DEVELOPMENTAL GENETICS 11:97-109 (1990)

Cis-Acting Sequences and Trans-Acting Factors Required for Constitutive Expression of a Microinjected HSP70 Gene After the Midblastula Transition of Xenopus Zaeuis Embryogenesis NICK OVSENEK, GREGG T. WILLIAMS, RICHARD I. MORIMOTO, AND JOHN J . HEIKKILA Department of Biology, University of Waterloo, Waterloo, Ontario, Canada (N.O., J.J.H.); Department of Biochemistry, Molecular Biology and Cell Biology, Northwestern University, Evanston, Illinois (G.T.W., R.I.M.)

ABSTRACT Microinjected human HSP70 promoter-chloramphenicol acetyl transferase (CAT) chimeric genes are constitutively expressed immediately after the midblastula transition of Xenopus embryogenesis. Analysis of a series of 5’-deletion mutants in the HSP70 promoter revealed that sequences within 74 bases of the transcriptional start site were sufficient for strong basal activity. We investigated the role of specific sequences in the basal promoter by injecting HSP70CAT vectors containing linker-scanner mutations in the basal elements (CCAAT, purine-rich element, GC-element, ATF/APl, and TATA). Our data reveal that deletion of any of these cis-acting elements in the basal promoter prevents expression after the midblastula stage of development. Furthermore, we have identified specific binding activities in embryonic nuclear extracts that complex with basal promoter elements (CCAAT, ATF, and GC) of the heterologous HSP70 promoter. These trans-acting factors are detectable in nuclear extracts of early blastula embryos, and their respective binding activity increases dramatically after the midblastula transition. The expression of the human HSP70 gene after the midblastula transition of Xenopus embryogenesis requires an array of cisacting elements, which interact with specific Xenopus transcription factors. Key words: Heat shock promoters, HSP70-CAT, microinjection, linker-scanner mutations

not understood. Newport et al. [1985] have proposed that the lack of transcriptional activity during cleavage stages may be due to the overabundance of cytoplasmic M-phase-promoting factor or mitosis initiation factors, which prevent a G, phase in the cell cycle by rapidly triggering the onset of mitosis after S phase. Alternatively, i t is possible that a common transcription factor that is absent or inactive during early development is required for the regulation of MBT transcription. Heat shock protein (HSP) genes such as HSP70 are among the first zygotic genes to be transcribed a t the MBT [Bienz, 1984a; Heikkila et al., 1985, 19871. We are interested in the mechanisms associated with the developmental regulation of HSP70 transcription. The heat shock genes, in addition to their ubiquitous induction following exposure to environmental stress, are also expressed under a variety of “non-stress” conditions such as cell cycle and development [Craig, 1985; Heikkila et al., 1986; Lindquist, 1986; Bond and Schlesinger, 19873. For example, the major heat shock gene, HSP70, is expressed at the two-cell stage of mouse embryogenesis [Bensaude et al., 19831, during mouse spermatogenesis [Krawczyk et al., 1987; Zakeri and Wolgemuth, 1987; Allen et al., 19881, and during chicken erythropoesis [Banerji et al., 1984,19871. The complexity of transcriptional regulation exhibited by vertebrate heat shock genes is reflected in the multiple arrays of cis-acting elements located in the 5’-flanking regions [Morimoto et al., 1986; Morgan et al., 1987; Greene et al., 1987; Wu et al., 1987; Bienz and Pelham, 19873. This complexity of vertebrate HSP70 promoter elements has also been noted for the chicken [Morimoto

INTRODUCTION The midblastula transition (MBT) of Xenopus embryogenesis is a point in development that coincides with the transcriptional activation of the embryonic genome [Brown and Littna, 1964; Bachvarova and Davidson, 1966; Shiokawa et al., 1981; Newport and Kirschner, 1982a,b]. The mechanism by which Xenopus embryos remain transcriptionally dormant until the MBT and then activate a subset of selected genes is

0 1990 WILEY-LISS, INC.

Received for publication November 3, 1989; accepted December 22, 1989. Address reprint requests to Dr. John J. Heikkila, Department of Biology, University of Waterloo, Waterloo, Ontario, N2L 3G1 Canada.

98

OVSENEK ET AL.

et al., 19861 and mouse [Zakeri et al., 19881 HSP70 genes. Comparisons of the 5’-flanking sequences of different vertebrate HSP70 genes reveals a common picture of multiple cis-acting elements including one or more heat shock elements (HSEs). These promoter elements confer basal, serum, and interleukin 2 (IL-2) inducibility, adenovirus E1A responsiveness, and developmental and tissue-specific expression in addition to the heat shock and stress response [Wu et al., 1986; Ferris et al., 1988; Williams et al., 19891. To date there is little information available on the cis-acting DNA sequences and trans-acting factors that are responsible for the activation of genes at the MBT. An effective approach for the examination of cis-acting sequences involved in the regulation of transcription during Xenopus development is the introduction of reporter gene constructions into developing embryos [Etkin et al., 1986; Etkin, 1988; Krieg and Melton, 1987al. This methodology has been succesfully employed to examine the expression of cardiac actin [Mohun et al., 1986, 1989; Taylor et al., 19891, skeletal muscle actin [Steinbeisser et al., 19881, GS 17 [Krieg and Melton, 1985, 1987a1, and epidermal keratin genes [Jonas et al., 19891. A comparison of the 5‘-flanking sequences between the human [Hunt and Morimoto, 19851 and Xenopus HSP70 [Bienz, 1984bl promoter region reveals considerable similarities in the arrangement of TATA, CCAAT, and HSE elements. Given this finding and the availability of various mutants, we have examined the expression of a human HSP70-CAT fusion gene during Xenopus development. Surprisingly, this chimeric gene is transcribed constitutively after the midblastula stage of embryogenesis in the absence of stress. The human HSP70 promoter is therefore ideal for the analysis of gene expression under control conditions at the MBT. By using a collection of 5’-deletion and linker-scanner mutants, we found that expression of a human HSP70 promoter-CAT fusion gene a t the MBT requires a n array of cis-acting regulatory elements located within 74 bases of the transcriptional start site. It is likely that this compact HSP70 promoter shares common regulatory features associated with the promoters of endogenous genes, which are selectively activated at the MBT. We have also identified trans-acting factors present in nuclear extracts of late blastula stage embryos, which interact with the regulatory elements in the heterologous HSP70 promoter.

MATERIALS AND METHODS Embryo Maintenance and Microinjection Xenopus laevis eggs were obtained, fertilized, dejelled, and maintained in Steinberg’s solution as previously described [Heikkila et al., 19851. Embryos were staged according to Nieuwkoop and Faber 119561. Circular or linearized plasmid DNA (400 pg in 20 nl) was microinjected into embryos within 2 h of fertilization using the apparatus designed by Hitchcock and Fried-

man [1980]. Injected embryos were maintained in Steinberg’s solution with 4% wlv ficoll [Krieg and Melton, 19851. The ficoll content of Steinberg’s solution was gradually decreased to 1%by the blastula stage. Only normally developing embryos were used for CAT activity and RNase protection assays.

