transfected with the mutated SVCT1 promoter alone showed a markedly decreased transcriptional activity of approximately 20% of control SVCT1 promoter, while co-transfected cells showed a luciferase level similar to that control SVCT1 promoter, suggesting that HNF4 activated the remaining transcriptional activity of the mutated SVCT1 promoter (Fig. 6). Sequence comparison between rat/human SVCT1 orthologs promoters indicated the presence of two HNF4 consensus sequence in the human SVCT1 promoter, at positions -1,108/-1,096 and -13/-1 from the TSS, and mutagenesis of the -13/-1 HNF4 site decreased the transcriptional activity of the human SVCT1 promoter by 60 to 75% compared with absence of effect when the -1,108/-1,096 HNF4 site was mutated. As a further specificity test, we transfected H4IIE cells with a plasmid encoding HNF4 simultaneously with a plasmid encoding a 1,485 pb human SVCT1 promoter, and as expected, HNF4 protein decreased human SVCT1 promoter transcriptional activity in co-transfected H4IIE cells, as evidenced by a 70% decrease in luciferase activity compared with control cells transfected with the plasmid encoding the human SVCT1 promoter alone, and moreover, cells
22
Muñoz et al 2015
transfected with a plasmid encoding the human SVCT1 promoter with an inactivating mutation in the -13/-1 HNF4 site failed to show any effect on luciferase activity (data not shown). Therefore, HNF4 functions as a transcriptional activator of the SVCT1 gene promoter in the rat while it acts as a repressor in the case of the human SVCT1 gene promoter.
Discussion
'4 - # ## 3- " - + - # +
C # 3- -
3 + I4 5=K 5@J$ * # 3 " + '4 3- - 3 + - # # - # " I?6J$ E "+ C '4 %D - + #- GF**! - # " # # # # #" " # =%= 3 A/(B # "+ # #- G-? $ % GF**! # " # " # # G-? # " " # + 3 I?6J$ (+ # 3
-=- # # 3- '4 #- + # $ To better understand the regulatory aspects involved in the regulation of the expression of the rat SVCT1 gene, we characterized its 5ƍ-regulatory region by identifying the promoter sequences required for directing the transcription of the luciferase reporter gene in cultured rat
23
Muñoz et al 2015
H4IIE and human HepG2 hepatoma cells. The first finding of this study, obtained from sequence, conservation and cluster analysis is that the promoter regions of rat and mouse SVCT1 genes are highly homologous and present cis-regulatory elements that are highly conserved interspecies along most of the promoter 1,476 pb length. Eleven consensus sequences for the binding of transcription factors related to antioxidant response (two Bach1 sites, five HNF4 sites, two CBEP sites and two HNF1 sites) were identified as conserved in the rat/mouse SVCT1 promoter. On the other hand, the analysis of the rat/human orthologs revealed that the region of high homology and conservation was restricted to rather short segments in the 3'-half of the 1,476 pb promoter region. Thus, only a reduced number of cis-regulatory elements consisting of consensus sequences for the binding of transcription factors were identified as conserved in the rat and human SVCT1 promoter (one HNF4 site, two HNF1 sites, one CEBP site). Using the above information as the starting point, we performed a structural-functional study to identify critical cis-regulatory elements with specificity for regulating the transcriptional activity of the rat SVCT1 promoter in a species-specific manner, cis-regulatory elements that are absent or possess divergent functions in the promoter of the corresponding human SVCT1 gene. The findings of the present study strongly suggest that the regulation of vitamin C metabolism in humans may differ from that of species capable of synthesizing vitamin C de novo.
'# 7 + " # #
'4 - # # + 7 - - " - # - # # - =8662[4 # ' A.$ 9B$ * # 8Z= =4F952=866 # ' # # # # '4 - - " /#4 A=4?562=4?86B GD.F A=K662=9L8B !/ A=9?92=94FB GD.F A=5@42=54KB
24
Muñoz et al 2015
## # # # - # # '4 - A.$ 9B$ + # # '4 - - " GD.F A=446K2= 46L5B Q A=L8F2=LF9B !.? A=9KL2=99KB # " # -
# '4 - A.$ 9B$ ( # # # # # ' - + " - # # # " # # '4 - # GD.F =?KK2=?95 # # # # GD.F =?@92=??F # GD.4 =4852=4F? # # # # GD.4 =4?F2=46K # !/ =4@52=4?@ # # # # !/ =L92=K4 # GD.4 =4462=LF # # # # GD.4 =5L2=8@ A.$ 9B$ '# - 3- # 7 # " GD.F - =4@2=4 # # '4 - # " # '4 - $
7 + # # '4
- # # # # - # - '4 - # 8Z @Z # # + 7 # " - # =3- - # # '4 - + # # '4 - - = # - # # -=- A.$ 9B$ ( 44 7 # " - - + 7 - # - /#4 " =4?562=
4?86 GD.F " =K662=9L8 - # '4 - A'B$ '# /#4 # GD.F ## + # '4
25
Muñoz et al 2015
# 8Z= # - # - # = 4F952=966 # # " + " # # '4 - $ # " + # /#4 " A=4?562=4?86B # GD.F " A= K662=9L8B - # '4 - " # " # - # # '4 - A.$ 9B$
+ - /#4 # +
- 3 # # 3 =4 # D,ABG 7
3 4 I5F=96J> # + # # # /#4
# - # # # # '4 $ * +
# /#4 =4?562=4?86 - # - # /#4 =4?562=4?86 " # /#4 =@F52= @@5 # # - + # '4 - $ * # # " /#4 4?562=4?86 # - " 7 - + '4 - $ * # # +3- /#4 -- # - + # '4 - # + " /#4$ 3- /#4 +3- # - + # # '4 - # C " /#4$ * /#4 +3- # # 3- # # '4 - # # /#4 =4?562=4?86 + " $ (+ # # /#4 =4?562=4?86 # '4 - - = # '4 #
26
Muñoz et al 2015
" # - # '4 - # /#4 =@F52=@@5 # '4 - A " # # - B - $
GD.F - +
" + + # 3 " " - I94=95J$ + # GD.F # 3- + '4 # " - # GD.F " + '4 - I99J$ 7 + - # + 7 GD.F " # '4 - A.$ 9B$ ( GD.F " - =K662= 9L8 - # '4 ' # # = + " # # '4 - " # - # # '4 - A.$ 9B$ * + # =K662=9L8 GD.F " - # # =K662=9L8 GD.F " 7 - + '4 - $ * # # =3- GD.F + # - +
# '4 - # "+ # '4 - + =K662=9L8 GD.F " # # # '4 - # C " GD.F # A.$ 9B$ . GD.F - # '4 - - =5@42=54K =F?F2=F6K =?KK2=?95 =4LL2=4LF # ' -- " - " # C + A.$ 9B$ * - # " GD.F # # '4 - A.$ 9B$ ( # " =?@92=
27
Muñoz et al 2015
??F # # '4 - -- " - # # - GD.F =?KK2=?95 # '4 - A.$ 9B$
- # " GD.F - =4@2=4 # # '4 - + + - - " GD.F # # # '4 - A.$ 9B$ (+ # # GD.F =K662=9L8 - = # '4 - # " # - # '4 - > + # GD.F =4@2=4 - = # # '4 - # " # - '4 - $
GD.4 - + + # "
+ - C + + # 3 " " - I9? 9F 9KJ$ GD.4 + + 3- - -+ + - - # '4 I54 5?J$ ' GD.4 " - " # # # '4 - -- " - '4 - A.$ 9B$ * " # GD.4 " # '4 - - =4852=4F? =4462=LF -- " - " + " # - + # '4 - A.$ 9B$ ( # # # # - GD.4 " # # '4 - - =4?F2=46K =5L2=8@ " 7 # - + # '4 " GD.4$ (+ # -- # - # # GD.4 =4?F2=46K =5L2=8@ - =
28
Muñoz et al 2015
# # '4 - # # - + # # '4 - - A.$ 9B$
'# - + "
'4 '? 3- # #- - # - " # /( ## - #" # # I?6J$ '# + # # - - # 46=
'4 '? %D + #- # # - %D + # #- $
+ # - # ' - " H1' 3- + # #- I?6J$ '# - 3 # # # # '4 - - = # # -=- # " - # '4 $ ( -- # # - # # " = # - - # # '4 - # -=- - # '4 $ # = - /#4 GD.F " # - + # '4 - " " # - # '4 - GD.4 " # - + # # '4 - " - # '4 - GD.F " # - + # # '4 - " " # '4 - $ '# - # - + + # -=- 3- '4 -#- - #
29
Muñoz et al 2015
### # -3 + + - + # - # + -- $
E # # - - - # # -=-
'4 3- # # - A " B # " $ # 466R 7 + # - 3 - # - # 2#- # 2 # 2 - " # " # # # # # - 2 # ## + 7 3 + $ # 7 + = # - # 2 # 2 $ G + # - # 2 - + # # ## + = # # + # 8Z=# # - 3 - ## # "+ # # - # 2 $ ( # # # # + "+ # - # - 2 -$ '# #+ - # '4 3- - - # C # C # - # " " # -- + # # = # - - # - 3 '4 - $ .
30
Muñoz et al 2015
+ = # '4 - # = # - -$ AB - # # '4 - # # # - - # # #+ # - # " $ . # - 4866 "- # 8\= 7 - # - " + = # - % + ?$6$ '# - # # # 86R $ . # - # 2#- # 2 # 2 " 466R 7 "+ # 4866 "- - $ . # - # 2 - " 98R "+ # # @Z=# # - $ A/B - # # '4 - # # - # # " $ . # - # 2 # # # 86R 7 "+ + " @6R # - # # @Z= # - # - $ . # - # 2 # 86R 7 - # - $ A,B + = # '4 - - # # - # - - $ 7 + 7 # " - # + " -$ 3- # 3 + + = # # - 2# 2 - # + + + $ + = # 3 $
31
Muñoz et al 2015
, # 8\= C # '4 - $. - " # -@ - # ## # AH1B # # # '4 8\ $ # # # #C "C - # = - + - " # " 3$ " 866 # GF**! G-? + FK # $ !# + # ] , + + A. 2%B # - 3- # - - $ % + + - # + + - # # + # A # '4 - # -#B$ " = D( - # ' C A) ! M6$68> )) ! M6$64B$ # '4 - $'# '4 - " = 44 - + + # /#4 A=4?5624?86> @ B GD.F A=K662=9L8 =5@42=54K =F?F2=F6K =?KK2=?95 =4LL2=4LF> #B GD.4 A= 4462=LF> B !/ A=9?92=94F =4@52=4?@> #B $ '# - # -@ -$ '# 7 # - + " # " 3 # # # + 7 "C #
32
Muñoz et al 2015
7 # # $ GF**! G-? A866 B # # '4 - + FK # $ '# + - # ] , + + A. 2%B # - 3- # - - $ % + + - # + R + - # # + # A = - '4 - B$ " = D( - # ' C A) ! M6$64B$ . " # /#4 =4?562=4?86 GD.F =K662=9L8 # '4 - $ GF**! G-? - A866 B # # '4 - ; - + # /#4 =4?562=4?86 - + # GD.F =K662=9L8 - + " # # /#4 =4?562=4?86 # GD.F = K662=9L8 $ H + FK # $ '# + - # ] , + + A. 2%B # - 3- # - - $ % + + - # + R + - # # + A = - '4 - B$ " = D( - # ' C A) ! M6$64B$
33
Muñoz et al 2015
- - # - + # '4 - " /#4
+3- $!3 3- /#4 GF**! G-? $ A=B GF**! = # A?66 B 3- + AB # = - '4 - A/B # '4 - # + # /#4 = 4?562=4?86 AB # # = - # '4 - A / B # # /#4 3- + A?66 B$ A,=.B G-? = # A?66 B 3- + A,B # # = - '4 - A!B # '4 - # + # /#4 =4?562=4?86 A.B # # = - # '4 - A, ! .B # # /#4 3- + A?66 B$ . " # - # + + + A. 2%B$ '# + - # ] , + + A. 2%B # - 3- # - - $ ""+ ; - '4= 3- + # = - '4 - > - '4=H /#4 3- + # '4 - # + # /#4 =4?562=4?86 > -GD.F 3- + GD.F> -@ " - = H + > - " + # - $ - + # - # '4 - " GD.F$!3 3- GD.F GF**! G-? $ AB GF**! = # A?66 B 3- + # # = - '4 -
34
Muñoz et al 2015
- # + # GD.F =K662=9L8 # A?66 B # GD.F 3- + $ A/B G-? = # A?66 B 3- + # # = - - # A?66 B # GD.F 3- + $ H + + + A. 2%B$ '# + - # ] , + + A. 2%B # - 3- # - - $ ""+ ; - '4= H GD.F4 3- + # '4 - # + # GD.F =K662=9L8 $ # - = # # '4 - + + -=- $A=/B# # # - = # # - 3 4F95 C" # AB # A/B '4 - " + A% + ?$6B$ AB# - # = + + # - " + # '4 - $ '# = # " - -- " - - - ; B # /#4 " =4?562=4?86 ## - - # '4 - # " # - # # '4 - > B # GD.F =K662=9L8 - + # - +
# '4 - " # - # # '4 - > B GD.4 # '4 - A=4852=4F? =4462=LFB
35
Muñoz et al 2015
- # GD.4 # - # # '4 - A=4?F2=46K =5L2=8@B - +> +B # GD.F # # '4 - A=4@2=4B - # " # - # '4 - $ '# " 3 - # = # # - # - $
Acknowledgments
We thank the Antioxidant Lab members for helpful discussions and the support of the ,- . - . / 0 1+ -0 #$ '# C - -- " 44F6F?L 44@6@K5 44@6KF? 44?65L5 # Comisión Nacional de Investigación Científica y Tecnológica (CONICYT), Chile. Students were supported by studentships from the Universidad de Concepción and doctoral fellowships from CONICYT. % [1]
a) Linster, C. L.; Van Schaftingen, E. Vitamin C. Biosynthesis, recycling and degradation
in mammals. FEBS J 274:1-22; 2007.
