Cell Tissue Res DOI 10.1007/s00441-014-1878-9
REGULAR ARTICLE
Circadian oscillators in the mouse brain: molecular clock components in the neocortex and cerebellar cortex Martin F. Rath & Louise Rovsing & Morten Møller
Received: 27 January 2014 / Accepted: 25 March 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract The circadian timekeeper of the mammalian brain resides in the suprachiasmatic nucleus of the hypothalamus (SCN), and is characterized by rhythmic expression of a set of clock genes with specific 24-h daily profiles. An increasing amount of data suggests that additional circadian oscillators residing outside the SCN have the capacity to generate peripheral circadian rhythms. We have recently shown the presence of SCN-controlled oscillators in the neocortex and cerebellum of the rat. The function of these peripheral brain clocks is unknown, and elucidating this could involve mice with conditional cell-specific clock gene deletions. This prompted us to analyze the molecular clockwork of the mouse neocortex and cerebellum in detail. Here, by use of in situ hybridization and quantitative RT-PCR, we show that clock genes are expressed in all six layers of the neocortex and the Purkinje and granular cell layers of the cerebellar cortex of the mouse brain. Among these, Per1, Per2, Cry1, Arntl, and Nr1d1 exhibit circadian rhythms suggesting that local running circadian oscillators reside within neurons of the mouse neocortex and cerebellar cortex. The temporal expression profiles of clock genes are similar in the neocortex and cerebellum, but they are delayed by 5 h as compared to the SCN, suggestively reflecting a master–slave relationship between the SCN and extra-hypothalamic oscillators. Furthermore, ARNTL protein products are detectable in neurons of the mouse neocortex and cerebellum, as revealed by immunohistochemistry. These findings give reason to further pursue the physiological
significance of circadian oscillators in the mouse neocortex and cerebellum. Keywords Clock genes . Circadian rhythm . Suprachiasmatic nucleus . Cerebral cortex . Cerebellum Abbreviations Actb Actin beta ANOVA Analysis of variance Arntl Aryl hydrocarbon receptor nuclear translocatorlike, also known as Bmal1 Clock Circadian locomotor output cycles kaput Cry1 Cryptochrome 1 CT Circadian time (animals kept in constant darkness for two days and sacrificed in darkness) Dbp D site of albumin promoter binding protein Gapdh Glyceraldehyde-3-phosphate dehydrogenase GFAP Glial fibrillary acidic protein NeuN Neuronal nuclear antigen Nr1d1 Nuclear receptor subfamily 1 group D member 1, also known as Rev-ErbAlpha Per1 Period circadian clock 1 Per2 Period circadian clock 2 qRT-PCR Quantitative real-time RT-PCR ZT Zeitgeber time (animals sacrificed during the light–dark cycle)
Introduction Electronic supplementary material The online version of this article (doi:10.1007/s00441-014-1878-9) contains supplementary material, which is available to authorized users. M. F. Rath (*) : L. Rovsing : M. Møller Department of Neuroscience and Pharmacology, Faculty of Health and Medical Sciences, University of Copenhagen, Rigshospitalet 6102, Blegdamsvej 9, Copenhagen DK-2100, Denmark e-mail: [email protected]
The presence of a circadian clock in the suprachiasmatic nucleus (SCN) of the hypothalamus controlling daily changes in secretion of neuroendocrine hormones, body temperature, and activity has been well documented; however, recent investigations have shown the presence of extra-hypothalamic peripheral clocks exhibiting
Cell Tissue Res
autonomous rhythms in many tissues (Green et al. 2008). At the molecular level, the clockworks of both the SCN and extrahypothalamic oscillators are characterized by an autoregulatory transcriptional 24-h machinery with clock gene products as core elements (Reppert and Weaver 2002). Clock genes are expressed in various parts of the central nervous system constituting molecular clocks with different degrees of autonomy and SCN-dependence (Guilding and Piggins 2007). A limited number of clock gene transcripts have been reported in the neocortex and cerebellum of the mouse; these previous studies include both single transcript detections and large-scale screening efforts as well as noncircadian analyses (Akiyama et al. 1999; Abe et al. 2001, 2004; Wakamatsu et al. 2001; Yang et al. 2007; Wisor et al. 2008; Mendoza et al. 2010; Coogan et al. 2011). Furthermore, recent large-scale analyses on human tissues suggest that a number of core clock gene transcripts are also detectable in the human cerebral cortex and cerebellum (Li et al. 2013). We have recently shown the presence of peripheral circadian oscillators in the neocortex and cerebellar cortex of the rat (Rath et al. 2012, 2013); these extrahypothalamic oscillators are controlled by the SCN. However, the physiological significance of the molecular oscillators of the neocortex and cerebellum is enigmatic. Despite the close phylogenetic relationship between mouse and rat, we have previously shown that circadian gene expression varies considerably between mouse and rat (Bailey et al. 2009; Rovsing et al. 2011). Thus, as a next step towards understanding the function of the circadian oscillators of the neocortex and cerebellum, we analyzed the circadian profile and cellular localization of the molecular clockwork of the mouse neocortex and cerebellum. Since the mouse is the species of choice in conditional knockout models with tissue- and cell-specific clock gene deletions, information about localization and temporal expression of clock genes in the mouse neocortex and cerebellum is of special importance in defining the physiological roles of these extrahypothalamic oscillators of the mammalian brain.