DNA Isolation and Southern Hybridization DNA was isolated by homogenizing 10 embryos in 200 pl of buffer containing 1%SDS, 100 mM Tris (pH 7.4), and 1mM EDTA followed by digestion with 50 pg proteinase K a t 37°C and phenollchloroform extraction. Samples were adjusted to 0.3 M sodium acetate and ethanol precipitated. For each sample, 10 pg of DNA was digested with HindIII, electrophoresed on a 1% agarose gel, and transferred to nitrocellulose as described by Maniatis et al. 119821. Blots were hybridized against labeled CAT insert and washed as described by Heikkila et al. [1987]. Autoradiography was performed using Kodak XAR-5 film, and densitometric measurements on appropriately exposed autoradiograms (within the linear range of the film) were performed on a Bio-Rad model 1650 Scanning Densitometer. Construction of 5‘-Deletionand Linker-ScannerMutations The microinjected plasmids (excluding pHB-CAT) contain a CAT gene and neomycin resistance (NEO) gene orientated in opposite directions. The NEO gene is regulated by the proximal 74 bases of the human HSP70 promoter and is a constant on all of the microinjected constructs. Upstream of the CAT gene are unique MstII and NdeI restriction sites. These sites are used to shuttle in all of the mutant promoters. Insertion of 5’-deletions generates the delta 5N series. Insertion of linker-scanners into the proximal 100 bases of the promoter generates the LSPN series. 5’-Deletions and linker-scanner mutations were constructed a s described [Wu et al., 19871. Specific details describing the construction of the delta 5N and LSPN series are described by Williams et al. [1989]. CAT Assays For each analysis, 10 embryos were homogenized in 100 pl of 0.25 M Tris (pH 7.8) and then centrifuged twice for 15 min at 10,000 r.p.m. to remove yolk and cellular debris. The supernatants were stored a t -70°C. Enzyme assays were performed a s described by Gorman et al. [ 19821 using 3 embryo equivalents. Conversion of ‘‘C-chloramphenicol to acetylated forms was monitored by thin-layer chromatography followed by autoradiography using Kodak XAR-5 film. Radioactivity in the acetylated forms of chloramphenicol was measured by scintillation counting.

RNA Isolation and RNase Protection Assays Total lithium chloride-precipitable RNA was isolated from embryos by the method of Auffray and Rou-

HSP70 GENE EXPRESSION DURING EMBRYOGENESIS

99

geon 119801 as modified by Mohun et al. [1984]. RNA shift assays [Fried and Crothers, 1981; Singh et al., samples were treated with 4 U of RQ1 DNase 19861 contained 5 pl of nuclear protein (added last) (Promega) in 40 mM Tris (pH 7.9), 6 mM MgC1, for 1h mixed with 0.1 ng of l3,P1-end-labeled oligonucleotide at 37"C, followed by extraction with phenolichloroform and 5.0 pg of poly(d1)-poly(dC)(Pharmacia) in 10 mM and chloroform and subsequent ethanol precipitation. Tris (pH 7.8), 50 mM NaCl, 1mM EDTA, 0.5 mM DTT, The 588 bp HindIII to EcoRI fragment from pA18 and 5% glycerol in a final volume of 25 pl. For compe[Wu et al., 19861 containing 188bp of HSP-CAT pro- tition experiments, a 50-fold molar excess of oligonumoter sequences and 400 bp of transcribed sequences cleotide was also added. After incubation at 22°C for 20 was cloned into the pGEM2 vector. Digestion of the min, a dye solution (2 pl) containing 0.2% bromophenol resulting plasmid with HindIII and transcription with blue, 0.2% xylene cyanol, and 50% glycerol was added SP6 RNA polymerase results in a n antisense riboprobe to the reactions, which were then loaded directly onto approximately 600 n t long of which 400 n t are pro- 4% polyacrylamide gels in 6.7 mM Tris (pH 7.5), 1 mM tected by correctly initiated HSP-CAT RNA. The 536 EDTA, and 3.3 mM sodium actetate. Gels were run at bp HindIII to PstI fragment, nucleotides 2642 to 3178, 150 V for 3 h, dried, and exposed to Kodak XAR-5 film from pSV,neo [Southern and Berg, 19821 was cloned at - 70°C. into the pGEM2 vector. HindIII digestion of the resulting plasmid and SP6 RNA polymerase transcription RESULTS result in a n approximately 550 n t long antisense riboA Human HSP7O-CAT Fusion Gene Is probe, which protects 216 nt of HSP-NEO RNA. The Constitutively Activated After the Midblastula protection covers the sequences from the BgIII site (nuStage of Xenopus Development cleotide 2962) to the PstI site (nucleotide 3178) from pSV,neo. Labeled transcripts were passed through a The developmental timing of human HSP70-CAT exG-50 Sephadex column. RNase protection assays were pression during Xenopus embryogenesis was examined performed as described by Krieg and Melton [1987b] by microinjection of the chimeric HSP70-CAT gene, using 10 pg of total RNA. RNase-protected transcripts pHB-CAT, containing 2.8 kb of 5'-flanking sequences were detected following electrophoresis on 4% poly- [Wu and Morimoto, 19851, into newly fertilized emacrylamide, 8 M urea gels, and exposure to Kodak bryos and measuring CAT activity and HSP-CAT RNA XAR-5 film at -70°C. levels in embryos at various stages of development. Analysis of cleavage and early blastula embryos Nuclear Extraction Procedure and DNA (stages 6 and 7) revealed only a small amount of backMobility Shift Assay ground CAT activity (0.1% of 14C-chloramphenicol; Nuclear protein extracts were prepared from early Fig. 1A). However, between mid-to-late blastula stages and late blastula and neurula stage embryos using the (stages 8 and 9) a 400-fold increase in CAT activity method described in Mohun et al. [1989] with minor over background levels was observed. In order to demmodifications. Embryos were washed in Steinberg's so- onstrate that the increase in CAT activity correlution and homogenized (Dounce homogenizer, B pes- sponded with increased CAT mRNA levels, we isolated tle) in a buffer containing 2.2 M sucrose, 10 mM Hepes RNA from injected embryos for a n RNase protection (pH 7.61, 15 mM KC1,0.15 mM spermine, 0.5 mM sper- analysis using a 32P-labeledriboprobe transcribed from midine, 1 mM EDTA, 1 mM dithiothreitol, 0.5 mM the CAT gene. As shown in Figure l B , a n antisense PMSF, 28 pgiml aprotinin, and 10% glycerol. After a 1 riboprobe spanning the transcriptional start site of the h centrifugation (SW41 rotor, 27K), nuclei were resus- HSP70-CAT chimeric gene protects a 400 nucleotide pended in a buffer containing 10 mM Hepes (pH 7.6), transcript in RNA from injected Xenopus late blastula 100 mM KC1, 0.1 mM EDTA, 3 mM MgC1, 0.5 mM (stage 9) and gastrula (stage 10) stage embryos. dithiothreitol, 0.1 mM PMSF, 28 pg/ml aprotinin, 10% HSP70-CAT mRNA was not detectable in cleavage and glycerol and lysed by homogenization (Dounce homog- early blastula embryos. Similar results were obtained enizer, A pestle) followed by addition of KC1 to 0.55 M. with embryos transformed with either circular or linThe chromatin was pelleted (SW41 rotor, 31K, 1 h), ear plasmid. Thus, the human HSP70-CAT fusion gene and nuclear proteins in the supernatant were precipi- is expressed shortly after the midblastula stage at a tated by addition of 0.3 g/ml ammonium sulfate and time in embryogenesis that coincides with activation of incubation on ice for 1 h. Proteins were pelleted (SW41 generalized zygotic gene expression. Our finding that rotor, 31 K, 1 h), resuspended in dialysis buffer, dial- this 400 nucleotide transcript co-migrates with a proysed, and frozen at -80°C. The final extract volume tected RNA fragment from a human 293 cell line stably was adjusted to approximately 2 embryo equivalents/ transfected with the pHB-CAT gene [Wu and Moripl. The yield of late blastula stage nuclei was much moto, 19851 suggests that the transcription of human lower than found with neurulae, probably due to their HSP70-CAT fusion gene is properly initiated in Xenolarger size, which makes them more susceptible to pus embryos (Fig. 1C). physical damage during isolation. In numerous experiments, we noticed that gastrula The standard binding reactions for the DNA mobility or neurula stage embryos microinjected with either cir-