36
[2]
Muñoz et al 2015
Ohta, Y.; Nishikimi, M. Random nucleotide substitutions in primate nonfunctional gene
for L-gulono-gamma-lactone oxidase, the missing enzyme in L-ascorbic acid biosynthesis. Biochim Biophys Acta 1472:408-411; 1999. [3]
Drouin, G.; Godin, J. R.; Page, B. The genetics of vitamin C loss in vertebrates. Curr
Genomics 12:371-378; 2011. [4]
Yang, H. Conserved or lost: molecular evolution of the key gene GULO in vertebrate
vitamin C biosynthesis. Biochem Genet 51:413-425; 2013. [5]
Faaland, C. A.; Race, J. E.; Ricken, G.; Warner, F. J.; Williams, W. J.; Holtzman, E. J.
Molecular characterization of two novel transporters from human and mouse kidney and from LLC-PK1 cells reveals a novel conserved family that is homologous to bacterial and Aspergillus nucleobase transporters. Biochim Biophys Acta 1442:353-360; 1998. [6]
Tsukaguchi, H.; Tokui, T.; Mackenzie, B.; Berger, U. V.; Chen, X. Z.; Wang, Y.;
Brubaker, R. F.; Hediger, M. A. A family of mammalian Na+-dependent L-ascorbic acid transporters. Nature 399:70-75; 1999. [7]
Rivas, C. I.; Zuniga, F. A.; Salas-Burgos, A.; Mardones, L.; Ormazabal, V.; Vera, J. C.
Vitamin C transporters. J Physiol Biochem 64:357-375; 2008. [8]
Burzle, M.; Suzuki, Y.; Ackermann, D.; Miyazaki, H.; Maeda, N.; Clemencon, B.;
Burrier, R.; Hediger, M. A. The sodium-dependent ascorbic acid transporter family SLC23. Mol Aspects Med 34:436-454; 2013. [9]
Sotiriou, S.; Gispert, S.; Cheng, J.; Wang, Y.; Chen, A.; Hoogstraten-Miller, S.; Miller,
G. F.; Kwon, O.; Levine, M.; Guttentag, S. H.; Nussbaum, R. L. Ascorbic-acid transporter Slc23a1 is essential for vitamin C transport into the brain and for perinatal survival. Nat Med 8:514-517; 2002.
37
[10]
Muñoz et al 2015
Corpe, C. P.; Tu, H.; Eck, P.; Wang, J.; Faulhaber-Walter, R.; Schnermann, J.; Margolis,
S.; Padayatty, S.; Sun, H.; Wang, Y.; Nussbaum, R. L.; Espey, M. G.; Levine, M. Vitamin C transporter Slc23a1 links renal reabsorption, vitamin C tissue accumulation, and perinatal survival in mice. J Clin Invest 120:1069-1083; 2010. [11]
Maulen, N. P.; Henriquez, E. A.; Kempe, S.; Carcamo, J. G.; Schmid-Kotsas, A.;
Bachem, M.; Grunert, A.; Bustamante, M. E.; Nualart, F.; Vera, J. C. Up-regulation and polarized expression of the sodium-ascorbic acid transporter SVCT1 in post-confluent differentiated CaCo-2 cells. J Biol Chem 278:9035-9041; 2003. [12]
Boyer, J. C.; Campbell, C. E.; Sigurdson, W. J.; Kuo, S. M. Polarized localization of
vitamin C transporters, SVCT1 and SVCT2, in epithelial cells. Biochem Biophys Res Commun 334:150-156; 2005. [13]
Michels, A. J.; Joisher, N.; Hagen, T. M. Age-related decline of sodium-dependent
ascorbic acid transport in isolated rat hepatocytes. Arch Biochem Biophys 410:112-120; 2003. [14]
Wu, X.; Itoh, N.; Taniguchi, T.; Hirano, J.; Nakanishi, T.; Tanaka, K. Stimulation of
differentiation in sodium-dependent vitamin C transporter 2 overexpressing MC3T3-E1 osteoblasts. Biochem Biophys Res Commun 317:1159-1164; 2004. [15]
Qiao, H.; May, J. M. Macrophage differentiation increases expression of the ascorbate
transporter (SVCT2). Free Radic Biol Med 46:1221-1232; 2009. [16]
Fujita, I.; Hirano, J.; Itoh, N.; Nakanishi, T.; Tanaka, K. Dexamethasone induces sodium-
dependant vitamin C transporter in a mouse osteoblastic cell line MC3T3-E1. Br J Nutr 86:145149; 2001.
38
[17]
Muñoz et al 2015
Wu, X.; Itoh, N.; Taniguchi, T.; Nakanishi, T.; Tatsu, Y.; Yumoto, N.; Tanaka, K. Zinc-
induced sodium-dependent vitamin C transporter 2 expression: potent roles in osteoblast differentiation. Arch Biochem Biophys 420:114-120; 2003. [18]
Savini, I.; Rossi, A.; Catani, M. V.; Ceci, R.; Avigliano, L. Redox regulation of vitamin C
transporter SVCT2 in C2C12 myotubes. Biochem Biophys Res Commun 361:385-390; 2007. [19]
Amano, A.; Aigaki, T.; Maruyama, N.; Ishigami, A. Ascorbic acid depletion enhances
expression of the sodium-dependent vitamin C transporters, SVCT1 and SVCT2, and uptake of ascorbic acid in livers of SMP30/GNL knockout mice. Arch Biochem Biophys 496:38-44; 2010. [20]
Mardones, L.; Zuniga, F. A.; Villagran, M.; Sotomayor, K.; Mendoza, P.; Escobar, D.;
Gonzalez, M.; Ormazabal, V.; Maldonado, M.; Onate, G.; Angulo, C.; Concha, II; Reyes, A. M.; Carcamo, J. G.; Barra, V.; Vera, J. C.; Rivas, C. I. Essential role of intracellular glutathione in controlling ascorbic acid transporter expression and function in rat hepatocytes and hepatoma cells. Free Radic Biol Med 52:1874-1887; 2012. [21]
Michels, A. J.; Frei, B. Myths, artifacts, and fatal flaws: identifying limitations and
opportunities in vitamin C research. Nutrients 5:5161-5192; 2013. [22]
Yu, R.; Schellhorn, H. E. Recent applications of engineered animal antioxidant
deficiency models in human nutrition and chronic disease. J Nutr 143:1-11; 2013. [23]
Iwama, M.; Shimokado, K.; Maruyama, N.; Ishigami, A. Time course of vitamin C
distribution and absorption after oral administration in SMP30/GNL knockout mice. Nutrition 27:471-478; 2011. [24]
Mohan, S.; Kapoor, A.; Singgih, A.; Zhang, Z.; Taylor, T.; Yu, H.; Chadwick, R. B.;
Chung, Y. S.; Donahue, L. R.; Rosen, C.; Crawford, G. C.; Wergedal, J.; Baylink, D. J.
39
Muñoz et al 2015
Spontaneous fractures in the mouse mutant sfx are caused by deletion of the gulonolactone oxidase gene, causing vitamin C deficiency. J Bone Miner Res 20:1597-1610; 2005. [25]
Maeda, N.; Hagihara, H.; Nakata, Y.; Hiller, S.; Wilder, J.; Reddick, R. Aortic wall
damage in mice unable to synthesize ascorbic acid. Proc Natl Acad Sci U S A 97:841-846; 2000. [26]
Kondo, Y.; Masutomi, H.; Noda, Y.; Ozawa, Y.; Takahashi, K.; Handa, S.; Maruyama,
N.; Shimizu, T.; Ishigami, A. Senescence marker protein-30/superoxide dismutase 1 double knockout mice exhibit increased oxidative stress and hepatic steatosis. FEBS Open Bio 4:522532; 2014. [27]
Horio, F.; Hayashi, K.; Mishima, T.; Takemori, K.; Oshima, I.; Makino, S.; Kakinuma,
A.; Ito, H. A newly established strain of spontaneously hypertensive rat with a defect of ascorbic acid biosynthesis. Life Sci 69:1879-1890; 2001. [28]
Horio, F.; Ozaki, K.; Yoshida, A.; Makino, S.; Hayashi, Y. Requirement for ascorbic acid
in a rat mutant unable to synthesize ascorbic acid. J Nutr 115:1630-1640; 1985. [29]
Frei, B.; Birlouez-Aragon, I.; Lykkesfeldt, J. Authors' perspective: What is the optimum
intake of vitamin C in humans? Crit Rev Food Sci Nutr 52:815-829; 2012. [30]
Cahill, L.; Corey, P. N.; El-Sohemy, A. Vitamin C deficiency in a population of young
Canadian adults. Am J Epidemiol 170:464-471; 2009. [31]
Carr, A. C.; Bozonet, S. M.; Pullar, J. M.; Simcock, J. W.; Vissers, M. C. A randomized
steady-state bioavailability study of synthetic versus natural (kiwifruit-derived) vitamin C. Nutrients 5:3684-3695; 2013. [32]
Mosdol, A.; Erens, B.; Brunner, E. J. Estimated prevalence and predictors of vitamin C
deficiency within UK's low-income population. J Public Health (Oxf) 30:456-460; 2008.
40
[33]
Muñoz et al 2015
Ravindran, R. D.; Vashist, P.; Gupta, S. K.; Young, I. S.; Maraini, G.; Camparini, M.;
Jayanthi, R.; John, N.; Fitzpatrick, K. E.; Chakravarthy, U.; Ravilla, T. D.; Fletcher, A. E. Prevalence and risk factors for vitamin C deficiency in north and south India: a two centre population based study in people aged 60 years and over. PLoS One 6:e28588; 2011. [34]
Schleicher, R. L.; Carroll, M. D.; Ford, E. S.; Lacher, D. A. Serum vitamin C and the
prevalence of vitamin C deficiency in the United States: 2003-2004 National Health and Nutrition Examination Survey (NHANES). Am J Clin Nutr 90:1252-1263; 2009. [35]
European Food Safety Authority. Scientific Opinion on the substantiation of health
claims related to vitamin C and protection of DNA, proteins and lipids from oxidative damage (ID 129, 138, 143, 148) pursuant to Article 13(1) of Regulation (EC) No 1924/2006. EPSA J 7:1226; 2009. [36]
Levine, M.; Conry-Cantilena, C.; Wang, Y.; Welch, R. W.; Washko, P. W.; Dhariwal, K.
R.; Park, J. B.; Lazarev, A.; Graumlich, J. F.; King, J.; Cantilena, L. R. Vitamin C pharmacokinetics in healthy volunteers: evidence for a recommended dietary allowance. Proc Natl Acad Sci U S A 93:3704-3709; 1996. [37]
Levine, M.; Wang, Y.; Padayatty, S. J.; Morrow, J. A new recommended dietary
allowance of vitamin C for healthy young women. Proc Natl Acad Sci U S A 98:9842-9846; 2001. [38]
National Institute of Health. Vitamin C Fact Sheet for Health Professionals. NIH Office of
Dietary Supplements; 2013. [39]
Conseil Supérior de la Santé. Recommandations nutritionnelles pour la Belgique.
Révision. CSS No 8309:1-91; 2009.