Materials and methods Animals Adult 129SV mice (25–30 g) were housed under a 12-h light/ 12-h darkness schedule with food and water ad libitum. For circadian experiments, male mice were obtained from Charles River Laboratories (Sulzfeld, Germany). Animals for noncircadian experiments were bred at the Department of Experimental Medicine, Panum Institute, from founders obtained from Charles River Laboratories. For circadian experiments, animals were kept in constant darkness conditions for
2 days before they were euthanized. Animals were sacrificed at specific circadian times (CT) or Zeitgeber times (ZT) as specified in the figure legends. For quantitative RT-PCR and western blot analysis, animals were decapitated, brains were dissected and samples were frozen on solid CO2. For neocortical samples, the neocortex was dissected bilaterally from the rhinal fissure to the cingulate gyrus; cerebellar samples included the entire cerebellum. For in situ hybridization, animals were decapitated and brains were frozen on solid CO2. For immunohistochemistry, animals were perfusion fixed in 4 % paraformaldehyde, brains were postfixed overnight in the same fixative, cryoprotected in 25 % sucrose and frozen on solid CO2. Animal experiments were performed in accordance with the guidelines of EU Directive 86/609/EEC and the specific experiments in this study were approved by the Danish Council for Animal Experiments (authorization number 2012-DY-2934-00022) and the Faculty of Health and Medical Sciences, University of Copenhagen (authorization number P13–035). Quantitative real-time RT-PCR Total RNA was isolated using TriZOL reagent (Life Technologies, Nærum, Denmark) according to the manufacturer’s instructions. Total RNA was then subject to DNase treatment using DNase I (Life Technologies). cDNA production was performed following the Superscript III protocol (Life Technologies) using 500 ng of total RNA as starting material. Experiments were performed using a LightCycler 1.5 (Roche Diagnostics, Hvidovre, Denmark). Reactions (25 μl volume) contained 0.5 μM primers, RT Real-Time SYBR Green master mix (SuperArray Bioscience, Frederick, MD, USA) and cDNA according to the manufacturer’s instructions. For primer sequences, see Table 1. Assays included an initial denaturation step at 95ºC for 10 min, followed by 40 cycles of a 95ºC denaturation for 15 s, 30 s annealing at 63ºC, then extension at 72ºC for 30 s. Product specificity was confirmed during every quantitative real-time RT-PCR (qRT-PCR) run by melting curve analysis followed by agarose gel electrophoresis of the amplified product. Transcript number was determined using internal standards; these were prepared by cloning Per1 (period circadian clock 1), Per2 (period circadian clock 2), Clock (circadian locomotor output cycles kaput), Arntl (aryl hydrocarbon receptor nuclear translocator-like, also known as Bmal1), Cry1 (cryptochrome 1), Nr1d1 (nuclear receptor subfamily 1, group D, member 1), Dbp (D site of albumin promoter binding protein), Gapdh (glyceraldehyde-3-phosphate dehydrogenase), and Actb (actin beta) target PCR products into pGEMT Easy vectors (Promega, Madison, WI, USA). Clone identity was confirmed by direct sequencing (DNA Technology, Aarhus, Denmark). For each experiment, a set
Cell Tissue Res Table 1 Sequences of primers used for quantitative real-time PCR Transcript
GenBank accession number
Position
Forward primer sequence (5′-3′)
Reverse primer sequence (5′-3′)
Per1 Per2 Arntl Clock Cry1 Nr1d1 Dbp Gapdh Actb