100

OVSENEK ET AL. A 0.1

B 0.1

0.1 38.0

58.3 66.9%

c

CM

Stage

6

7

8

9

10

Stage 7

12

8

9

10

Cleav. Early Mid Late Early Late Blastula C 1

Gastrula

D 2

3

4

1

2

3

4

5

6

-7O/CAT

*PHBCAT

Stage 6 Fig. 1. Expression of the human HSP70-CAT fusion gene during Xenopus development. A: CAT assays were performed on extracts from 3 embryo equivalents a t different developmental stages after microinjection of pHB-CAT (400 pg) at the I- to 2-cell stage. Chloramphenicol (CM), and the acetylated forms are indicated. CAT activity values (percent conversion of ''C-chloramphenicol to the acetylated forms) are shown above each lane. B: RNase protection assays were performed on 20 pg of total RNA from early, mid, and late blastula stage embryos (stages 7-9) and gastrula stage embryos (stage 10) that had been microinjected with 400 pg of pHB-CAT. Undigested probe (P), and the 400 nucleotide protected transcript (701 CAT) are indicated. C: RNase protection assays were performed in the absence of RNA (lane 11, with 10 pg tRNA (lane 2), 10 pg of total

7

9

10

18 Uninj.

RNA from pHB-CAT-injected gastrula stage embryos (lane 3), or 10 pg of total RNA from human 293 cells transfected with an HSP70CAT gene (lane 4). Full length (400 base) protected transcripts are indicated (70/CAT). D Fate of microinjected pHB-CAT DNA during development as determined by Southern hybridization analysis performed on 10 pg of HindIII-digested DNA isolated from cleavage (lane l), early (lane 2) and late blastula (lane 3), gastrula (lane 4), and neurula stage (lane 5 ) embryos that had been microinjected with 400 pg of pHB-CAT within 2 h after fertilization, as well as from uninjected gastrula stage embryos (lane 6). A 32P-labeledCAT gene fragment was used as a probe. The 8.0 kb pHB-CAT DNA fragment is indicated by an arrow. Developmental stages according to Nieuwkoop and Faber 119561 are shown.

HSP70 GENE EXPRESSION DURING EMBRYOGENESIS

101

n

T

T

-158

-105

-74

-64

-54

-42

-35

-26

Fig. 2. Human HSP70 5'-deletion mutants. The deletion mutants indicated above were fused to the CAT gene, and the entire series is contained in the plasmid vector LSN, which contains SV40 splice and polyadenylation signals, and the neomycin resistance marker under

control of 74 bases of the human HSP70 promoter as described in Williams et al. [ 19891. Known human HSP70 regulatory elements are shown.

cular DNA or DNA linearized at the 5' end of the HSP70 promoter did not show a n increase in CAT activity following exposure to a variety of heat shock regimes (data not shown). The lack of heat shock responsiveness of the HSP70-CAT genes could be explained either by the high basal expression or by the possibility that manipulation of the embryos during the microinject,ion procedure resulted in physiological st,ress. To examine whether the embryos had been inadvertantly stressed, we measured the level of endogenous HSP70 mRNA in uninjected, mock-injected, or pHB-CAT-injected embryos. In none of these examples was the level of endogenous HSP70 mRNA elevated (data not shown); therefore, the high level of HSP70-CAT expression in gastrula stage embryos reflected the strong basal expression and was not due to induction of the stress response. An important control in the analysis of expression of the microinjected HSP70-CAT vectors was to determine the fate of the injected DNA during early Xenopus embryogenesis. Total DNA was isolated and electrophoretically separated on agarose gels, and the relative levels of HSP70-CAT DNA were measured by Southern hybridization analysis (Fig. 1D) Densitometric scans of the resultant autoradiogram indicated that the level of pHB-CAT DNA increased 2-fold relative to genomic DNA between cleavage and gastrula stages. By neurula stage, levels of pHB-CAT had declined to cleavage stage levels. Therefore, the abrupt increase in HSP70-CAT gene expression after the midblastula stage was due to transcriptional activation rather than a n increase in the copy number of injected plasmid. Analysis of undigested DNA from embryos at different stages of development revealed t h a t the plasmid existed primarily in superhelical form with only a minor fraction associated with high molecular weight genomic DNA.

Determination of the HSP7O Promoter Elements Required for Constitutive Expression After the Midblastula Stage of Development To identify the promoter elements responsible for constitutive expression at the midblastula stage, we microinjected a series of 5' deletion mutants (Fig. 2) into fertilized embryos, which were then allowed to develop to the gastrula stage. Expression was measured by CAT activity and the level of CAT mRNA (Fig. 3A,B). The level of CAT activity detected with the parental pHB-CAT vector that contains 2.8 kb of 5'flanking sequences was nearly identical with a 5'-deletion mutation retaining only 158 bp of upstream sequences (data not shown). These results suggested that the sequences necessary for expression during early embryogenesis were within the region of the HSP70 promoter depicted in Figure 2. Embryos injected with deletion mutants (delta 5N series) whose 5'-boundary extended to -158, -105, or -74 bp displayed a >300-fold increase in CAT activity relative to the background levels of uninjected control embryos. However, if a n additional 10 bp of the promoter was removed to the -64 boundary, the promoter was inactive. Microinjected delta 5N promoter mutants deleted to positions -26, -35, -42, or -54 bp upstream of the transcriptional start site were also inactive. Within the boundary of -74 and -64 is a CCAAT element that has been previously shown to be essential in vivo and in vitro for wild-type basal activity in human cells [Morgan et al., 1987; Greene et al., 1987, Wu et al., 1986, 1987; Williams et al., 19891. The results of promoter deletion mutants as measured by CAT activity were confirmed by direct RNA analysis. The level of HSP-CAT mRNA in embryos microinjected with each of the 5' deletion mutants was examined by RNase protection analysis (Fig. 3B). Correctly initiated HSP70-CAT transcripts were detected

102

OVSENEK ET AL.