41
[40]
Muñoz et al 2015
Corpe, C. P.; Eck, P.; Wang, J.; Al-Hasani, H.; Levine, M. Intestinal dehydroascorbic
acid (DHA) transport mediated by the facilitative sugar transporters, GLUT2 and GLUT8. J Biol Chem 288:9092-9101; 2013. [41]
Lee, Y. C.; Huang, H. Y.; Chang, C. J.; Cheng, C. H.; Chen, Y. T. Mitochondrial
GLUT10 facilitates dehydroascorbic acid import and protects cells against oxidative stress: mechanistic insight into arterial tortuosity syndrome. Hum Mol Genet 19:3721-3733; 2010. [42]
Mardones, L.; Ormazabal, V.; Romo, X.; Jana, C.; Binder, P.; Pena, E.; Vergara, M.;
Zuniga, F. A. The glucose transporter-2 (GLUT2) is a low affinity dehydroascorbic acid transporter. Biochem Biophys Res Commun 410:7-12; 2011. [43]
Rumsey, S. C.; Daruwala, R.; Al-Hasani, H.; Zarnowski, M. J.; Simpson, I. A.; Levine,
M. Dehydroascorbic acid transport by GLUT4 in Xenopus oocytes and isolated rat adipocytes. J Biol Chem 275:28246-28253; 2000. [44]
Rumsey, S. C.; Kwon, O.; Xu, G. W.; Burant, C. F.; Simpson, I.; Levine, M. Glucose
transporter isoforms GLUT1 and GLUT3 transport dehydroascorbic acid. J Biol Chem 272:18982-18989; 1997. [45]
Vera, J. C.; Rivas, C. I.; Fischbarg, J.; Golde, D. W. Mammalian facilitative hexose
transporters mediate the transport of dehydroascorbic acid. Nature 364:79-82; 1993. [46]
Linster, C. L.; Van Schaftingen, E. Vitamin C. Biosynthesis, recycling and degradation in
mammals. FEBS J 274:1-22; 2007. [47]
Montecinos, V.; Guzman, P.; Barra, V.; Villagran, M.; Munoz-Montesino, C.;
Sotomayor, K.; Escobar, E.; Godoy, A.; Mardones, L.; Sotomayor, P.; Guzman, C.; Vasquez, O.; Gallardo, V.; van Zundert, B.; Bono, M. R.; Onate, S. A.; Bustamante, M.; Carcamo, J. G.; Rivas, C. I.; Vera, J. C. Vitamin C is an essential antioxidant that enhances survival of
42
Muñoz et al 2015
oxidatively stressed human vascular endothelial cells in the presence of a vast molar excess of glutathione. J Biol Chem 282:15506-15515; 2007. [48]
Nualart, F. J.; Rivas, C. I.; Montecinos, V. P.; Godoy, A. S.; Guaiquil, V. H.; Golde, D.
W.; Vera, J. C. Recycling of vitamin C by a bystander effect. J Biol Chem 278:10128-10133; 2003. [49]
Vera, J. C.; Rivas, C. I.; Velasquez, F. V.; Zhang, R. H.; Concha, II; Golde, D. W.
Resolution of the facilitated transport of dehydroascorbic acid from its intracellular accumulation as ascorbic acid. J Biol Chem 270:23706-23712; 1995. [50]
Vera, J. C.; Rivas, C. I.; Zhang, R. H.; Farber, C. M.; Golde, D. W. Human HL-60
myeloid leukemia cells transport dehydroascorbic acid via the glucose transporters and accumulate reduced ascorbic acid. Blood 84:1628-1634; 1994. [51]
Mizushima, Y.; Harauchi, T.; Yoshizaki, T.; Makino, S. A rat mutant unable to
synthesize vitamin C. Experientia 40:359-361; 1984. [52]
Vissers, M. C.; Bozonet, S. M.; Pearson, J. F.; Braithwaite, L. J. Dietary ascorbate intake
affects steady state tissue concentrations in vitamin C-deficient mice: tissue deficiency after suboptimal intake and superior bioavailability from a food source (kiwifruit). Am J Clin Nutr 93:292-301; 2011. [53]
Rucker, R. B. Allometric scaling, metabolic body size and interspecies comparisons of
basal nutritional requirements. J Anim Physiol Anim Nutr (Berl) 91:148-156; 2007. [54]
Chatterjee, I. B.; McKee, R. W. Biosynthesis of L-Ascorbic Acid in Liver Microsomes
from Mice Bearing Transplanted Tumors. Proc Soc Exp Biol Med 117:304-306; 1964.
43
[55]
Muñoz et al 2015
Upston, J. M.; Karjalainen, A.; Bygrave, F. L.; Stocker, R. Efflux of hepatic ascorbate: a
potential contributor to the maintenance of plasma vitamin C. Biochem J 342 ( Pt 1):49-56; 1999. [56]
Kaufmann, J.; Smale, S. T. Direct recognition of initiator elements by a component of the
transcription factor IID complex. Genes Dev 8:821-829; 1994. [57]
Javahery, R.; Khachi, A.; Lo, K.; Zenzie-Gregory, B.; Smale, S. T. DNA sequence
requirements for transcriptional initiator activity in mammalian cells. Mol Cell Biol 14:116-127; 1994. [58]
Lo, K.; Smale, S. T. Generality of a functional initiator consensus sequence. Gene
182:13-22; 1996. [59]
Loots, G. G.; Ovcharenko, I. rVISTA 2.0: evolutionary analysis of transcription factor
binding sites. Nucleic Acids Res 32:W217-W221; 2004. [60]
Wasserman, W. W.; Fahl, W. E. Functional antioxidant responsive elements. Proc Natl
Acad Sci U S A 94:5361-5366; 1997. [61]
Michels, A. J.; Hagen, T. M. Hepatocyte nuclear factor 1 is essential for transcription of
sodium-dependent vitamin C transporter protein 1. Am J Physiol Cell Physiol 297:C1220-C1227; 2009. [62]
Reidling, J. C.; Rubin, S. A. Promoter analysis of the human ascorbic acid transporters
SVCT1 and 2: mechanisms of adaptive regulation in liver epithelial cells. J Nutr Biochem 22:344-350; 2011. [63]
Savini, I.; Rossi, A.; Pierro, C.; Avigliano, L.; Catani, M. V. SVCT1 and SVCT2: key
proteins for vitamin C uptake. Amino Acids 34:347-355; 2008.
44
[64]
Muñoz et al 2015
Kitamuro, T.; Takahashi, K.; Ogawa, K.; Udono-Fujimori, R.; Takeda, K.; Furuyama, K.;
Nakayama, M.; Sun, J.; Fujita, H.; Hida, W.; Hattori, T.; Shirato, K.; Igarashi, K.; Shibahara, S. Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1 gene in human cells. J Biol Chem 278:9125-9133; 2003. [65]
Shan, Y.; Lambrecht, R. W.; Donohue, S. E.; Bonkovsky, H. L. Role of Bach1 and Nrf2
in up-regulation of the heme oxygenase-1 gene by cobalt protoporphyrin. FASEB J 20:26512653; 2006. [66]
Dhakshinamoorthy, S.; Jain, A. K.; Bloom, D. A.; Jaiswal, A. K. Bach1 competes with
Nrf2 leading to negative regulation of the antioxidant response element (ARE)-mediated NAD(P)H:quinone oxidoreductase 1 gene expression and induction in response to antioxidants. J Biol Chem 280:16891-16900; 2005. [67]
Hou, W.; Shan, Y.; Zheng, J.; Lambrecht, R. W.; Donohue, S. E.; Bonkovsky, H. L. Zinc
mesoporphyrin induces rapid and marked degradation of the transcription factor Bach1 and upregulates HO-1. Biochim Biophys Acta 1779:195-203; 2008. [68]
Kaspar, J. W.; Jaiswal, A. K. Antioxidant-induced phosphorylation of tyrosine 486 leads
to rapid nuclear export of Bach1 that allows Nrf2 to bind to the antioxidant response element and activate defensive gene expression. J Biol Chem 285:153-162; 2010. [69]
Raval, C. M.; Zhong, J. L.; Mitchell, S. A.; Tyrrell, R. M. The role of Bach1 in ultraviolet
A-mediated human heme oxygenase 1 regulation in human skin fibroblasts. Free Radic Biol Med 52:227-236; 2012. [70]
Oyake, T.; Itoh, K.; Motohashi, H.; Hayashi, N.; Hoshino, H.; Nishizawa, M.;
Yamamoto, M.; Igarashi, K. Bach proteins belong to a novel family of BTB-basic leucine zipper
45
Muñoz et al 2015
transcription factors that interact with MafK and regulate transcription through the NF-E2 site. Mol Cell Biol 16:6083-6095; 1996. [71]
Odom, D. T.; Dowell, R. D.; Jacobsen, E. S.; Gordon, W.; Danford, T. W.; MacIsaac, K.
D.; Rolfe, P. A.; Conboy, C. M.; Gifford, D. K.; Fraenkel, E. Tissue-specific transcriptional regulation has diverged significantly between human and mouse. Nat Genet 39:730-732; 2007. [72]
Odom, D. T.; Zizlsperger, N.; Gordon, D. B.; Bell, G. W.; Rinaldi, N. J.; Murray, H. L.;
Volkert, T. L.; Schreiber, J.; Rolfe, P. A.; Gifford, D. K.; Fraenkel, E.; Bell, G. I.; Young, R. A. Control of pancreas and liver gene expression by HNF transcription factors. Science 303:13781381; 2004. [73]
Gonzalez, F. J. Regulation of hepatocyte nuclear factor 4 alpha-mediated transcription.
Drug Metab Pharmacokinet 23:2-7; 2008. [74]
Kyrmizi, I.; Hatzis, P.; Katrakili, N.; Tronche, F.; Gonzalez, F. J.; Talianidis, I. Plasticity
and expanding complexity of the hepatic transcription factor network during liver development. Genes Dev 20:2293-2305; 2006. [75]
Hayhurst, G. P.; Lee, Y. H.; Lambert, G.; Ward, J. M.; Gonzalez, F. J. Hepatocyte
nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 21:1393-1403; 2001. [76]
Li, J.; Ning, G.; Duncan, S. A. Mammalian hepatocyte differentiation requires the
transcription factor HNF-4alpha. Genes Dev 14:464-474; 2000. [77]
Lu, H.; Gonzalez, F. J.; Klaassen, C. Alterations in hepatic mRNA expression of phase II
enzymes and xenobiotic transporters after targeted disruption of hepatocyte nuclear factor 4 alpha. Toxicol Sci 118:380-390; 2010.
46
[78]
Tronche, F.; Yaniv, M. HNF1, a homeoprotein member of the hepatic transcription
regulatory network. Bioessays 14:579-587; 1992.
Muñoz et al 2015
47
Muñoz et al 2015
'" 4$ 7 - # '4 - - - ==================================================================================================================== ,D
8Z @Z - 7
==================================================================================================================== '4 -
A.B; TCCCCCCGGGCATGAGCTACCAAGATAGGGTCT
A4F95 "-B
A%B; CCGCTCGAGCACGGGTTTGAGAAATCTCTGAGG
/#4
A.B; TTCTCTTCCAGCACATGGGGAGCGGGAGAAGATGAACCCAG
A=4?8LB
A%B; CTGGGTTCATCTTCTCCCGCTCCCCATGTGCTGGAAGAGAA
/G4
A.B; GAGTCAGTTCTCTTCCAGCACACGGGAGAAGATG
A=4?8LB
A%B; CATCTTCTCCCGTGTGCTGGAAGAGAACTGACTC
GD.F
A.B; GGCCAGGCTGGGTTCACTGGGATCTGC
A=K66B
A%B; GCAGATCCCAGTGAACCCAGCCTGGCC
GD.F
A.B; CACAGCACAAGGGGCCTGTGTGCATGCC
A=5@4B
A%B; GGCATCCACACAGGCCCCTTGTGCTGTG
GD.F
A.B; ATATACAAATACAGGTAATGGTCCTGTCCTCAAAGAACAGTG
A=F?FB
A%B; CACTGTTCTTTGAGGACAGGACCATTACCTGTATTTGTATAT
GD.F
A.B; CCTCTTCACCCTGTAGCTTCCCTAGGGAAGCA
A=?KKB
A%B; TGCTTCCCTAGGGAAGCTACAGGGTGAAGAGG
48
GD.F
A.B; AGCAGGTGGGCGTCGCTTGGGTGG
A=4LLB
A%B; CCACCCAAGCGACGCCCACCTGCT
Muñoz et al 2015
GD.4
A.B; TCTGGAGCTATGGACCTGATTGACTTTGAACAATGTC
A=446B
A%B; GACATTGTTCAAAGTCAATCAGGTCCATAGCTCCAGA
2!/β A.B; CTACACACAACAACATTCTTAATATTTTTAAAGAGGGCCCCTTCT A=9?9B
A%B; AGAAGGGGCCCTCTTTAAAAATATTAAGAATGTTGTTGTGTGTAG
2!/β A.B; GCCCCGTCCCCTTTCTGGAGCTATGG A=4@5B
A%B; CCATAGCTCCAGAAAGGGGACGGGGC
/#4
A.B; TCTCTGCCGCGGGCCACCATGTCTGTGAGTGAGAGTGCAGTGTT
A #B
A%B; CAGAGAAAGCTTTTACTCATCAGTAGTACACTTGTCAGACATCTG
GD.Fα
A.B; TCTCTGCCGCGGGCCACCATGCGACTCTCTAAAACCCTCGCCGA
A #B
A%B; CAGAGAAAGCTTCTAGATGGCTTCCTGCTTGGTGATCGTTGGCT
GD.4α
A.B;TCTCTGAAGCTTGCCACCATGGTTTCTAAACTGAGCCAGCTGCAGACG
A #B
A%B; TCTCTGGGTACCTTACTGGGAGGAAGAGGCCATCTGGGTGGA
49
Muñoz et al 2015
•
Rats synthesize their own ascorbic acid in the liver.