NM_011065.4 NM_011066.3 NM_007489.4 NM_007715.6 NM_007771.3 NM_145434.3 NM_016974.3 NM_008084.2 NM_007393.3
2,616–2,718 1,524–1,634 1,867–1,991 2,335–2,545 2,204–2,342 385–569 790–964 20–122 54–257
TTCTGTGGCCCCCTCAGCCC GAAGACTCCGCACCCCAGCG GGACCCAACCTTCCCGCAGC ACCGAGCACTCTCACAGCCCC AACGTCCCGAGCTGTAGCGGT CGGGGCTCACTCGTCTCCCT TGTCGCCGGCACCCTCTCCA TGTGCAGTGCCAGCCTCGTC CGGTCCACACCCGCCACCA
GTGGTGGTGGTGGCGGGAAC CCGTTACTGCCCAGGCTCCC CGGCTCTGGTTCCCCCTGGA GACGGCCCCACAAGCTACAGG GACGCTTCCCACTGCTGAGGC GCTCGGGGAGGAGCCACTAG GGGTCCACAGGACTGGGTGTGT GCCACTGCAAATGGCAGCCC TCTGGGCCTCGTCACCCACAT
of 100-fold serial dilutions of each internal standard (101–107 copies/1 μl) was prepared and used to generate standard curves. Clock and clock-controlled gene copy numbers were normalized against the arithmetic means of copy numbers obtained for the two house-keeping genes Gapdh and Actb. Radiochemical in situ hybridization Coronal cryostat sections (12 μm) mounted on glass slides were hybridized with a mixture of two-three DNA probes labeled with [35S]dATP as previously described (Klitten et al. 2008; Rath et al. 2009). For probe sequences, see Table 2. Hybridized sections were exposed to an X-ray film for 2 weeks and developed. Images were digitized and quantified by use of Scion Image Beta 4.0.2 (Scion, Frederick, MD, USA). In the neocortex, all six layers of both motor and somatosensory areas at Bregma −1.7 mm were used for quantification; in the cerebellar cortex, all cortical layers of the most dorsal folium of the vermis were used for quantification. Alternatively, the hybridized sections were covered with a Kodak autoradiographic emulsion (Carestream Health, Skovlunde, Denmark), exposed for 4 weeks, developed and counterstained in cresyl violet. Sections were photographed in an Axiophot microscope (Carl Zeiss Microscopy, Göttingen, Germany) equipped with a Plan Apochromat objective with a numerical aperture of 0.60 and an AxioCam HR digital camera by use of AxioVision 4.4 (Carl Zeiss Vision, MünchenHalbergmoos, Germany). Contrast was adjusted by use of
Table 2 Sequences of probes used for in situ hybridization
Adobe Photoshop CS5 Extended (Adobe Systems Software, Dublin, Ireland). Immunohistochemistry Coronal cryostat sections (40 μm) were processed free-floating as previously described (Rath et al. 2007). Sections were incubated in goat anti-ARNTL (BMAL1 N-20) polyclonal IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted 1/200. For specificity controls, see Supporting Information. The primary antiserum was detected with biotinylated donkey anti-goat IgG (Santa Cruz Biotechnology) diluted 1/500, and the chromogenic reaction was performed in a combination of ABC-Vectastain (Vector Laboratories, Burlingame, CA, USA) diluted 1/100 and diaminobenzidine. For colocalization studies, sections were incubated in the same goat anti-ARNTL (BMAL1 N-20) polyclonal IgG diluted 1/200 in combination with either mouse anti-NeuN monoclonal IgG (Millipore, Hellerup, Denmark) diluted 1/100 or mouse anti-glial fibrillary acidic protein (GFAP) monoclonal IgG (Millipore) diluted 1/400, respectively. The primary antibodies were detected in a combination of Alexa Fluor 488 donkey anti-goat IgG (Invitrogen, Taastrup, Denmark) and Alexa Fluor 568 rabbit anti-mouse IgG (Invitrogen). Diaminobenzidine-stained sections were photographed in an Axiophot microscope (Carl Zeiss Microscopy) equipped with a Plan Apochromat objective with a numerical aperture of 0.32 and an AxioCam HR digital camera by use of AxioVision 4.4 (Carl Zeiss Vision).