A 0.1

-26

0.3

-35

0.2

-42

0.2

-54

0.2

-64

deletion mutants in gastrula stage embryos. By Southern hybridization analysis of total embryo DNA we 77.1 87.3 85.2% could detect the presence of each of the vector DNAs (data not shown). Thus, we have ruled out the possibil1ity that the lack of HSP70-CAT activity in embryos microinjected with the deletion mutants - 26 through 4-64 was a consequence of low plasmid copy number, degradation of the microinjected DNA, or the loss of the CM ability of the microinjected DNA to be transcribed.

-74

-105

-158

C

4 P

+NEO

--7O/CAT

-54 -64 -74 -105

-54-64 -74 -105

Fig. 3. 5'-Deletion analysis of the human HSP70 promoter. A: CAT assays were performed on gastrula extracts (3 embryo equivalents), which had been previously microinjected with the -26, -35, -42, -54, -64, -74, -105, or -158 delta 5N deletion mutants (Fig. 2). Chloramphenicol (CM) and the acetylated forms are shown. The percentages of 14C-chloramphenicol in the acetylated forms are displayed a t the top. B: RNase protection assays were performed on 10 pg of total RNA from gastrula embryos that had been injected with the -54, -64, -105, or -158 deletion mutants. Undigested probe and the 400 nucleotide protected HSP70-CAT transcript are indicated by arrows. Analysis of RNA from embryos injected with more extensive deletions also revealed the absence of CAT transcripts and are not shown. C: RNase protection assays were performed on similar samples using an antisense riboprobe complementary to the NEO gene. The 216 bp protected transcript is indicated by arrows.

in total RNA isolated from gastrulae transformed with the promoter deletions with -74 or -105 bp boundaries, but not with deletion mutants containing only -54 or -64 bp of the promoter. Thus, the results of promoter activity measured by the CAT assay and by the level of CAT mRNA yield consistent results and reveal that the proximal -74 bp region of the human HSP70 promoter contains the cis-acting elements necessary for early embryonic activation. As a n internal control for the ability of the microinjected DNA to be expressed, we examined the levels of RNA from the neomycin resistance gene (NEO), which was also present on the delta 5N vector DNA. As shown in Figure 3C, NEO RNA levels were similar in embryos injected with the 5'-deletion mutants ranging from -54 to -105. As a n additional control we monitored the presence of the vector DNAs containing the

Constitutive Expression of HSP70-CAT in Xenopus Embryos Involves Multiple Cis-Acting Regulatory Elements The analysis of 5'-deletion mutants revealed that the CCAAT element located a t -68 was essential for transcriptional activation after the midblastula transition. We next examined whether other sequences within this proximal domain were required by microinjecting a set of HSP70-CAT promoters containing linkerscanner mutations in the proximal region into developing Xenopus embryos. The LSPN series of promoter vectors (Fig. 4) contain mutations in the context of a -100 bp promoter fused to the CAT gene, which is linked to a NEO gene in the opposite orientation [Williams et al., 19891. The nomenclature for the LSPN linker scanner mutations corresponds to the regions in the proximal promoter in which nucleotide substitutions have been made. Each of the LSPN linker-scanner mutants (400 pg) were microinjected into fertilized embryos and analyzed for CAT activity and mRNA levels at the gastrula stage (Fig. 5A). CAT activity in extracts from gastrula stage embryos microinjected with the wildtype LSPN vector was more than 500 times higher than the background activity in uninjected controls. Only background CAT activity was detected in gastrulae injected with each of the LSPN linker-scanner mutants. The CAT activity results were confirmed by RNase protection assays on gastrulae transformed with the LSPN series (Fig. 5B). Whereas embryos microinjected with the wild-type LSPN vector expressed the 400 nucleotide HSP70-CAT transcript, no transcripts were detected in total RNA from gastrulae transformed with any of the LSPN linker-scanner mutations. We confirmed that the LSPN vectors containing the linker-scanner mutations were transcriptionally competent by assaying for transcription from the covalently linked NEO gene (Fig. 5C). We also used isolated total DNA from the injected embryos for Southern blot analysis to confirm the presence of the microinjected LSPN mutants in gastrula stage embryos (data not shown). Embryonic Nuclear Proteins Form Specific Complexes With Human HSP7O Promoter Elements The deletion and linker-scanning mutant analyses presented above suggested that trans-acting factors in

HSP7O GENE EXPRESSION DURING EMBRYOGENESIS LSPN TO

-100

-60

-40

I

I

-20 I A T F l A P l H TATA

73/63 69/55 59/49 57/47 44/35

-CGAATC C c G 4 m m c G

103

+1 I

%

% %

A m

%

CGA ATCTC CRX

40126

TCG CG4 AXX;AT CG

* *

%

Fig. 4. Diagram of the linker-scanner mutations in the human HSP7O promoter. For each mutant, the numeric notation refers to the region in the promoter in which the indicated base changes have been made. The LSPN series contains 100 bases of the promoter immediately 5’ of the transcriptional start site.

Xenopus embryos interacted with human HSP70 proximal promoter elements to activate transcription in a constitutive fashion. Thus, we performed DNA mobility shift assays using oligonucleotides corresponding to putative regulatory elements of the HSP70 gene (Fig. 6) and nuclear extracts from developing Xenopus embryos. Figure 7 shows that a neurula stage nuclear extract contains a factor(s) that forms a complex with the CCAAT-PB oligonucleotide in the presence of 5 pg of non-specific competitor DNA (poly dl-poly dC; (lane 2 ) . A series of competition experiments (also in the presence of 5 pg poly dl-poly dC) was performed to determine the specificity of this interaction. The amount of retarded probe was significantly reduced when a 50fold molar excess of unlabeled self (CCAAT-PB, lane 3) or CCAAT (lane 4) oligonucleotide was added to the binding reaction. The yield of complex was not reduced in the presence of a 50-fold molar excess of PB (purine box) or noncomplementary HSE oligonucleotide [Mosser et al., 1988; lanes 5 and 61. Similar results were obtained when the CCAAT oligonucleotide was used a s a probe (data not shown). These results suggest that a trans-acting factor in Xenopus embryonic nuclei binds to the human HSP70 CCAAT box, and that the interaction occurs independently of the purine-rich region. We found that the purine box oligonucleotide was not complexed by a Xenopus embryonic nuclear factor under the assay conditions used (Fig. 7B). We also used DNA mobility shift assays to determine if the neurula nuclear extract contained specific binding activity to other sequences in the proximal region of the human HSP70 promoter. For these experiments we used oligonucleotides, which span a region of the promoter that contains a GC-rich element, a TATA box, and a segment that is highly related to both the AP1 [Lee et al., 1987a,b; Angel et al., 19871 and ATF (Lee et al., 1987a,b] consensus elements (Fig. 6). Figure