•
SVCT1 is fundamental for humans to obtain ascorbic acid (vitamin C) from the diet.
•
Specific cis-regulatory elements are involved in species-specific transcriptional regulation of the rat and human SVCT1 gene.
•
SVCT1 transcription is differentially regulated in cells from species that differ in their capacity to synthesize ascorbic acid.
Figure1
Figure2
Figure3
Figure4
Figure5
Figure6
Figure7
Graphical Abstract (for review)
Cis-regulatory elements involved in speciesspecific transcriptional regulation of the SVCT1 gene in rat and Human hepatoma cells Alejandra Muñoz, Marcelo Villagrán, Paula Guzmán, Carlos Solíz, Marcell Gatica, Carlos Aylwin, Karen Sweet, Mafalda Maldonado, Elizabeth Escobar, Alejandro M. Reyes, Jorge R. Toledo, Oliberto Sánchez, Sergio A. Oñate, Juan Carlos Vera, Coralia I. Rivas
www.elsevier.com/locate/freeradbiomed
PII: DOI: Reference:
S0891-5849(15)00187-2 http://dx.doi.org/10.1016/j.freeradbiomed.2015.04.024 FRB12403
To appear in:
Free Radical Biology and Medicine
Received date: 21 January 2015 Revised date: 9 April 2015 Accepted date: 20 April 2015 Cite this article as: Alejandra Muñoz, Marcelo Villagrán, Paula Guzmán, Carlos Solíz, Marcell Gatica, Carlos Aylwin, Karen Sweet, Mafalda Maldonado, Elizabeth Escobar, Alejandro M. Reyes, Jorge R. Toledo, Oliberto Sánchez, Sergio A. Oñate, Juan Carlos Vera, Coralia I. Rivas, Cis-regulatory elements involved in species-specific transcriptional regulation of the SVCT1 gene in rat and Human hepatoma cells, Free Radical Biology and Medicine, http://dx.doi.org/ 10.1016/j.freeradbiomed.2015.04.024 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1
Muñoz et al 2015
Cis-regulatory elements involved in species-specific transcriptional regulation of the SVCT1 gene in rat and human hepatoma cells !" # ! " $ % " & %$ ' (" # $ ( & ) *$ %+))
,- . - . / 0 1+ -0
/ 1+ 2 ( / 3 456 -0 # "
* / 7 " . 1+ #
- * ' ( / 3 859 + #
,- . . / 0 1+ -0
/ 1+ 2 ( / 3 456 -0 #
,- !- : . 1+ -0
/ 1+ 2 ( / 3 456 -0 # ) - # ; +< $ )) - # ; +< $
2
Muñoz et al 2015
""+ ; '4 = - " - 4> . ?@ A " - B " 4$ " " - " # = - + - A'B$ % " + ' 3- - 3 + - # # - # + # C '4 %D - + #- #
"+ # #- $ ' " # - + + - # - 3 - # $ E 4F95 "- # - 3 - # =+ - - " " - " = $ E 3 # - # - - GF**! # G-? #- 3- + + # =3- - # " 7 - # '4 - $ '# + # - = # - + # - 7 # "
3
Muñoz et al 2015
# - /#4 GD.F # - 7 + # # - $
+ GD.4 # # # # '4 - - # '4 - " #
- + $ '# - # + " # - # # - # " # # - # " " # # # - # # - - - '4 3- $
- > '4 - > " - 4 - > '4 - > - - - 3 $ *
3 # # "
C H= " A " B # 3 = C # =H= " A# " ,GB I4J$
+ " # " " # " - # # - - " - # - # 7 # + I4=FJ$ * # - # # # 3 A1H(B # # - # " ## I4=FJ$ - # # " " A # # - + B
4
Muñoz et al 2015
# # # #- # # # #+ # - I4=FJ$ Ascorbic acid is transported into cells by the sodium-coupled vitamin C transporters SVCT1 and SVCT2 that are the product of genes SLC23A1 and SLC23A2, respectively, and show differential expression at cellular and tissue levels [5-8]. SVCT2 is expressed in most cells and tissues [6-9], while SVCT1 shows high level expression in a restricted number of epithelial cells in organs that regulate the availability of ascorbic acid from the diet (intestine), antioxidant metabolism and synthesis of ascorbic acid (liver) and ascorbic acid reabsorption (kidneys) [612]. SVCT1 and SVCT2 expression is regulated during cell differentiation, aging and in response to oxidative stress [11-19]. Recently, we obtained evidence of differential regulation of SVCT expression in response to acute oxidative stress in cells from species that differ in their capacity to synthesize vitamin C, with a marked decrease in SVCT1 mRNA and protein levels in rat hepatoma cell that was not observed in human hepatoma cells [20]. Important advances in our current understanding of vitamin C cell and molecular biology have been obtained using rats, mice and cellular models derived from these species. These animal and cellular models are used as surrogates to investigate the control and regulatory aspects of the metabolism of vitamin C in humans. However, it is now becoming clear that the capacity for synthesizing their own ascorbic acid render these models poorly adequate to investigate and further our understanding of the physiology and pathophysiology of vitamin C in humans [21]. Similar to humans, guinea pigs lost the capacity to synthesize ascorbic acid in the course of evolution and may represent a better human-like model to study vitamin C metabolism and regulation [3, 4, 21]. There are also several rat and mice mutant models, of natural origin and also genetically engineered, that lack the capacity to synthesize ascorbic acid and are used to
5
Muñoz et al 2015
interrogate different areas of vitamin C metabolism related with the biological-biomedical significance of megadoses of vitamin C, studies of supplementation, depletion and repletions, in vivo adaptative responses to oxidative stress, and analysis of xenografted human tumor responses to changes in antioxidant status and oxidative stress [9, 10, 19, 21-28].
( - # # " # # # - A " B
# " -=- # # # # 3- # " - # 7 + # -# C + $ G # - # + " # + # # = - + " +" # # - # " I4 9 K ?4J$ D - # +
- I?LJ$ - # - + AM 44 N B " - A44=?K N B 7 AO ?K N B I@6=@FJ$ + - + = C + -- 3 86 P # 1 D Q I@4 @FJ @6 N I@6J = - - C + I@? @@J$ # A%,B + " F6 2 # 1 I@8J 98 L6 2 - + 1 I@5=@KJ 446 2 . / I@LJ$
# C " 7 #
-- + # - A B + I@5 @9J # -3 @=-# =-; B @6 466 2 #
6
Muñoz et al 2015
- #- " - A46=56 N - 4$?=@$K B> " 466=?66 2 - # - " 96=K6 N 4$?=F - + > O F66 2 # # - " I@5 @9J$ , A- -# -#B # + + # 3 # - 46 86= I@5 @9J$ *- -- # " A # 42 B - # - " # # + " 3 # " - # - 3 " I@5 @9J$ '# + -3 - " # # + + - + " -; " - A - CB - " - 3 $ '- # " - # - '4 3- # - " # " " # " - # - - '4 # - " - # # - 3 " I5 46=4?J$ # # + "
# + - # " - IF6= F8J # + # # - - # 7 " - + # $ ' - -- " " '? ##= " - # 3- # I5=K F5J$ G + +" " # 3 - " # 466= # " 3 - - " + # 3
7
Muñoz et al 2015
- I?4 F5J$ '# 7 + # # # #+ " C $ * # # -- + # @6 + - = - + " @6 P I@5 @9J # # +" + # # " - 3 # ?R # " # + A" ? B$ # - ## # + + - # + + # - - # " # # - " - # # " - IF9=86J$ '# - - # " - "C " " 3 # " - " - IF5=86J$
- # " + -
# # " #- IK ?4J$ C C A'4=2=B + # '4 " # C + 3 # - " # - " - I46J$ # C " -- " # + + # - + # =#- =- + #
"+ # I?8 ?K 84 8?J$ G + " F66=866 " 2 - AK=46 ?6= B 7 # - " - I8?J " - # K=46 ?6=
8
Muñoz et al 2015
" 7 + " 6$8F=6$59 96=C - I8@J$ '# # # #+ 7 + # 3 # # 7 I8? 8@J # " -" # - F86 + 2 - I8@ 8FJ$
(+ + # # " +" + #
- 7 3- + '4 # " # " +" # - # # + # + I?4J$ E # # - # # '4 - = # -=- - # # - 7
'4 3- # - 3- # '4
"+ # I?6J$ '# # - - # + - = # - 3 - # # = - - # -=- $ ( + # 3 = - # - + # - 3 - # # -=- > # " - # # $ - # - 7 /#4 " =4?562=4?86 GD.F " =K662 =9L8 - # - # $ '# # # + " # # - 7 '4 3- -- - 7 " +" # - -" # + $
9
Muñoz et al 2015
Material and Methods
'# #- " GF**! A'S %H=48FK' B # #
#- G-? A'S G/=K658' B % *=45F6 AG ' B -- # 46R " + -2 - I?6 88J$
'# - 7 # - "
# ! - / * # " " A# -;22 $"$ 2B I85=8KJ$ = # # - % =*' ?$6 A# -;22+ $ $ 2B " + + + " # - 86R # # - I8LJ$ Cloning of the promoter of the rat SLC23A1 gene and construction of truncated and mutant promoters
10
Muñoz et al 2015
4F95="- " % - ,D GF**!