Transcript
GenBank accession number
Position
Per2
NM_011066.3
390–353
GTGAGTGTTGGACGATTCCACTAACATCCGCAGCTCCT
803–766
GCCACTTGGTTAGAGATGTACAGGATCTTCCCAGAAAC
Nr1d1
NM_145434.3
Probe sequence (5′-3′)
3,520–3,485
TGTGATTATTCTCTGAAGAGTCAATGCTTCCAAAGT
552–515
TAGAGCCAATGTAGGTGATAACACCACCTGTGTTGTTA
1,419–1,384
CTAACTTGTCATGGGCATAGGTGAAGATTTCTCGAT
Cell Tissue Res
For fluorescence microscopy, sections were photographed in an Axioplan 2 epifluoresence microscope (Carl Zeiss Microscopy) equipped with a Plan Neofluar objective with a numerical aperture of 0.50 and an AxioCam MR digital camera by use of AxioVision 4.4 (Carl Zeiss Vision). Contrast was adjusted by use of Adobe Photoshop CS5 Extended (Adobe Systems Software). Western blot analysis Protein extraction from tissue samples and protein measurements was performed as previously described (Rath et al. 2006). A sample of 50 μg protein per lane was run in a NuPage 4–12 % Bis Tris gel (Life Technologies) at 200 V for 50 min and blotted at 30 V for 2 h by use of the XCell SureLock system (Invitrogen). HiMark Pre-Stained HMW Protein Standard (Invitrogen) and Precision Plus Protein Kaleidoscope (Bio-Rad Laboratories, Copenhagen, Denmark) molecular weight markers were run simultaneously. The membrane was blocked in 2 % skim milk for 30 min and incubated in goat anti-ARNTL (BMAL1 N-20) polyclonal IgG (Santa Cruz Biotechnology) diluted 1/500 in 2 % skim milk at 4ºC overnight. The blot was subsequently washed and incubated in Alexa Fluor 790 donkey anti-goat IgG (Invitrogen) diluted 1/1,000 in 2 % skim milk at room temperature for 1 h. The blot was scanned in an Odyssey Infrared Imager (Li-Cor Biosciences, Cambridge, UK). The digital image was converted to grayscale and the contrast adjusted by use of Adobe Photoshop CS5 Extended (Adobe Systems Software). Statistical analysis Quantitative data obtained by qRT-PCR or in situ hybridization were analyzed by use of GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA, USA). Data are presented as means ± standard error of mean (SEM). Quantitative data were analyzed by one-way analysis of variance (ANOVA). A twotailed p value of 0.05 was considered to represent statistical significance.Circadiandatawerefittedtosine-wavecurvesto mathematically estimate the times of peaking gene expression.
Results Clock genes are expressed with a circadian profile in the neocortex To determine if clock genes are expressed in the neocortex of the 129SV mouse, animals were housed in a controlled 12-h light/12-h darkness schedule, transferred to constant darkness for 2 days and sacrificed at 3-h intervals throughout a 24-h
period. The entire neocortex was removed and samples were used for qRT-PCR for circadian expression analyses of the six core clock genes Per1 (Fig. 1a), Per2 (Fig. 1b), Arntl (Fig. 1c), Clock (Fig. 1d), Cry1 (Fig. 1e), and Nr1d1 (Fig. 1f), as well as the clock-controlled gene Dbp (Fig. 1g). All seven genes were found to be expressed in the mouse neocortex; among these, Per1, Per2, Arntl, Cry1, Nr1d1, and Dbp exhibited significant differences in expression throughout the subjective day–night cycle (Fig. 1a–c, e–g; Table 3), whereas Clock was expressed at constant levels (Fig. 1d; Table 3). The temporal expression profiles differed between the analyzed genes. The highest expression levels of Per1, Per2, and Cry1 were detected in the middle of the subjective night (CT16–CT19), Arntl showed the highest expression levels at the subjective night–day transition (CT24), whereas Nr1d1 expression peaked late in the subjective day (CT11), and peaking levels of Dbp transcripts were detected early in the subjective night (CT15) (Table 3). Clock genes are expressed with a circadian profile in the cerebellum In a similar circadian series, the expression profiles of clock genes were analyzed in the cerebellum of the mouse by use of qRT-PCR (Fig. 2). All seven analyzed clock and clockcontrolled genes were expressed in the cerebellum with Per1, Per2, Arntl, Cry1, Nr1d1, and Dbp exhibiting significant differences in expression throughout the subjective day– night cycle (Fig. 2a–c, e–g; Table 3), whereas Clock was expressed constitutively (Fig. 2d; Table 3). The sequential peaks of expression were similar to those of the neocortex; thus, Per1, Per2, and