8A (lane 2 ) shows that the TATA-ATF probe formed a complex with nuclear extract and that competition with a 50-fold excess of unlabeled self (TATA-ATF, lane 3) produced a significant reduction in formation of the complex. A 50-fold excess of unlabeled GC-ATF also competed with the labeled TATA-ATF probe for binding to the factor although less efficiently than the self-competition (compare lanes 3 and 4). When a 50fold excess of HSE was added to the binding reaction no decrease in the complex was observed (lane 5). Incubation of labeled GC-ATF probe resulted in the assembly of two complexes designated b and c (Fig. 8B). A competition with 50-fold excess self (GC-ATF) reduced the formation of both complexes. However, TATA-ATF did not compete a s efficiently with the labeled probe as GC-ATF in the self-competition experiment (compare lanes 3 and 4).Also, a 50-fold excess of noncomplementary HSE did not reduce the formation of either complex (lane 5). These experiments demonstrate that a neurula nuclear extract contains a specific binding activity that will form a complex with the ATF/APl region of the human HSP70 promoter. The reduced ability of the TATA-ATF and GC-ATF probes to compete against each other for factor relative to selfcompetition (compare Fig. 8A, lanes 3 , 4 , and 8B, lanes 3, 4)suggests that there may be more than one factor binding to this region of the promoter. The presence of specific binding activities to the set of human HSP70 oligonucleotides in nuclear extracts of early and late blastula stage embryo was also determined. For example, Figure 9 shows that end-labeled CCAAT-PB (A) and GC-ATF (C) probes form complexes with early and late blastula stage extracts that co-migrate with the complexes formed with the neurula nuclear extract. Binding activity of early blastula stage extract to TATA-ATF (B) was very low but was better visualized on the autoradiograms with longer

OVSENEK ET AL.

104

A 76.5

0.1

0.1

0.1

0.1

0.1

0.8%

binding activities present in early and late blastula nuclei were identical with the binding activity found in neurulae nuclear extract during a series of self- and non-self-competition experiments as described above (data not shown). These data demonstrate that the trans-acting factors that may be essential for the expression of HSP70-CAT are detectable a t a developmental stage that precedes the transcriptional activation of the HSP70 gene at MBT.

CM

LSPN

73/63 69/55 59/49

57/47

44/35 40126

P-c

7OICAT-

C 1

2

3

4

5

6

7

NEO

Fig. 5. Expression of LSPN linker-scanner mutations in Xenopus embryos. A CAT assays were performed on gastrula extracts (3 embryo equivalents) that were microinjected a t the 1-cell stage with 400 pg of LSPNwt, LSPN73163, LSPN69155, LSPN59149, LSPN57147, LSPN44135, or LSPN40126. Acetylated forms of chloramphenicol are indicated by arrows, and the percentages of radioactivity in the acetylated forms are shown. B: RNase protection assays were performed on 10 pg of total RNA isolated from transformed gastrulae. Undigested probe and the protected 400 nucleotide CAT transcript are indicated. C: RNase protection assays were performed on 10 pg of total RNA isolated from transformed gastrulae (as above) using antisense NEO gene RNA. Lane 1, LSPN wt; Lane 2, LSPN73163; lane 3, LSPN691 55; lane 4, LSPN59149;lane 5, LSPN57147; lane 6, LSPN44135; lane 7, LSPN40126. The 216 nucleotide protected NEO transcripts are indicated.

exposure times. Interestingly, the amount of complex formed with all three oligonucleotides increased dramatically with development from early blastula to neurula stages. Furthermore, the specific oligonucleotide

DISCUSSION The expression of microinjected chimeric human HSP70-CAT genes during Xenopus development was analyzed by both CAT assays and RNase protection analysis. Interestingly, the human HSP70 promoter is activated in a constitutive fashion after the midblastula transition. Furthermore, the human HSP7O-CAT fusion gene displayed strong basal expression, which was unaffected by heat shock. This finding is in contrast to the stage-dependent, heat-inducible expression of the endogenous Xenopus HSP70 genes [Bienz, 1984a; Heikkila et al., 1985, 1987; Nickells and Browder, 19851 and a microinjected Xenopus HSP70-CAT fusion gene [Krone and Heikkila, 19891. In human cells, the complex pattern of HSP70 regulation involves a large number of cis-acting regulatory elements in the promoter [Morgan et al., 1987; Greene et al., 1987, Wu et al., 19861. Expression of the human HSP70 gene is regulated during normal cell growth and differentiation [Wu and Morimoto, 1985; Kao et al., 1985; Milarski and Morimoto, 19861 and in response to various stresses [Wu et al., 1986; Mosser et al., 1988; Watowich and Morimoto, 19881. Therefore, it was possible that some of the cis-acting regulatory elements of the human promoter may be active in Xenopus embryos. In order to define the cis-acting elements involved in the constitutive expression of the human HSP70 promoter a t the MBT, we have used a collection of 5’deletion and linker-scanner mutations in the HSP70 promoter. The results obtained from microinjection of 5 ‘-deletion mutants revealed high levels of CAT activity and correctly initiated HSP70-CAT transcripts when the promoter was deleted up to position -74. Within this region are multiple cis-acting elements including a CCAAT box centered around position -68 that is essential for expression of the human HSP70 gene in Xenopus embryos. By using a series of LSPN linker-scanner mutants we found that mid-to-late blastula expression required the involvement of other cisacting regulatory elements in the basal promoter, namely, the TATA, ATF/APl, GC, and purine-rich elements. Comparison of the 5’-flanking sequences between the human and Xenopus HSP70 [Bienz, 1984bl promoter region reveals considerable similarities in the complexity and spatial arrangement of cis-acting ele-

HSP70 GENE EXPRESSION DURING EMBRYOGENESIS 5' 3' CGAGCTCGGTGATGGCTC

105

CCAAT ( - 7 8 to

CGAGCTCGGTGATTGGCTCAGAAGGGAA AAGGCCG

-60)

CCAAT/PB (-78

to

-45)

GC/ATF

AAGGCGGGTCTCCGTGACGACTT

(-50

CGGCGTGACGACTATAAAAGCCCAGCCG

to

-28)

TATA/ATF (-41

to

-13)

Fig. 6. Sequences of synthetic oligonucleotides used in DNA mobility shift assays. The relative positions of the oligonucleotides within the human HSP70 promoter are indicated.