##= !" ** A B$ /C 7 # 4K # 8T '4 A'" 4B$ '# %=- " -%=** '(( + A*+ B
" " # -H@=/ + A B # + -'4=H # - $ 7 # # # - # - A'B " # # '4 %D 7 A/C D " D U649@48B$ 1 -'4=H # - # 7 # - + #$ * + - - " # V C=# ** =, C A B$ # 7 # " - - " - - " - # + # 7 # " - A'" 4B$ '# # - " ,D 7 $ " "
GF**! G-? -- 3 96R "
?F= - $ ' + ,D - #
11
Muñoz et al 2015
. A B$ / 866 - 46 + 3- # H - A-%H= > B -3 + @66 P # $ ' #+ FK # # , H A B$ , # + "$ # !# " "
'# - - ,D -- %D 3 GF**! $ '# %D -- #
%D C !$Q$D$ A( / = CB
+ - - # - W - '- %+ '- A B$ . % - - - - - /#4 GD.F GD.4 A'" 4B$ % - X= # %'=% # # -$ / ' ' # " C - - - - @6 L8 Y " @6 @6 L8 Y @6 56 Y @6 5K Y 3 - 8 5K Y$ '# % - - " -# ?R + " # # " $ % - - 3 - # # 1 ' ,D - A ( /*( H" B " - =- " 7 $
12
Muñoz et al 2015
$
- " = D( A -#
5B - # !%6$68$ '# ' C - # -- $
Results The rat SVCT1 proximal promoter possess putative species-specific cis-regulatory elements
E 4866 "- - # - 3 -
8Z # - A'B # - # # - = # # - '4 3- -=- $ '# + # # - 3 -
# ''= C =# A# -;22-$ $ 2B$
''= - A*B 7 A2'B A # - B # ' I85=8KJ$ '# - 3 - # 7 ''' # - + $ E # # - # 7 # - =
13
Muñoz et al 2015
# - 3 - # + - " # " A# #- -B - # # " A B$ '# A ?$6 !% / B I8LJ + 466R 7 + # = - # 4866 "- # - 3 - # - # 2#- # 2 # 2 A.$ 4B$ ( # # # # 98R + # 996 "- - # ' A =@962[4 =5562=866 =K?62=966B " + # =48662=K?6 # - # 2 - A.$ 4B$ E# - # 2# # # # + = A-- 3 98R + B =?662[4 =@962=@66 = 9662=586 + # ' # # + # 8Z=# # 4866 "- - 3 - A =48662=966B A.$ 4/B$ + +
"+ # - # 2 # A =?662[4 - # 'B # " 98R + A.$ 4/B$ - " + O K6R 7 + = # 4@66 "- - # ' # - 3 - # " + = # =48662=4@66 A. 4B$ '# + + "+ # - 2 - # A=?662[4 - # 'B # " 96R + A.$ 4B$
+ # 44 7
- - # - 3 - A.$ 4,B$ * #- # # ' # -
14
Muñoz et al 2015
7 # " /#4 - =4?562=4?86 GD.F - =K662=9L8 !/ - =9?92=94F GD.F - =5@42=54K =F?F2=F6K /#4 - =@F52=@@5 GD.F - =?KK2=?95 =4LL2=4LF GD.4 - =4852=4F? !/ - =4@52= 4?@ GD.4 - =4462=LF A.$ 4,B$ '# 44 7 # " - - # '4 - # ## + # - 2 # # + # - - A.$ 4,B$ ( # # # F 7 # " - - # '4 - GD.F - =4LL2=4LF GD.4 - =4852=4F? !/ - =4@52=4?@ GD.4 - =4462=LF + # - 2# A.$ 4,B$ "+ # - 2 - #
? 7 # " - - # '4 - !/ - =4@52=4?@ GD.4 - =4462=LF + # - - A.$ 4,B$ "&
'# - 3 - # - #
- # - -H@=" # 3- + -'4= H ## # - 3 - # - # $ ' GF**! # G-? #- # # # - 3 - - + 3-
15
Muñoz et al 2015
# -'4=H # "C + 3- # # - = -H@=" + A # B$ ' # = 7 '4 3- - - + # - 3 - $ . GF**! G-? # #- $ ?49 "- - # - =4F95 =4?8L # ' =4?8L "- - # - + " @5= K= # - + # - #" # # # - # A.$ ?B$ # 8FL "- - # =4?8L =946 # ' # 946 "- - 98R - + " # # # # 3 + # =4?8L =946 # 7 # # $ # =946 "- - - + # F K= ## # # # # - A.$ ?B$ '# - + =4?8L2=946 + # # - 8FL "- ,D " C - # #" + # '4 - # 3- # #- $ , =9462=FK8 A??8 "-B FK8 "- - # - + -- 3 F= ## # # # # - A.$ ?B$ , =FK62=?88 A?@6 "-B ?88 "- - # - + " ?$8= ## # # # - # #
16
Muñoz et al 2015
- # - 3 " =?88 [4 "- # '4 - # " - # A.$ ?B$ As mentioned before, conservation and cluster analysis allowed the identification of 11 consensus sequences containing potential transcription factor recognition sites in the rat SVCT1 proximal promoter. To functionally demonstrate that these potential cis-regulatory elements are important for the transcriptional activity of the rat SVCT1 promoter, we altered the putative transcription factor binding sites by introducing inactivating mutations that would remove or structurally alter the consensus sequences for nine consensus sequences for the binding of a total of four different transcription factors present in the SVCT1 rat promoter (one Bach1 site, five HNF4 sites, one HNF1 site and two CEBP sites). We generated individual mutant promoters with alterations in the Bach1 site at position -1,260/-1,250, the five HNF4 sites at positions 800/-795, -631/-618, -424/-408, -288/-276 and -199/-194, the two CEBP sites at positions -727/714 and -136/-123 and the HNF1 site at position -110/-94, to determine the relative contribution of each binding site to the transcriptional activity of the SVCT1 promoter. Vectors encoding the mutant promoters carrying altered consensus binding sites were transiently transfected in H4IIE and HepG2 cells, and the effects of the specific mutations on the transcriptional activity of the SVCT1 promoter was analyzed by measuring luciferase activity. The consensus sequence of the Bach1 binding site at position -1,260/-1,250 that contains 11 bp was modified by random exchange of three bp of the ARE (antioxidant response element) sequence described as the core of the Bach1 site [60] (random TCA to GAG mutation), alteration that caused a 100% increase in the transcriptional activity of the mutated rat SVCT1 promoter expressed in H4IIE cells. Next, we produced a 7 bp deletion that eliminated the core and the Bach1 binding site causing a 200% increase in the promoter transcriptional activity in the H4IIE
17
Muñoz et al 2015
cells. To confirm the implication of the Bach1 site in the SVCT1 promoter regulation, we generated a third construct by eliminating the remaining 5'-sequence by exonuclease digestion in the Bach1 mutant GAG, generating a truncated (1,250 bp long) and mutant promoter that showed a 100% increase in transcriptional activity compared with the control SVCT1 promoter (Fig. 3). Interestingly, each of these effects on the transcriptional activity of the mutated SVCT1 promoters in the rat H4IIE cells were also observed when the mutant promoters were expressed in human HepG2 cells (Fig. 3). Most importantly, our data indicate that the transcriptional activation of the SVCT1 promoter is maintained regardless of the method used to inactivate the Bach1 site. Thus, the mutagenesis data confirmed the results obtained with truncated transporters that suggested the presence of a transcriptional repressor motif in the segment encompassing the deletion -1,476/-1,259 that may correspond to a consensus sequence for a Bach1 binding site at position -1,260/-1,250 in the rat SVCT1 promoter.
'# + GD.F " - # # #
+ # - + # - + - 3- # GF**! #- $ # GD.F =K662=9L8 =F?F2=F6K # '4 - - + " L8 56R - + - # # + # '4 - A.$ @B$ * # GD.F =5@42=54K =?KK2=?95 # - + " 466 K6R - + A.$ @B$ ( # # # # GD.F =4LL2=4LF - # + - # # - GF**! A.$ @B$ E# # - 3- # # G-? # - GD.F =K662=9LF # - + A@6R # # '4 - B # "+ GF**! A.$ @B$ '#
18
Muñoz et al 2015
AGD.F =5@42=54K =F?F2=F6K =?KK2=?95 =4LL2=4LFB # - + + # # '4 - AL6 4@6RB A.$ @B$ '# - -- # " - # - - + # - # = 4?8L2=946 # - 7 GD.F " - =K662=9L8 # '4 - $
'# + # 2# # + 466R
# " 7 # " GD.4 # # '4 - $ * # '4 - # GD.4 9 "- A =46K =46?B - # - + - # # - # 3- GF**! G-? # # GD.4 # # '4 7 - + A.$ @B$ * GD.4 3- # # '4 I54 5?J ## + # # 3 " GD.4 " -$
# !/X A=9?92=94FB " 8 "- =9?6 =
945 - 3- " 56R - # # '4 - GF**! $ ( # # # # !/X " - =4@52=4?@ " 9 "- =4@6 =4?F # + A.$ @B$ (+ # '4 " # 8Z= # '4 - $
19
Muñoz et al 2015
To further examine the importance of the Bach1 -1,260/-1,250 and HNF4 -800/-795 consensus binding sequences in regulating the SVCT1 rat promoter, we produced a double mutant containing simultaneous mutations at the Bach1 -1,260/-1,250 site (triple TCA to GAG mutation at position -1,254/-1,252) and the HNF4 -800/-795 site (6 bp deletion at position -800/795). As expected from our previous results, the single Bach1 mutant showed a similarly increased transcriptional activity (about two-fold) in both the rat H4IIE and human HepG2 cells, compared with control SVCT1 promoter. The single HNF4 mutant showed a markedly decreased transcriptional activity when expressed in H4IIE cells (less than 10% the activity of the control promoter), with a minor decrease (about 70% the activity of the control promoter) when expressed in human HepG2 cells. Interestingly, further results showed that the double mutation caused a three-fold increase in transcriptional activity compared with the control SVCT1 promoter in both the rat H4IIE and human HepG2 cells, indicating dominance of transcriptional activation resulting from the removal of the highly repressive Bach1 motif at position -1,260/1,250 (Fig. 4).
Bach1 represses and HNF4 activates transcription of the SVCT1 rat promoter
We tested whether Bach1 represses the transcriptional activity of the rat SVCT1 promoter by co-transfecting H4IIE cells with plasmids encoding the Bach1 cDNA simultaneously with the rat SVCT1 promoter. The results of these experiments revealed that co-transfection of H4IIE cells with expression plasmids encoding the transcription factor Bach1 and the full length SVCT1 rat promoter caused a marked decrease in the transcriptional activity of the rat SVCT1 promoter, to about 35% of the respective control (Fig. 5A). The specificity of the repression was
20
Muñoz et al 2015
demonstrated in H4IIE cells co-transfected with plasmids encoding the Bach1 cDNA and a mutated form of the SVCT1 promoter carrying an inactivating mutation at the Bach1 consensus binding sequence (triple TCA to GAG mutation at position -1,254/-1,252). As expected, H4IIE cells transfected with the mutated SVCT1 promoter showed an increased transcriptional activity that was about 2.5-fold higher than cells transfected with the control SVCT1 promoter. Cotransfected cells showed a luciferase level similar to that of cells transfected with mutant SVCT1, indicating that Bach1 expression failed to affect the transcriptional activity of the Bach1-inactivated SVCT1 promoter, an observation that we propose is due to the mutated Bach1 binding sequences (Fig. 5B). Sequence comparison between rat/human SVCT1 orthologs promoters indicated that sequence homology decreases along the more distal 5'-regions of the promoter, including the absence of a Bach1 consensus sequence in the human SVCT1 promoter. Accordingly, H4IIE cells simultaneously co-transfected with a plasmid encoding Bach1 and a plasmid encoding a 1,485 pb human SVCT1 (Bach1-less) promoter, showed no changes in luciferase activity, indicating that Bach1 overexpression produced no alterations of the transcriptional activity of the human SVCT1 promoter (Fig. 5C). Almost identical results were observed in human HepG2 cells (Fig. 5D-F). As a positive control for the activity of the human SVCT1 promoter, we transfected the H4IIE cells with a plasmid encoding the transcription factor HNF1 simultaneously with a plasmid encoding a 1,485 pb human SVCT1 promoter that contains a consensus site for the binding of HNF1 at -124/-108. As expected, HNF1 activated human SVCT1 promoter transcriptional activity in co-transfected H4IIE cells as assessed by a five-fold increase in luciferase activity compared with control cells transfected with the plasmid encoding the human SVCT1 promoter alone, and cells transfected with a plasmid encoding the human
21
Muñoz et al 2015
SVCT1 promoter with an inactivating mutation in the HNF1 site failed to show any luciferase activity (data not shown). A similar strategy was used to assess the role of HNF4 in regulating the transcriptional activity of the rat SVCT1 promoter. Co-transfection of rat H4IIE and human HepG2 cells with expression plasmids encoding the transcription factor HNF4 and the full length SVCT1 rat promoter caused a 3.5 to 2.5-fold increase in the transcriptional activity of the rat SVCT1 promoter, compared with the respective control (Fig. 6). The specificity of the activation was demonstrated in H4IIE cells co-transfected with plasmids encoding the HNF4 cDNA and a mutated form of the SVCT1 promoter carrying an inactivating mutation at the HNF4 consensus binding sequence (six bp deletion at position -800/-795). As expected, H4IIE cells transfected with the mutated SVCT1 promoter alone showed a markedly decreased transcriptional activity of approximately 20% of control SVCT1 promoter, while co-transfected cells showed a luciferase level similar to that control SVCT1 promoter, suggesting that HNF4 activated the remaining transcriptional activity of the mutated SVCT1 promoter (Fig. 6). Sequence comparison between rat/human SVCT1 orthologs promoters indicated the presence of two HNF4 consensus sequence in the human SVCT1 promoter, at positions -1,108/-1,096 and -13/-1 from the TSS, and mutagenesis of the -13/-1 HNF4 site decreased the transcriptional activity of the human SVCT1 promoter by 60 to 75% compared with absence of effect when the -1,108/-1,096 HNF4 site was mutated. As a further specificity test, we transfected H4IIE cells with a plasmid encoding HNF4 simultaneously with a plasmid encoding a 1,485 pb human SVCT1 promoter, and as expected, HNF4 protein decreased human SVCT1 promoter transcriptional activity in co-transfected H4IIE cells, as evidenced by a 70% decrease in luciferase activity compared with control cells transfected with the plasmid encoding the human SVCT1 promoter alone, and moreover, cells
22
Muñoz et al 2015
transfected with a plasmid encoding the human SVCT1 promoter with an inactivating mutation in the -13/-1 HNF4 site failed to show any effect on luciferase activity (data not shown). Therefore, HNF4 functions as a transcriptional activator of the SVCT1 gene promoter in the rat while it acts as a repressor in the case of the human SVCT1 gene promoter.