Cry1 peaked in the middle of the night (CT16-CT19), followed by Arntl at the night–day transition (CT2), Nr1d1 late in the subjective day (CT11), and Dbp early in the subjective night (CT13) (Table 3). Clock gene expression is delayed in the neocortex and cerebellum as compared to the SCN In an effort to combine temporal, spatial, and quantitative analysis of clock gene expression, brains from mice housed in a 12-h light/12-h darkness environment and sacrificed at 4-h intervals were subjected to radiochemical in situ hybridization (Fig. 3). Per2 and Nr1d1 were detected and found to exhibit daily variations in the neocortex, cerebellar cortex, and SCN (Fig. 3a–l; Table 4). Further, the quantitative in situ hybridization analyses confirmed that both neocortical and cerebellar Per2 expression peaked in the middle of the dark period (ZT15) (Fig. 3a, b; Table 4), whereas Nr1d1 expression peaked late in the day in both tissues (ZT8–ZT10) (Fig. 3d, e; Table 4). This temporal pattern of expression was delayed by approximately 5 h as compared to that of the SCN for both
Cell Tissue Res Fig. 1 Quantitative real-time RTPCR analysis of circadian expression of clock and clockcontrolled genes in the mouse neocortex. Mice were transferred to constant darkness 2 days before they were euthanized. Mice were sacrificed at 3-h intervals throughout the subjective day/ subjective night cycle; three mice were analyzed at each time point. Mean values ± SEM are indicated on the graphs. Significance levels representing two-tailed p values based on one-way ANOVA analyses are displayed: *p
REGULAR ARTICLE
Circadian oscillators in the mouse brain: molecular clock components in the neocortex and cerebellar cortex Martin F. Rath & Louise Rovsing & Morten Møller
Received: 27 January 2014 / Accepted: 25 March 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract The circadian timekeeper of the mammalian brain resides in the suprachiasmatic nucleus of the hypothalamus (SCN), and is characterized by rhythmic expression of a set of clock genes with specific 24-h daily profiles. An increasing amount of data suggests that additional circadian oscillators residing outside the SCN have the capacity to generate peripheral circadian rhythms. We have recently shown the presence of SCN-controlled oscillators in the neocortex and cerebellum of the rat. The function of these peripheral brain clocks is unknown, and elucidating this could involve mice with conditional cell-specific clock gene deletions. This prompted us to analyze the molecular clockwork of the mouse neocortex and cerebellum in detail. Here, by use of in situ hybridization and quantitative RT-PCR, we show that clock genes are expressed in all six layers of the neocortex and the Purkinje and granular cell layers of the cerebellar cortex of the mouse brain. Among these, Per1, Per2, Cry1, Arntl, and Nr1d1 exhibit circadian rhythms suggesting that local running circadian oscillators reside within neurons of the mouse neocortex and cerebellar cortex. The temporal expression profiles of clock genes are similar in the neocortex and cerebellum, but they are delayed by 5 h as compared to the SCN, suggestively reflecting a master–slave relationship between the SCN and extra-hypothalamic oscillators. Furthermore, ARNTL protein products are detectable in neurons of the mouse neocortex and cerebellum, as revealed by immunohistochemistry. These findings give reason to further pursue the physiological
significance of circadian oscillators in the mouse neocortex and cerebellum. Keywords Clock genes . Circadian rhythm . Suprachiasmatic nucleus . Cerebral cortex . Cerebellum Abbreviations Actb Actin beta ANOVA Analysis of variance Arntl Aryl hydrocarbon receptor nuclear translocatorlike, also known as Bmal1 Clock Circadian locomotor output cycles kaput Cry1 Cryptochrome 1 CT Circadian time (animals kept in constant darkness for two days and sacrificed in darkness) Dbp D site of albumin promoter binding protein Gapdh Glyceraldehyde-3-phosphate dehydrogenase GFAP Glial fibrillary acidic protein NeuN Neuronal nuclear antigen Nr1d1 Nuclear receptor subfamily 1 group D member 1, also known as Rev-ErbAlpha Per1 Period circadian clock 1 Per2 Period circadian clock 2 qRT-PCR Quantitative real-time RT-PCR ZT Zeitgeber time (animals sacrificed during the light–dark cycle)