A 1

2

B 1 2 3 4

3 4 5 6

B

A 1 2 3 4 5

1 2 3 4 5

-a

Fig. 7. A DNA mobility shift assay detecting a complex formed between the CCAAT box oligonucleotide of the human HSP7O promoter and a Xenopus neurula nuclear extract. End-labeled CCAATPB probe (lane 1)was incubated with 30 pg of nuclear extract (lane 2) or additionally in the presence of a 50-fold molar excess of unlabeled CCAAT-PB (lane 3), CCAAT box (lane 4), PB (purine box) (lane 5), or HSE oligonucleotide (lane 6). B: End-labeled PB (purine box) prove (lane 1)was incubated with 50 pg (lane 2 ) of neurula stage nuclear extract. Lane 3 contained a 50-fold molar excess of unlabeled PB as a competitor. As a positive control, 30 pg of the same extract was incubated with end-labeled CCAAT-PB probe (lane 4). Specific complexes are indicated by an arrow.

Fig. 8. DNA mobility shift assay demonstrating DNA-bindmg activity in neurula stage nuclear extracts specific for TATA-ATF and GC-ATF oligonucleotides. A: End-labeled TATA-ATF probe (lane 1) was incubated with 30 pg of neurula stage nuclear extract (lane 2) or additionally in the presence of a 50-fold molar excess of unlabeled TATA-ATF (lane 3), GC-ATF (lane 4),or HSE oligonucleotide (lane 5). B: End-labeled GC-ATF probe (lane 1) was incubated with 30 pg of neurula nuclear extract (lane 2 ) or additionally in the presence of a 50-fold molar excess of unlabeled GC-ATF (lane 3), TATA-ATF (lane 4), or HSE oligonucleotide (lane 5). Specific complexes are indicated by arrows.

106

OVSENEK ET AL.

ments. Bienz and Pelham [1986] have shown that two Xenopus HSP7O promoter elements, HSE and CCAAT, are necessary for strong constitutive expression in oocytes. Interestingly, our studies using developingxenopus embryos indicate that only 74 bp of human HSP70 promoter containing the CCAAT box but not the HSE are sufficient for basal expression after the midblastula stage of embryogenesis. It is likely that this truncated human HSP70 promoter shares common regulatory features found with the promoters of endogenous genes that are activated a t the MBT. Our microinjection experiments strongly implied that trans-acting factors present in Xenopus embryos during early development interacted specifically with regulatory elements of the human HSP70 promoter to mediate the constitutive expression of CAT fusion genes. The results from the DNA mobility shift experiments clearly show that Xenopus blastula and neurula nuclear extracts contain binding activity that forms a complex with the CCAAT box of the human HSP70 promoter. Presumably, the CCAAT-specificbinding activity we observe in nuclei from Xenopus embryonic tissue is attributable to a protein, or group of proteins, homologous to the CTF/NFl group of transcriptional activators [Jones et al., 1985, 1987; Graves et al., 1986; McKnight and Tjian, 19861.

A

The present study has also revealed the existence of two or more specific binding activities interacting with the GC-ATF-TATA region of the HSP70 promoter. Although competition experiments have confirmed the sequence specificity of the binding activities, we find that the two ATF-containing oligonucleotides do not cross-compete efficiently for binding to radiolabeled probe. These observations are compatable with the presence of two proteins in embryonic nuclei that interact with the ATFiAPl site. Since recent studies have demonstrated that yeast AP1 and ATF binding activities are indistinguishable from the mammalian factors [Jones et al., 1988; Harshman et al., 1988; Jones and Jones 19891, it is likely that we have observed the binding of the Xenopus counterparts to these transactivators. Furthermore, it is tenable that a transcription factor present in Xenopus embryos may specifically bind to the GC box (Fig. 8B) since this promoter element is a perfect match to the mammalian Spl binding site [Dynan and Tjian, 1983a,b; Gidoni et al., 1984, 19851. In our DNA mobility shift experiments with the GC-ATF probe we obtained two distinct bands (Fig. 8B). It is possible that band c is a degradation product of band b. Alternatively, the multiple bands we observed may be due to different phosphorylation states of a single factor. For example, studies with the yeast

C

B 1

2

3

4

1

2

3

1 2 3 4

4

--C

r-b

Fig. 9. DNA mobility shift assays comparing DNA-binding activity in nuclear extracts from early and late blastula and neurula stage embryos. End-labeled human HSP7O oligonucleotides were incubated with 90 bg of early blastula (stage 8 ) nuclear extract, 70 +g of late blastula (stage 9 ) extract, or 20 +g of neurula stage nuclear extract. A: Lane 1, CCAAT-PB probe; lane 2, CCAAT-PB probe plus early blastula extract; lane 3, CCAAT-PB probe plus late blastula extract;

+d

lane 4, CCAAT-PB probe plus neurula extract. B: Lane 1, TATAATF probe; lane 2, TATA-ATF probe plus early blastula extract; lane 3, TATA-ATF probe plus late blastula extract; lane 4, TATA-ATF probe plus neurula extract. C: Lane 1, GC-ATF probe; lane 2, GCATF probe plus early blastula extract; lane 3, GC-ATF plus late blastula extract; lane 4, GC-ATF plus neurula extract. Complexes are indicated with arrows.

HSP7O GENE EXPRESSION DURING EMBRYOGENESIS ATF have shown that different phosphorylation states influence the number of complexes observed in DNA mobility shift assays [Jones and Jones, 19891. Collectively, our microinjection and DNA mobility shift data strongly suggest that factors that bind to the CCAAT, GC, and ATFiAPl-like sequences are essential for the activation of microinjected human HSP70 genes after the midblastula transition. Although the linker-scanner experiments suggest that the TATA and PB elements may also interact with transcription factors in Xenopus embryos, we did not observe binding activity specific to either of these elements. We speculate that sequences in the PB may be involved in the recognition of adjacent promoter sequences by Xenopus transcription elements, or that the in vitro assay conditions we used did not permit the binding of a putative factor. A third possibility is that a PB-specific factor was not recovered or was inactivated by the nuclear isolation procedure. The TATA element, which is required for transcriptional initiation of most RNA pol I1 genes, undoubtedly plays a role in the activation of the human HSP70 gene in Xenopus embryos, although we were unable to detect any protein interactions using crude nuclear extracts. We have also observed detectable levels of binding activities specific for the CCAAT, TATA-ATF, and GCATF oligonucleotides in early blastula nuclei. Therefore, it is unlikely that the lack of expression of endogenous genes or microinjected HSP70 constructs before the MBT is due to the complete absence of transcription factors in nuclei. However, it is possible that a critical level of nuclear transcriptional activators is required for gene expression at MBT. We have observed a n increase in the binding activities of several trans-acting factors in nuclei, relative to nuclear protein, between early blastula and late blastula stages (Fig. 9). This increase in binding affinity in nuclei from the early to late blastula stage of development may be due to 1)a n increase in the total embryonic levels of these factors, 2) activation of these factors by some post-translational modification, or 3) relocalization of the factors from the cytoplasm to the nucleus. Thus, the mechanism by which selected genes are transcribed precisely a t the MBT may involve a n increase in the binding affinity of these transcription factors in nuclei between early and late blastula stages.