Discussion
'4 - # ## 3- " - + - # +
C # 3- -
3 + I4 5=K 5@J$ * # 3 " + '4 3- - 3 + - # # - # " I?6J$ E "+ C '4 %D - + #- GF**! - # " # # # # #" " # =%= 3 A/(B # "+ # #- G-? $ % GF**! # " # " # # G-? # " " # + 3 I?6J$ (+ # 3
-=- # # 3- '4 #- + # $ To better understand the regulatory aspects involved in the regulation of the expression of the rat SVCT1 gene, we characterized its 5ƍ-regulatory region by identifying the promoter sequences required for directing the transcription of the luciferase reporter gene in cultured rat
23
Muñoz et al 2015
H4IIE and human HepG2 hepatoma cells. The first finding of this study, obtained from sequence, conservation and cluster analysis is that the promoter regions of rat and mouse SVCT1 genes are highly homologous and present cis-regulatory elements that are highly conserved interspecies along most of the promoter 1,476 pb length. Eleven consensus sequences for the binding of transcription factors related to antioxidant response (two Bach1 sites, five HNF4 sites, two CBEP sites and two HNF1 sites) were identified as conserved in the rat/mouse SVCT1 promoter. On the other hand, the analysis of the rat/human orthologs revealed that the region of high homology and conservation was restricted to rather short segments in the 3'-half of the 1,476 pb promoter region. Thus, only a reduced number of cis-regulatory elements consisting of consensus sequences for the binding of transcription factors were identified as conserved in the rat and human SVCT1 promoter (one HNF4 site, two HNF1 sites, one CEBP site). Using the above information as the starting point, we performed a structural-functional study to identify critical cis-regulatory elements with specificity for regulating the transcriptional activity of the rat SVCT1 promoter in a species-specific manner, cis-regulatory elements that are absent or possess divergent functions in the promoter of the corresponding human SVCT1 gene. The findings of the present study strongly suggest that the regulation of vitamin C metabolism in humans may differ from that of species capable of synthesizing vitamin C de novo.
'# 7 + " # #
'4 - # # + 7 - - " - # - # # - =8662[4 # ' A.$ 9B$ * # 8Z= =4F952=866 # ' # # # # '4 - - " /#4 A=4?562=4?86B GD.F A=K662=9L8B !/ A=9?92=94FB GD.F A=5@42=54KB
24
Muñoz et al 2015
## # # # - # # '4 - A.$ 9B$ + # # '4 - - " GD.F A=446K2= 46L5B Q A=L8F2=LF9B !.? A=9KL2=99KB # " # -
# '4 - A.$ 9B$ ( # # # # # ' - + " - # # # " # # '4 - # GD.F =?KK2=?95 # # # # GD.F =?@92=??F # GD.4 =4852=4F? # # # # GD.4 =4?F2=46K # !/ =4@52=4?@ # # # # !/ =L92=K4 # GD.4 =4462=LF # # # # GD.4 =5L2=8@ A.$ 9B$ '# - 3- # 7 # " GD.F - =4@2=4 # # '4 - # " # '4 - $
7 + # # '4
- # # # # - # - '4 - # 8Z @Z # # + 7 # " - # =3- - # # '4 - + # # '4 - - = # - # # -=- A.$ 9B$ ( 44 7 # " - - + 7 - # - /#4 " =4?562=
4?86 GD.F " =K662=9L8 - # '4 - A'B$ '# /#4 # GD.F ## + # '4
25
Muñoz et al 2015
# 8Z= # - # - # = 4F952=966 # # " + " # # '4 - $ # " + # /#4 " A=4?562=4?86B # GD.F " A= K662=9L8B - # '4 - " # " # - # # '4 - A.$ 9B$
+ - /#4 # +
- 3 # # 3 =4 # D,ABG 7
3 4 I5F=96J> # + # # # /#4
# - # # # # '4 $ * +
# /#4 =4?562=4?86 - # - # /#4 =4?562=4?86 " # /#4 =@F52= @@5 # # - + # '4 - $ * # # " /#4 4?562=4?86 # - " 7 - + '4 - $ * # # +3- /#4 -- # - + # '4 - # + " /#4$ 3- /#4 +3- # - + # # '4 - # C " /#4$ * /#4 +3- # # 3- # # '4 - # # /#4 =4?562=4?86 + " $ (+ # # /#4 =4?562=4?86 # '4 - - = # '4 #
26
Muñoz et al 2015
" # - # '4 - # /#4 =@F52=@@5 # '4 - A " # # - B - $
GD.F - +
" + + # 3 " " - I94=95J$ + # GD.F # 3- + '4 # " - # GD.F " + '4 - I99J$ 7 + - # + 7 GD.F " # '4 - A.$ 9B$ ( GD.F " - =K662= 9L8 - # '4 ' # # = + " # # '4 - " # - # # '4 - A.$ 9B$ * + # =K662=9L8 GD.F " - # # =K662=9L8 GD.F " 7 - + '4 - $ * # # =3- GD.F + # - +
# '4 - # "+ # '4 - + =K662=9L8 GD.F " # # # '4 - # C " GD.F # A.$ 9B$ . GD.F - # '4 - - =5@42=54K =F?F2=F6K =?KK2=?95 =4LL2=4LF # ' -- " - " # C + A.$ 9B$ * - # " GD.F # # '4 - A.$ 9B$ ( # " =?@92=
27
Muñoz et al 2015
??F # # '4 - -- " - # # - GD.F =?KK2=?95 # '4 - A.$ 9B$
- # " GD.F - =4@2=4 # # '4 - + + - - " GD.F # # # '4 - A.$ 9B$ (+ # # GD.F =K662=9L8 - = # '4 - # " # - # '4 - > + # GD.F =4@2=4 - = # # '4 - # " # - '4 - $
GD.4 - + + # "
+ - C + + # 3 " " - I9? 9F 9KJ$ GD.4 + + 3- - -+ + - - # '4 I54 5?J$ ' GD.4 " - " # # # '4 - -- " - '4 - A.$ 9B$ * " # GD.4 " # '4 - - =4852=4F? =4462=LF -- " - " + " # - + # '4 - A.$ 9B$ ( # # # # - GD.4 " # # '4 - - =4?F2=46K =5L2=8@ " 7 # - + # '4 " GD.4$ (+ # -- # - # # GD.4 =4?F2=46K =5L2=8@ - =
28
Muñoz et al 2015
# # '4 - # # - + # # '4 - - A.$ 9B$
'# - + "
'4 '? 3- # #- - # - " # /( ## - #" # # I?6J$ '# + # # - - # 46=
'4 '? %D + #- # # - %D + # #- $
+ # - # ' - " H1' 3- + # #- I?6J$ '# - 3 # # # # '4 - - = # # -=- # " - # '4 $ ( -- # # - # # " = # - - # # '4 - # -=- - # '4 $ # = - /#4 GD.F " # - + # '4 - " " # - # '4 - GD.4 " # - + # # '4 - " - # '4 - GD.F " # - + # # '4 - " " # '4 - $ '# - # - + + # -=- 3- '4 -#- - #
29
Muñoz et al 2015
### # -3 + + - + # - # + -- $
E # # - - - # # -=-
'4 3- # # - A " B # " $ # 466R 7 + # - 3 - # - # 2#- # 2 # 2 - " # " # # # # # - 2 # ## + 7 3 + $ # 7 + = # - # 2 # 2 $ G + # - # 2 - + # # ## + = # # + # 8Z=# # - 3 - ## # "+ # # - # 2 $ ( # # # # + "+ # - # - 2 -$ '# #+ - # '4 3- - - # C # C # - # " " # -- + # # = # - - # - 3 '4 - $ .
30
Muñoz et al 2015
+ = # '4 - # = # - -$ AB - # # '4 - # # # - - # # #+ # - # " $ . # - 4866 "- # 8\= 7 - # - " + = # - % + ?$6$ '# - # # # 86R $ . # - # 2#- # 2 # 2 " 466R 7 "+ # 4866 "- - $ . # - # 2 - " 98R "+ # # @Z=# # - $ A/B - # # '4 - # # - # # " $ . # - # 2 # # # 86R 7 "+ + " @6R # - # # @Z= # - # - $ . # - # 2 # 86R 7 - # - $ A,B + = # '4 - - # # - # - - $ 7 + 7 # " - # + " -$ 3- # 3 + + = # # - 2# 2 - # + + + $ + = # 3 $
31
Muñoz et al 2015
, # 8\= C # '4 - $. - " # -@ - # ## # AH1B # # # '4 8\ $ # # # #C "C - # = - + - " # " 3$ " 866 # GF**! G-? + FK # $ !# + # ] , + + A. 2%B # - 3- # - - $ % + + - # + + - # # + # A # '4 - # -#B$ " = D( - # ' C A) ! M6$68> )) ! M6$64B$ # '4 - $'# '4 - " = 44 - + + # /#4 A=4?5624?86> @ B GD.F A=K662=9L8 =5@42=54K =F?F2=F6K =?KK2=?95 =4LL2=4LF> #B GD.4 A= 4462=LF> B !/ A=9?92=94F =4@52=4?@> #B $ '# - # -@ -$ '# 7 # - + " # " 3 # # # + 7 "C #
32
Muñoz et al 2015
7 # # $ GF**! G-? A866 B # # '4 - + FK # $ '# + - # ] , + + A. 2%B # - 3- # - - $ % + + - # + R + - # # + # A = - '4 - B$ " = D( - # ' C A) ! M6$64B$ . " # /#4 =4?562=4?86 GD.F =K662=9L8 # '4 - $ GF**! G-? - A866 B # # '4 - ; - + # /#4 =4?562=4?86 - + # GD.F =K662=9L8 - + " # # /#4 =4?562=4?86 # GD.F = K662=9L8 $ H + FK # $ '# + - # ] , + + A. 2%B # - 3- # - - $ % + + - # + R + - # # + A = - '4 - B$ " = D( - # ' C A) ! M6$64B$
33
Muñoz et al 2015
- - # - + # '4 - " /#4
+3- $!3 3- /#4 GF**! G-? $ A=B GF**! = # A?66 B 3- + AB # = - '4 - A/B # '4 - # + # /#4 = 4?562=4?86 AB # # = - # '4 - A / B # # /#4 3- + A?66 B$ A,=.B G-? = # A?66 B 3- + A,B # # = - '4 - A!B # '4 - # + # /#4 =4?562=4?86 A.B # # = - # '4 - A, ! .B # # /#4 3- + A?66 B$ . " # - # + + + A. 2%B$ '# + - # ] , + + A. 2%B # - 3- # - - $ ""+ ; - '4= 3- + # = - '4 - > - '4=H /#4 3- + # '4 - # + # /#4 =4?562=4?86 > -GD.F 3- + GD.F> -@ " - = H + > - " + # - $ - + # - # '4 - " GD.F$!3 3- GD.F GF**! G-? $ AB GF**! = # A?66 B 3- + # # = - '4 -
34
Muñoz et al 2015
- # + # GD.F =K662=9L8 # A?66 B # GD.F 3- + $ A/B G-? = # A?66 B 3- + # # = - - # A?66 B # GD.F 3- + $ H + + + A. 2%B$ '# + - # ] , + + A. 2%B # - 3- # - - $ ""+ ; - '4= H GD.F4 3- + # '4 - # + # GD.F =K662=9L8 $ # - = # # '4 - + + -=- $A=/B# # # - = # # - 3 4F95 C" # AB # A/B '4 - " + A% + ?$6B$ AB# - # = + + # - " + # '4 - $ '# = # " - -- " - - - ; B # /#4 " =4?562=4?86 ## - - # '4 - # " # - # # '4 - > B # GD.F =K662=9L8 - + # - +
# '4 - " # - # # '4 - > B GD.4 # '4 - A=4852=4F? =4462=LFB
35
Muñoz et al 2015
- # GD.4 # - # # '4 - A=4?F2=46K =5L2=8@B - +> +B # GD.F # # '4 - A=4@2=4B - # " # - # '4 - $ '# " 3 - # = # # - # - $
Acknowledgments
We thank the Antioxidant Lab members for helpful discussions and the support of the ,- . - . / 0 1+ -0 #$ '# C - -- " 44F6F?L 44@6@K5 44@6KF? 44?65L5 # Comisión Nacional de Investigación Científica y Tecnológica (CONICYT), Chile. Students were supported by studentships from the Universidad de Concepción and doctoral fellowships from CONICYT. % [1]
a) Linster, C. L.; Van Schaftingen, E. Vitamin C. Biosynthesis, recycling and degradation
in mammals. FEBS J 274:1-22; 2007.