Introduction Electronic supplementary material The online version of this article (doi:10.1007/s00441-014-1878-9) contains supplementary material, which is available to authorized users. M. F. Rath (*) : L. Rovsing : M. Møller Department of Neuroscience and Pharmacology, Faculty of Health and Medical Sciences, University of Copenhagen, Rigshospitalet 6102, Blegdamsvej 9, Copenhagen DK-2100, Denmark e-mail: [email protected]
The presence of a circadian clock in the suprachiasmatic nucleus (SCN) of the hypothalamus controlling daily changes in secretion of neuroendocrine hormones, body temperature, and activity has been well documented; however, recent investigations have shown the presence of extra-hypothalamic peripheral clocks exhibiting
Cell Tissue Res
autonomous rhythms in many tissues (Green et al. 2008). At the molecular level, the clockworks of both the SCN and extrahypothalamic oscillators are characterized by an autoregulatory transcriptional 24-h machinery with clock gene products as core elements (Reppert and Weaver 2002). Clock genes are expressed in various parts of the central nervous system constituting molecular clocks with different degrees of autonomy and SCN-dependence (Guilding and Piggins 2007). A limited number of clock gene transcripts have been reported in the neocortex and cerebellum of the mouse; these previous studies include both single transcript detections and large-scale screening efforts as well as noncircadian analyses (Akiyama et al. 1999; Abe et al. 2001, 2004; Wakamatsu et al. 2001; Yang et al. 2007; Wisor et al. 2008; Mendoza et al. 2010; Coogan et al. 2011). Furthermore, recent large-scale analyses on human tissues suggest that a number of core clock gene transcripts are also detectable in the human cerebral cortex and cerebellum (Li et al. 2013). We have recently shown the presence of peripheral circadian oscillators in the neocortex and cerebellar cortex of the rat (Rath et al. 2012, 2013); these extrahypothalamic oscillators are controlled by the SCN. However, the physiological significance of the molecular oscillators of the neocortex and cerebellum is enigmatic. Despite the close phylogenetic relationship between mouse and rat, we have previously shown that circadian gene expression varies considerably between mouse and rat (Bailey et al. 2009; Rovsing et al. 2011). Thus, as a next step towards understanding the function of the circadian oscillators of the neocortex and cerebellum, we analyzed the circadian profile and cellular localization of the molecular clockwork of the mouse neocortex and cerebellum. Since the mouse is the species of choice in conditional knockout models with tissue- and cell-specific clock gene deletions, information about localization and temporal expression of clock genes in the mouse neocortex and cerebellum is of special importance in defining the physiological roles of these extrahypothalamic oscillators of the mammalian brain.
Materials and methods Animals Adult 129SV mice (25–30 g) were housed under a 12-h light/ 12-h darkness schedule with food and water ad libitum. For circadian experiments, male mice were obtained from Charles River Laboratories (Sulzfeld, Germany). Animals for noncircadian experiments were bred at the Department of Experimental Medicine, Panum Institute, from founders obtained from Charles River Laboratories. For circadian experiments, animals were kept in constant darkness conditions for
2 days before they were euthanized. Animals were sacrificed at specific circadian times (CT) or Zeitgeber times (ZT) as specified in the figure legends. For quantitative RT-PCR and western blot analysis, animals were decapitated, brains were dissected and samples were frozen on solid CO2. For neocortical samples, the neocortex was dissected bilaterally from the rhinal fissure to the cingulate gyrus; cerebellar samples included the entire cerebellum. For in situ hybridization, animals were decapitated and brains were frozen on solid CO2. For immunohistochemistry, animals were perfusion fixed in 4 % paraformaldehyde, brains were postfixed overnight in the same fixative, cryoprotected in 25 % sucrose and frozen on solid CO2. Animal experiments were