ACKNOWLEDGMENTS This research has been supported by a Natural Sciences and Engineering Research Council of Canada grant to J.J.H. and by grants from NIGMS, the March of Dimes Foundation, and a Faculty Research Award (FRA 313) from the American Cancer Society to R.I.M. We thank Klara Abravaya and Dick Mosser for their comments on this manuscript and Tom Sargent and Alison Snape for supplying us with the nuclear isolation protocol.

107

REFERENCES Allen RL, O’Brien DA, Eddy EM (1988): A novel hsp7O-like protein (P70)is present in mouse spermatogenic cells. Mol Cell Biol8:828832. Angel P, Imagawa M, Chiu R, Stein B, Imbra R J , Rahmsdorf HJ, Jonat C, Herrlich P, Karin M (1987):Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49:729-739. Auffray C, Rougeon F (1980). Purification of mouse immunoglobulin heavy chain messenger RNAs from total myeloma tumour RNA. Eur J Biochem 107:303-314. Bachvarova R, Davidson EH (1966):Nuclear activation at the onset of amphibian gastrulation. J Exp Zoo1 163:285-295. Banerji SS,Theodorakis NG, Morimoto RI (1984): Heat shock-induced translational control of hsp7O and globin synthesis in chicken reticulocytes. Mol Cell Biol 4:2437-2448. Banerji SS, Laing K, Morimoto RI (1987): Erythroid lineage-specific expression and inducibility of the major heat shock protein HSP70 during avian embryogenesis. Genes Dev 1:946-953. Bensaude 0, Babinet D, Morange M, Jacob F (1983): Heat shock proteins, first major products of zygotic gene activity in mouse embryos. Nature 305:331-333. Bienz M (1984a):Developmental control of the heat shock response in Xenopus Proc Natl Acad Sci USA 81:3138-3142. Bienz M (1984b):Xenopus hsp 70 genes are constitutively expressed in injected oocytes. EMBO J 3:2477-2483. Bienz M, Pelham HRB (1986): Heat shock regulatory elements function as an inducible enhancer in the Xenopus hsp7O gene and when linked to a heterologous promoter. Cell 45:753-760. Bienz M, Pelham HRB (1987): Mechanisms of heat-shock gene activation in higher eukaryotes. Adv Genet 24:31-72. Bond U, Schlesinger MJ (1987): Heat-shock proteins and development. Adv Genet 24:l-23. Brown DD, Lillna E (1964):RNA synlhesis during the development of Xenopus laeuis, the South African clawed toad. J Mol Biol 8:669687. Craig EA (1985): The heat shock response. Crit Rev Biochem 18: 239-280. Dynan WS, Tjian R (1983a): Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase 11. Cell 32:669-680. Dynan WS, “Jian R (1983b): The promoter-specific transcription factor Spl binds to upstream sequences in the SV40 Early promoter. Cell 35:79-87. Etkin LD (1988):Regulation of the mid-blastula transition in amphibians. In Browder LW (ed): “Developmental Biology, a Comprehensive Synthesis,” vol. 5. New York: Plenum Press, pp. 209-225. Etkin L.D., Pearman B., Balcells S (1986):Regulation of heterologous genes injected into oocytes and eggs of Xenopus laeuis. In “Molecular Genetics of Mammilian Cells.” Malacinski G. (eds): New York: Macmillan, pp 247-268. Ferris DK, Harrel-Bellan A, Morimoto RI, Welch WJ, Farrar WL (1988): Mitogen and lymphokine stimulation of heat shock proteins in T lymphocytes. Proc Natl Acad Sci USA 85:3850-3854. Fried M, Crothers DM (1981):Equilibria and kinetics of lac repressoroperator interaction by polyacrylamide gel electrophoresis. Nucleic Acids Res 9:6505-6525. Gidoni D, Dynan WS, Tjian R (1984): Multiple specific contacts between a mammalian transcription factor and its cognate promoters. Nature 312:409-413. Gidoni D, Kadonga JT, Barrera-Saldana H, Takahashi K, Chambon P, Tjian R (1985): Bidirectional SV40 transcription mediated by tandem Spl binding interactions. Science 230:511-517. Gorman CM, Moffat LF, Howard BH (1982): Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051. Graves BJ, Johnson PF, McKnight SL (1986): Homologous recognition of a promoter domain common to the MSV LTR and the HSV tk gene. Cell 44:565-576.

108

OVSENEK ET AL.