36
[2]
Muñoz et al 2015
Ohta, Y.; Nishikimi, M. Random nucleotide substitutions in primate nonfunctional gene
for L-gulono-gamma-lactone oxidase, the missing enzyme in L-ascorbic acid biosynthesis. Biochim Biophys Acta 1472:408-411; 1999. [3]
Drouin, G.; Godin, J. R.; Page, B. The genetics of vitamin C loss in vertebrates. Curr
Genomics 12:371-378; 2011. [4]
Yang, H. Conserved or lost: molecular evolution of the key gene GULO in vertebrate
vitamin C biosynthesis. Biochem Genet 51:413-425; 2013. [5]
Faaland, C. A.; Race, J. E.; Ricken, G.; Warner, F. J.; Williams, W. J.; Holtzman, E. J.
Molecular characterization of two novel transporters from human and mouse kidney and from LLC-PK1 cells reveals a novel conserved family that is homologous to bacterial and Aspergillus nucleobase transporters. Biochim Biophys Acta 1442:353-360; 1998. [6]
Tsukaguchi, H.; Tokui, T.; Mackenzie, B.; Berger, U. V.; Chen, X. Z.; Wang, Y.;
Brubaker, R. F.; Hediger, M. A. A family of mammalian Na+-dependent L-ascorbic acid transporters. Nature 399:70-75; 1999. [7]
Rivas, C. I.; Zuniga, F. A.; Salas-Burgos, A.; Mardones, L.; Ormazabal, V.; Vera, J. C.
Vitamin C transporters. J Physiol Biochem 64:357-375; 2008. [8]
Burzle, M.; Suzuki, Y.; Ackermann, D.; Miyazaki, H.; Maeda, N.; Clemencon, B.;
Burrier, R.; Hediger, M. A. The sodium-dependent ascorbic acid transporter family SLC23. Mol Aspects Med 34:436-454; 2013. [9]
Sotiriou, S.; Gispert, S.; Cheng, J.; Wang, Y.; Chen, A.; Hoogstraten-Miller, S.; Miller,
G. F.; Kwon, O.; Levine, M.; Guttentag, S. H.; Nussbaum, R. L. Ascorbic-acid transporter Slc23a1 is essential for vitamin C transport into the brain and for perinatal survival. Nat Med 8:514-517; 2002.
37
[10]
Muñoz et al 2015
Corpe, C. P.; Tu, H.; Eck, P.; Wang, J.; Faulhaber-Walter, R.; Schnermann, J.; Margolis,
S.; Padayatty, S.; Sun, H.; Wang, Y.; Nussbaum, R. L.; Espey, M. G.; Levine, M. Vitamin C transporter Slc23a1 links renal reabsorption, vitamin C tissue accumulation, and perinatal survival in mice. J Clin Invest 120:1069-1083; 2010. [11]
Maulen, N. P.; Henriquez, E. A.; Kempe, S.; Carcamo, J. G.; Schmid-Kotsas, A.;
Bachem, M.; Grunert, A.; Bustamante, M. E.; Nualart, F.; Vera, J. C. Up-regulation and polarized expression of the sodium-ascorbic acid transporter SVCT1 in post-confluent differentiated CaCo-2 cells. J Biol Chem 278:9035-9041; 2003. [12]
Boyer, J. C.; Campbell, C. E.; Sigurdson, W. J.; Kuo, S. M. Polarized localization of
vitamin C transporters, SVCT1 and SVCT2, in epithelial cells. Biochem Biophys Res Commun 334:150-156; 2005. [13]
Michels, A. J.; Joisher, N.; Hagen, T. M. Age-related decline of sodium-dependent
ascorbic acid transport in isolated rat hepatocytes. Arch Biochem Biophys 410:112-120; 2003. [14]
Wu, X.; Itoh, N.; Taniguchi, T.; Hirano, J.; Nakanishi, T.; Tanaka, K. Stimulation of
differentiation in sodium-dependent vitamin C transporter 2 overexpressing MC3T3-E1 osteoblasts. Biochem Biophys Res Commun 317:1159-1164; 2004. [15]
Qiao, H.; May, J. M. Macrophage differentiation increases expression of the ascorbate
transporter (SVCT2). Free Radic Biol Med 46:1221-1232; 2009. [16]
Fujita, I.; Hirano, J.; Itoh, N.; Nakanishi, T.; Tanaka, K. Dexamethasone induces sodium-
dependant vitamin C transporter in a mouse osteoblastic cell line MC3T3-E1. Br J Nutr 86:145149; 2001.
38
[17]
Muñoz et al 2015
Wu, X.; Itoh, N.; Taniguchi, T.; Nakanishi, T.; Tatsu, Y.; Yumoto, N.; Tanaka, K. Zinc-
induced sodium-dependent vitamin C transporter 2 expression: potent roles in osteoblast differentiation. Arch Biochem Biophys 420:114-120; 2003. [18]
Savini, I.; Rossi, A.; Catani, M. V.; Ceci, R.; Avigliano, L. Redox regulation of vitamin C
transporter SVCT2 in C2C12 myotubes. Biochem Biophys Res Commun 361:385-390; 2007. [19]
Amano, A.; Aigaki, T.; Maruyama, N.; Ishigami, A. Ascorbic acid depletion enhances
expression of the sodium-dependent vitamin C transporters, SVCT1 and SVCT2, and uptake of ascorbic acid in livers of SMP30/GNL knockout mice. Arch Biochem Biophys 496:38-44; 2010. [20]
Mardones, L.; Zuniga, F. A.; Villagran, M.; Sotomayor, K.; Mendoza, P.; Escobar, D.;
Gonzalez, M.; Ormazabal, V.; Maldonado, M.; Onate, G.; Angulo, C.; Concha, II; Reyes, A. M.; Carcamo, J. G.; Barra, V.; Vera, J. C.; Rivas, C. I. Essential role of intracellular glutathione in controlling ascorbic acid transporter expression and function in rat hepatocytes and hepatoma cells. Free Radic Biol Med 52:1874-1887; 2012. [21]
Michels, A. J.; Frei, B. Myths, artifacts, and fatal flaws: identifying limitations and
opportunities in vitamin C research. Nutrients 5:5161-5192; 2013. [22]
Yu, R.; Schellhorn, H. E. Recent applications of engineered animal antioxidant
deficiency models in human nutrition and chronic disease. J Nutr 143:1-11; 2013. [23]
Iwama, M.; Shimokado, K.; Maruyama, N.; Ishigami, A. Time course of vitamin C
distribution and absorption after oral administration in SMP30/GNL knockout mice. Nutrition 27:471-478; 2011. [24]
Mohan, S.; Kapoor, A.; Singgih, A.; Zhang, Z.; Taylor, T.; Yu, H.; Chadwick, R. B.;
Chung, Y. S.; Donahue, L. R.; Rosen, C.; Crawford, G. C.; Wergedal, J.; Baylink, D. J.
39
Muñoz et al 2015
Spontaneous fractures in the mouse mutant sfx are caused by deletion of the gulonolactone oxidase gene, causing vitamin C deficiency. J Bone Miner Res 20:1597-1610; 2005. [25]
Maeda, N.; Hagihara, H.; Nakata, Y.; Hiller, S.; Wilder, J.; Reddick, R. Aortic wall
damage in mice unable to synthesize ascorbic acid. Proc Natl Acad Sci U S A 97:841-846; 2000. [26]
Kondo, Y.; Masutomi, H.; Noda, Y.; Ozawa, Y.; Takahashi, K.; Handa, S.; Maruyama,
N.; Shimizu, T.; Ishigami, A. Senescence marker protein-30/superoxide dismutase 1 double knockout mice exhibit increased oxidative stress and hepatic steatosis. FEBS Open Bio 4:522532; 2014. [27]
Horio, F.; Hayashi, K.; Mishima, T.; Takemori, K.; Oshima, I.; Makino, S.; Kakinuma,
A.; Ito, H. A newly established strain of spontaneously hypertensive rat with a defect of ascorbic acid biosynthesis. Life Sci 69:1879-1890; 2001. [28]
Horio, F.; Ozaki, K.; Yoshida, A.; Makino, S.; Hayashi, Y. Requirement for ascorbic acid
in a rat mutant unable to synthesize ascorbic acid. J Nutr 115:1630-1640; 1985. [29]
Frei, B.; Birlouez-Aragon, I.; Lykkesfeldt, J. Authors' perspective: What is the optimum
intake of vitamin C in humans? Crit Rev Food Sci Nutr 52:815-829; 2012. [30]
Cahill, L.; Corey, P. N.; El-Sohemy, A. Vitamin C deficiency in a population of young
Canadian adults. Am J Epidemiol 170:464-471; 2009. [31]
Carr, A. C.; Bozonet, S. M.; Pullar, J. M.; Simcock, J. W.; Vissers, M. C. A randomized
steady-state bioavailability study of synthetic versus natural (kiwifruit-derived) vitamin C. Nutrients 5:3684-3695; 2013. [32]
Mosdol, A.; Erens, B.; Brunner, E. J. Estimated prevalence and predictors of vitamin C
deficiency within UK's low-income population. J Public Health (Oxf) 30:456-460; 2008.
40
[33]
Muñoz et al 2015
Ravindran, R. D.; Vashist, P.; Gupta, S. K.; Young, I. S.; Maraini, G.; Camparini, M.;
Jayanthi, R.; John, N.; Fitzpatrick, K. E.; Chakravarthy, U.; Ravilla, T. D.; Fletcher, A. E. Prevalence and risk factors for vitamin C deficiency in north and south India: a two centre population based study in people aged 60 years and over. PLoS One 6:e28588; 2011. [34]
Schleicher, R. L.; Carroll, M. D.; Ford, E. S.; Lacher, D. A. Serum vitamin C and the
prevalence of vitamin C deficiency in the United States: 2003-2004 National Health and Nutrition Examination Survey (NHANES). Am J Clin Nutr 90:1252-1263; 2009. [35]
European Food Safety Authority. Scientific Opinion on the substantiation of health
claims related to vitamin C and protection of DNA, proteins and lipids from oxidative damage (ID 129, 138, 143, 148) pursuant to Article 13(1) of Regulation (EC) No 1924/2006. EPSA J 7:1226; 2009. [36]
Levine, M.; Conry-Cantilena, C.; Wang, Y.; Welch, R. W.; Washko, P. W.; Dhariwal, K.
R.; Park, J. B.; Lazarev, A.; Graumlich, J. F.; King, J.; Cantilena, L. R. Vitamin C pharmacokinetics in healthy volunteers: evidence for a recommended dietary allowance. Proc Natl Acad Sci U S A 93:3704-3709; 1996. [37]
Levine, M.; Wang, Y.; Padayatty, S. J.; Morrow, J. A new recommended dietary
allowance of vitamin C for healthy young women. Proc Natl Acad Sci U S A 98:9842-9846; 2001. [38]
National Institute of Health. Vitamin C Fact Sheet for Health Professionals. NIH Office of
Dietary Supplements; 2013. [39]
Conseil Supérior de la Santé. Recommandations nutritionnelles pour la Belgique.
Révision. CSS No 8309:1-91; 2009.
41
[40]
Muñoz et al 2015
Corpe, C. P.; Eck, P.; Wang, J.; Al-Hasani, H.; Levine, M. Intestinal dehydroascorbic
acid (DHA) transport mediated by the facilitative sugar transporters, GLUT2 and GLUT8. J Biol Chem 288:9092-9101; 2013. [41]
Lee, Y. C.; Huang, H. Y.; Chang, C. J.; Cheng, C. H.; Chen, Y. T. Mitochondrial
GLUT10 facilitates dehydroascorbic acid import and protects cells against oxidative stress: mechanistic insight into arterial tortuosity syndrome. Hum Mol Genet 19:3721-3733; 2010. [42]
Mardones, L.; Ormazabal, V.; Romo, X.; Jana, C.; Binder, P.; Pena, E.; Vergara, M.;
Zuniga, F. A. The glucose transporter-2 (GLUT2) is a low affinity dehydroascorbic acid transporter. Biochem Biophys Res Commun 410:7-12; 2011. [43]
Rumsey, S. C.; Daruwala, R.; Al-Hasani, H.; Zarnowski, M. J.; Simpson, I. A.; Levine,
M. Dehydroascorbic acid transport by GLUT4 in Xenopus oocytes and isolated rat adipocytes. J Biol Chem 275:28246-28253; 2000. [44]
Rumsey, S. C.; Kwon, O.; Xu, G. W.; Burant, C. F.; Simpson, I.; Levine, M. Glucose
transporter isoforms GLUT1 and GLUT3 transport dehydroascorbic acid. J Biol Chem 272:18982-18989; 1997. [45]
Vera, J. C.; Rivas, C. I.; Fischbarg, J.; Golde, D. W. Mammalian facilitative hexose
transporters mediate the transport of dehydroascorbic acid. Nature 364:79-82; 1993. [46]
Linster, C. L.; Van Schaftingen, E. Vitamin C. Biosynthesis, recycling and degradation in
mammals. FEBS J 274:1-22; 2007. [47]
Montecinos, V.; Guzman, P.; Barra, V.; Villagran, M.; Munoz-Montesino, C.;
Sotomayor, K.; Escobar, E.; Godoy, A.; Mardones, L.; Sotomayor, P.; Guzman, C.; Vasquez, O.; Gallardo, V.; van Zundert, B.; Bono, M. R.; Onate, S. A.; Bustamante, M.; Carcamo, J. G.; Rivas, C. I.; Vera, J. C. Vitamin C is an essential antioxidant that enhances survival of
42
Muñoz et al 2015
oxidatively stressed human vascular endothelial cells in the presence of a vast molar excess of glutathione. J Biol Chem 282:15506-15515; 2007. [48]
Nualart, F. J.; Rivas, C. I.; Montecinos, V. P.; Godoy, A. S.; Guaiquil, V. H.; Golde, D.
W.; Vera, J. C. Recycling of vitamin C by a bystander effect. J Biol Chem 278:10128-10133; 2003. [49]
Vera, J. C.; Rivas, C. I.; Velasquez, F. V.; Zhang, R. H.; Concha, II; Golde, D. W.
Resolution of the facilitated transport of dehydroascorbic acid from its intracellular accumulation as ascorbic acid. J Biol Chem 270:23706-23712; 1995. [50]
Vera, J. C.; Rivas, C. I.; Zhang, R. H.; Farber, C. M.; Golde, D. W. Human HL-60
myeloid leukemia cells transport dehydroascorbic acid via the glucose transporters and accumulate reduced ascorbic acid. Blood 84:1628-1634; 1994. [51]
Mizushima, Y.; Harauchi, T.; Yoshizaki, T.; Makino, S. A rat mutant unable to
synthesize vitamin C. Experientia 40:359-361; 1984. [52]
Vissers, M. C.; Bozonet, S. M.; Pearson, J. F.; Braithwaite, L. J. Dietary ascorbate intake
affects steady state tissue concentrations in vitamin C-deficient mice: tissue deficiency after suboptimal intake and superior bioavailability from a food source (kiwifruit). Am J Clin Nutr 93:292-301; 2011. [53]
Rucker, R. B. Allometric scaling, metabolic body size and interspecies comparisons of
basal nutritional requirements. J Anim Physiol Anim Nutr (Berl) 91:148-156; 2007. [54]
Chatterjee, I. B.; McKee, R. W. Biosynthesis of L-Ascorbic Acid in Liver Microsomes
from Mice Bearing Transplanted Tumors. Proc Soc Exp Biol Med 117:304-306; 1964.
43
[55]
Muñoz et al 2015
Upston, J. M.; Karjalainen, A.; Bygrave, F. L.; Stocker, R. Efflux of hepatic ascorbate: a
potential contributor to the maintenance of plasma vitamin C. Biochem J 342 ( Pt 1):49-56; 1999. [56]
Kaufmann, J.; Smale, S. T. Direct recognition of initiator elements by a component of the
transcription factor IID complex. Genes Dev 8:821-829; 1994. [57]
Javahery, R.; Khachi, A.; Lo, K.; Zenzie-Gregory, B.; Smale, S. T. DNA sequence
requirements for transcriptional initiator activity in mammalian cells. Mol Cell Biol 14:116-127; 1994. [58]
Lo, K.; Smale, S. T. Generality of a functional initiator consensus sequence. Gene
182:13-22; 1996. [59]
Loots, G. G.; Ovcharenko, I. rVISTA 2.0: evolutionary analysis of transcription factor
binding sites. Nucleic Acids Res 32:W217-W221; 2004. [60]
Wasserman, W. W.; Fahl, W. E. Functional antioxidant responsive elements. Proc Natl
Acad Sci U S A 94:5361-5366; 1997. [61]
Michels, A. J.; Hagen, T. M. Hepatocyte nuclear factor 1 is essential for transcription of
sodium-dependent vitamin C transporter protein 1. Am J Physiol Cell Physiol 297:C1220-C1227; 2009. [62]
Reidling, J. C.; Rubin, S. A. Promoter analysis of the human ascorbic acid transporters
SVCT1 and 2: mechanisms of adaptive regulation in liver epithelial cells. J Nutr Biochem 22:344-350; 2011. [63]
Savini, I.; Rossi, A.; Pierro, C.; Avigliano, L.; Catani, M. V. SVCT1 and SVCT2: key
proteins for vitamin C uptake. Amino Acids 34:347-355; 2008.
44
[64]
Muñoz et al 2015
Kitamuro, T.; Takahashi, K.; Ogawa, K.; Udono-Fujimori, R.; Takeda, K.; Furuyama, K.;
Nakayama, M.; Sun, J.; Fujita, H.; Hida, W.; Hattori, T.; Shirato, K.; Igarashi, K.; Shibahara, S. Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1 gene in human cells. J Biol Chem 278:9125-9133; 2003. [65]
Shan, Y.; Lambrecht, R. W.; Donohue, S. E.; Bonkovsky, H. L. Role of Bach1 and Nrf2
in up-regulation of the heme oxygenase-1 gene by cobalt protoporphyrin. FASEB J 20:26512653; 2006. [66]
Dhakshinamoorthy, S.; Jain, A. K.; Bloom, D. A.; Jaiswal, A. K. Bach1 competes with
Nrf2 leading to negative regulation of the antioxidant response element (ARE)-mediated NAD(P)H:quinone oxidoreductase 1 gene expression and induction in response to antioxidants. J Biol Chem 280:16891-16900; 2005. [67]
Hou, W.; Shan, Y.; Zheng, J.; Lambrecht, R. W.; Donohue, S. E.; Bonkovsky, H. L. Zinc
mesoporphyrin induces rapid and marked degradation of the transcription factor Bach1 and upregulates HO-1. Biochim Biophys Acta 1779:195-203; 2008. [68]
Kaspar, J. W.; Jaiswal, A. K. Antioxidant-induced phosphorylation of tyrosine 486 leads
to rapid nuclear export of Bach1 that allows Nrf2 to bind to the antioxidant response element and activate defensive gene expression. J Biol Chem 285:153-162; 2010. [69]
Raval, C. M.; Zhong, J. L.; Mitchell, S. A.; Tyrrell, R. M. The role of Bach1 in ultraviolet
A-mediated human heme oxygenase 1 regulation in human skin fibroblasts. Free Radic Biol Med 52:227-236; 2012. [70]
Oyake, T.; Itoh, K.; Motohashi, H.; Hayashi, N.; Hoshino, H.; Nishizawa, M.;
Yamamoto, M.; Igarashi, K. Bach proteins belong to a novel family of BTB-basic leucine zipper
45
Muñoz et al 2015
transcription factors that interact with MafK and regulate transcription through the NF-E2 site. Mol Cell Biol 16:6083-6095; 1996. [71]
Odom, D. T.; Dowell, R. D.; Jacobsen, E. S.; Gordon, W.; Danford, T. W.; MacIsaac, K.
D.; Rolfe, P. A.; Conboy, C. M.; Gifford, D. K.; Fraenkel, E. Tissue-specific transcriptional regulation has diverged significantly between human and mouse. Nat Genet 39:730-732; 2007. [72]
Odom, D. T.; Zizlsperger, N.; Gordon, D. B.; Bell, G. W.; Rinaldi, N. J.; Murray, H. L.;
Volkert, T. L.; Schreiber, J.; Rolfe, P. A.; Gifford, D. K.; Fraenkel, E.; Bell, G. I.; Young, R. A. Control of pancreas and liver gene expression by HNF transcription factors. Science 303:13781381; 2004. [73]
Gonzalez, F. J. Regulation of hepatocyte nuclear factor 4 alpha-mediated transcription.
Drug Metab Pharmacokinet 23:2-7; 2008. [74]
Kyrmizi, I.; Hatzis, P.; Katrakili, N.; Tronche, F.; Gonzalez, F. J.; Talianidis, I. Plasticity
and expanding complexity of the hepatic transcription factor network during liver development. Genes Dev 20:2293-2305; 2006. [75]
Hayhurst, G. P.; Lee, Y. H.; Lambert, G.; Ward, J. M.; Gonzalez, F. J. Hepatocyte
nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 21:1393-1403; 2001. [76]
Li, J.; Ning, G.; Duncan, S. A. Mammalian hepatocyte differentiation requires the
transcription factor HNF-4alpha. Genes Dev 14:464-474; 2000. [77]
Lu, H.; Gonzalez, F. J.; Klaassen, C. Alterations in hepatic mRNA expression of phase II
enzymes and xenobiotic transporters after targeted disruption of hepatocyte nuclear factor 4 alpha. Toxicol Sci 118:380-390; 2010.
46
[78]
Tronche, F.; Yaniv, M. HNF1, a homeoprotein member of the hepatic transcription
regulatory network. Bioessays 14:579-587; 1992.
Muñoz et al 2015
47
Muñoz et al 2015
'" 4$ 7 - # '4 - - - ==================================================================================================================== ,D
8Z @Z - 7
==================================================================================================================== '4 -
A.B; TCCCCCCGGGCATGAGCTACCAAGATAGGGTCT
A4F95 "-B
A%B; CCGCTCGAGCACGGGTTTGAGAAATCTCTGAGG
/#4
A.B; TTCTCTTCCAGCACATGGGGAGCGGGAGAAGATGAACCCAG
A=4?8LB
A%B; CTGGGTTCATCTTCTCCCGCTCCCCATGTGCTGGAAGAGAA
/G4
A.B; GAGTCAGTTCTCTTCCAGCACACGGGAGAAGATG
A=4?8LB
A%B; CATCTTCTCCCGTGTGCTGGAAGAGAACTGACTC
GD.F
A.B; GGCCAGGCTGGGTTCACTGGGATCTGC
A=K66B
A%B; GCAGATCCCAGTGAACCCAGCCTGGCC
GD.F
A.B; CACAGCACAAGGGGCCTGTGTGCATGCC
A=5@4B
A%B; GGCATCCACACAGGCCCCTTGTGCTGTG
GD.F
A.B; ATATACAAATACAGGTAATGGTCCTGTCCTCAAAGAACAGTG
A=F?FB
A%B; CACTGTTCTTTGAGGACAGGACCATTACCTGTATTTGTATAT
GD.F
A.B; CCTCTTCACCCTGTAGCTTCCCTAGGGAAGCA
A=?KKB
A%B; TGCTTCCCTAGGGAAGCTACAGGGTGAAGAGG
48
GD.F
A.B; AGCAGGTGGGCGTCGCTTGGGTGG
A=4LLB
A%B; CCACCCAAGCGACGCCCACCTGCT
Muñoz et al 2015
GD.4
A.B; TCTGGAGCTATGGACCTGATTGACTTTGAACAATGTC
A=446B
A%B; GACATTGTTCAAAGTCAATCAGGTCCATAGCTCCAGA
2!/β A.B; CTACACACAACAACATTCTTAATATTTTTAAAGAGGGCCCCTTCT A=9?9B
A%B; AGAAGGGGCCCTCTTTAAAAATATTAAGAATGTTGTTGTGTGTAG
2!/β A.B; GCCCCGTCCCCTTTCTGGAGCTATGG A=4@5B
A%B; CCATAGCTCCAGAAAGGGGACGGGGC
/#4
A.B; TCTCTGCCGCGGGCCACCATGTCTGTGAGTGAGAGTGCAGTGTT
A #B
A%B; CAGAGAAAGCTTTTACTCATCAGTAGTACACTTGTCAGACATCTG
GD.Fα
A.B; TCTCTGCCGCGGGCCACCATGCGACTCTCTAAAACCCTCGCCGA
A #B
A%B; CAGAGAAAGCTTCTAGATGGCTTCCTGCTTGGTGATCGTTGGCT
GD.4α
A.B;TCTCTGAAGCTTGCCACCATGGTTTCTAAACTGAGCCAGCTGCAGACG
A #B
A%B; TCTCTGGGTACCTTACTGGGAGGAAGAGGCCATCTGGGTGGA
49
Muñoz et al 2015
•
Rats synthesize their own ascorbic acid in the liver.
•
SVCT1 is fundamental for humans to obtain ascorbic acid (vitamin C) from the diet.
•
Specific cis-regulatory elements are involved in species-specific transcriptional regulation of the rat and human SVCT1 gene.
•
SVCT1 transcription is differentially regulated in cells from species that differ in their capacity to synthesize ascorbic acid.
Figure1
Figure2
Figure3
Figure4
Figure5
Figure6
Figure7
Graphical Abstract (for review)