Greene JM, Larin Z, Taylor ICA, Prentice H, Gwinn K, Kingston RE (1987): Multiple basal levels of a human hsp7O promoter function differently in human and rodent cell lines. Mol Cell Biol 7:36463655. Harshman KD, Moye-Rowely WS, Parker CS (1988):Transcriptional activation by the SV40 AP-1 recognition element in yeast is mediated by a factor similar to AP-1 that is distinct from GCN4. Cell 53:321-330. Heikkila JJ, Kloc M, Bury J, Schultz GA, Browder LW (1985):Aquisition of the heat shock response and thermotolerance during early development of Xenopus laeuis. Dev Biol 107:483-489. Heikkila J J , Browder LW, Gedamu L, Nickells RW, Schultz GA (19861: Heat shock gene expression in animal embryonic systems. Can J Genet Cytol 28:1093-1105. Heikkila J J , Ovsenek N, Krone P (1987):Examination of heat shock protein mRNA accumulation on early Xenopus Zaeuis embryos. Biochem Cell Biol 65:87-94. Hitchcock MJM, Friedman RM (1980): Microinjection of Xenopus oocytes. An automated device for volume control in the nanoliter range. Anal Biochem 109:338-344. Hunt C, Morimoto R (19851: Conserved features of eukaryotic hsp7O genes revealed by comparison with the nucleotide sequence of human hsp70. Proc Natl Acad Sci USA 82:6455-6459. Jonas EA, Snape AM, Sargent TD (19891: Transcriptional regulation of a Xenopus embryonic epidermal keratin gene. Development 106: 399-405. Jones RH, Jones NC (1989): Mammalian CAMP-responsive element can activate transcription in yeast and binds a yeast factork) that resembles the mammalian transcription factor ATF. Proc Natl Acad Sci USA 86:2176-2180. Jones KA, Yamamoto KR, Tjian R (19851: Two distinct transcription factors bind to the HSV thymidine kinase promoter in vitro. Cell 42:559-572. Jones KA, Kadonaga JT, Rosenfeld PJ, Kelly ‘YJ, ‘l’jian R (1987): A cellular DNA-binding protein that activated eukaryotic transcription and DNA replication. Cell 48:79-89. Jones RH, Moreno S, Nurse P, Jones NC (1988): Expression of the SV40 promoter in fission yeast: Identification and characterization of an AP-1-like factor. Cell 53:659-667. Kao HT, Capasso 0, Heintz N, Nevins JR (1985):Cell cycle control of the human HSP70 gene: Implications for the role of a cellular E1Alike function. Mol Cell Biol 5:628-633. Krawczyk Z, Wisniewski J , Biesiada E (19871: An hsp7O-related gene is constitutively highly expressed in testis of rat and mouse. Mol Biol Rep 12:27-34. Krieg P, Melton D (1985): Developmental regulation of a gastrula specific gene injected into fertilized Xenopus eggs. EMBO J 4:34633471. Krieg P, Melton D (1987a): An enhancer responsible for activating transcription a t the mid-blastula transition in Xenopus development. Proc Natl Acad Sci USA 84:2331-2335. Krieg PA, Melton DA (198713):In vitro RNA synthesis with SP6 RNA polymerase. Methods Enzymol 155:397-415. Krone P, Heikkiia JJ (1989): Expression of microinjected hsp30iCAT and hsp7OiCAT chimeric genes in developing Xenopus laeuis embryos. Development 106:271-281. Lee KAW, Hai TY, SivaRaman I, Thimmappaya B, Hurst HC, Jones MC, Green MR (1987a):A cellular protein, activating transcription factor activates transcription of multiple E l A- inducible adenovirus early promoters. Proc Natl Acad Sci USA Lee W, Mitchell P, Tjian R (1987131:Purified transcription factor AP1 interacts with TPA-inducible enhancer elements. Cell 49:741-752. Lindquist S (1986): The heat-shock response. Annu Rev Biochem 55: 1151-1191. Maniatis T, Fritsch EF, Sambrook J (1982): “Molecular Cloning. A Laboratory Manual.” Cold Spring Harbour, NY: Cold Spring Harbour Laboratory Press. McKnight S, Tjian R (1986):Trnascriptional selectivity of viral genes in mammalian cells. Cell 46:795-805. Milarski KL, Morimoto RI (1986): Expression of human HSP70 dur-

ing the synthetic phase of the cell cycle. Proc Natl Acad Sci USA 83:9517-9521. Mohun TJ, Brennan S, Dathan N, Fairman S, Gurdon J B (19841: Cell-type specific activation of actin genes in the early amphibian embryo. Nature 311:716-721. Mohun TJ, Garret N, Gurdon J (1986):Upstream sequences required for tissue-specific activation of the cardiac actin gene in Xenopus Zaeuis embryos. EMBO J 5:3185-3193. Mohun TJ, Taylor MV, Garret N, Gurdon J B (19891: The CArG promoter sequence is necessary for muscle-specific transcription of the carciac actin gene in Xenopus embryos. EMBO J 8:1153-1161. Morgan WD, Williams GT, Morimoto RI, Greene J, Kingston RE, Tjian R (1987):Two transcriptional activators, CCAAT-box binding transcription factor and heat shock transcription factor, interact with a human hsp70 gene promoter. Mol Cell Biol 7:1129-1138. Morimoto R, Hunt C, Huang S-Y, Berg KL, Banerji SS (19861: Organization, nucleotide sequence and transcription of the chicken HSP7O gene. J Biol Chem 261:12692-12699. Mosser DD, Theodorakis NG, Morimoto RI (19881: Coordinate changes in heat shock element binding activity and HSP7O gene transcription rates in human cells. Mol Cell Biol 8:4736-4744. Newport J, Kirschner M (1982a):A major developmental transition in early Xenopus embryos: I. Characterization and timing of cellular changes a t the midblastula stage. Cell 30:675-686. Newport JW, Kirschner M (198213): A major developmental transition in early Xenopus embryos: 11. Control of the onset of transcription. Cell 30:687-696. Newport JW, Spann T, Kanki J , Forbes D (1985): The role of mitotic factors in regulating the timing of the midblastula transition in Xenopus. Cold Spring Harbor Symp Quant Biol 50:651-656. Nickells RW, Browder LW (1985):Region-specific heat shock protein synthesis correlates with a biphasic acquisition of thermotolerance in Xenopus laeuis embryos. Dev Biol 112:391-395. Nieuwkoop PD, Faber J (1956): “Normal Table of Xenopus laevis (Daudin).”Amsterdam: North Holland. Shiokawa K, Masui Y, Yamana K (1981): Demonstration of RNA synthesis in pre-gastrular embryos of Xenopus laeuis. Dev Growth Differ 23579-587. Singh H, Sen R, Baltimore D, Sharp PA (19861: A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature 319:154-158. Southern PJ, Berg P (1982): Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J Mol Appl Genet 1:327-341. Steinbeisser H, Hoffman A, Stutz F, Trandelenberg MF (1988): Different regulatory elements are required for cell-type and stage specific expression of the Xenopus laeuis skeletal muscle actin gene upon injection in X . laeuis oocytes and embryos. Nucleic Acids Res 16:3223-3238. Taylor M, Treisman R, Garret N, Mohun T (1989): Muscle-specific (CArGl and serum-responsive (SRE) promoter elements are functionally interchangeable in Xenopus embryos and mouse fibroblasts. Development 106:67-78. Watowich SS, Morimoto RI (1988): Complex regulation of heat shockand glucose-responsive genes in human cells. Mol Cell Biol 8:393405. Williams GT, McClanahan TK, Morimoto RI (19891: E l a transactivation of the human HSP7O promoter is mediated through the basal transcription complex. Mol Cell Biol 9:2574-2587. Wu BJ, Morimoto RI (1985): Transcription of the human hsp70 gene is induced by serum stimulation. Proc Natl Acad Sci USA 82:60706074. Wu BJ, Kingston RE, Morimoto RI (19861: Human hsp70 promoter contains a t least two distinct regulatory domains. Proc Natl Acad Sci USA 83:629-633. Wu BJ, Williams GT, Morimoto RI (1987): Detection of three protein binding sites in the serum-regulated promoter ot the human gene encoding the 70-kDa heat shock protein. Proc Natl Acad Sci USA 84:2203-2207. Zakeri ZF, Wolgemuth DJ (1987): Developmental-stage-specific ex-

HSP70 GENE EXPRESSION DURING EMBRYOGENESIS pression of the hsp70 gene family during differentiation of the mammalian germ line. Mol Cell Biol 7:1791-1796. Zakeri ZF, Wolgemuth DJ, Hunt CR (1988): Identification and sequence analysis of a new member of the mouse HSP7O gene family

109

and characterization of its unique cellular and developmental pattern of expression in the male germ line. Mol Cell Biol 8:29252932.