performed in accordance with the guidelines of EU Directive 86/609/EEC and the specific experiments in this study were approved by the Danish Council for Animal Experiments (authorization number 2012-DY-2934-00022) and the Faculty of Health and Medical Sciences, University of Copenhagen (authorization number P13–035). Quantitative real-time RT-PCR Total RNA was isolated using TriZOL reagent (Life Technologies, Nærum, Denmark) according to the manufacturer’s instructions. Total RNA was then subject to DNase treatment using DNase I (Life Technologies). cDNA production was performed following the Superscript III protocol (Life Technologies) using 500 ng of total RNA as starting material. Experiments were performed using a LightCycler 1.5 (Roche Diagnostics, Hvidovre, Denmark). Reactions (25 μl volume) contained 0.5 μM primers, RT Real-Time SYBR Green master mix (SuperArray Bioscience, Frederick, MD, USA) and cDNA according to the manufacturer’s instructions. For primer sequences, see Table 1. Assays included an initial denaturation step at 95ºC for 10 min, followed by 40 cycles of a 95ºC denaturation for 15 s, 30 s annealing at 63ºC, then extension at 72ºC for 30 s. Product specificity was confirmed during every quantitative real-time RT-PCR (qRT-PCR) run by melting curve analysis followed by agarose gel electrophoresis of the amplified product. Transcript number was determined using internal standards; these were prepared by cloning Per1 (period circadian clock 1), Per2 (period circadian clock 2), Clock (circadian locomotor output cycles kaput), Arntl (aryl hydrocarbon receptor nuclear translocator-like, also known as Bmal1), Cry1 (cryptochrome 1), Nr1d1 (nuclear receptor subfamily 1, group D, member 1), Dbp (D site of albumin promoter binding protein), Gapdh (glyceraldehyde-3-phosphate dehydrogenase), and Actb (actin beta) target PCR products into pGEMT Easy vectors (Promega, Madison, WI, USA). Clone identity was confirmed by direct sequencing (DNA Technology, Aarhus, Denmark). For each experiment, a set
Cell Tissue Res Table 1 Sequences of primers used for quantitative real-time PCR Transcript
GenBank accession number
Position
Forward primer sequence (5′-3′)
Reverse primer sequence (5′-3′)
Per1 Per2 Arntl Clock Cry1 Nr1d1 Dbp Gapdh Actb
NM_011065.4 NM_011066.3 NM_007489.4 NM_007715.6 NM_007771.3 NM_145434.3 NM_016974.3 NM_008084.2 NM_007393.3
2,616–2,718 1,524–1,634 1,867–1,991 2,335–2,545 2,204–2,342 385–569 790–964 20–122 54–257
TTCTGTGGCCCCCTCAGCCC GAAGACTCCGCACCCCAGCG GGACCCAACCTTCCCGCAGC ACCGAGCACTCTCACAGCCCC AACGTCCCGAGCTGTAGCGGT CGGGGCTCACTCGTCTCCCT TGTCGCCGGCACCCTCTCCA TGTGCAGTGCCAGCCTCGTC CGGTCCACACCCGCCACCA
GTGGTGGTGGTGGCGGGAAC CCGTTACTGCCCAGGCTCCC CGGCTCTGGTTCCCCCTGGA GACGGCCCCACAAGCTACAGG GACGCTTCCCACTGCTGAGGC GCTCGGGGAGGAGCCACTAG GGGTCCACAGGACTGGGTGTGT GCCACTGCAAATGGCAGCCC TCTGGGCCTCGTCACCCACAT
of 100-fold serial dilutions of each internal standard (101–107 copies/1 μl) was prepared and used to generate standard curves. Clock and clock-controlled gene copy numbers were normalized against the arithmetic means of copy numbers obtained for the two house-keeping genes Gapdh and Actb. Radiochemical in situ hybridization Coronal cryostat sections (12 μm) mounted on glass slides were hybridized with a mixture of two-three DNA probes labeled with [35S]dATP as previously described (Klitten et al. 2008; Rath et al. 2009). For probe sequences, see Table 2. Hybridized sections were exposed to an X-ray film for 2 weeks and developed. Images were digitized and quantified by use of Scion Image Beta 4.0.2 (Scion, Frederick, MD, USA). In the neocortex, all six layers of both motor and somatosensory areas at Bregma −1.7 mm were used for quantification; in the cerebellar cortex, all cortical layers of the most dorsal folium of the vermis were used for quantification. Alternatively, the hybridized sections were covered with a Kodak autoradiographic emulsion (Carestream Health, Skovlunde, Denmark), exposed for 4 weeks, developed and counterstained in cresyl violet. Sections were photographed in an Axiophot microscope (Carl Zeiss Microscopy, Göttingen, Germany) equipped with a Plan Apochromat objective with a numerical aperture of 0.60 and an AxioCam HR digital camera by use of AxioVision 4.4 (Carl Zeiss Vision, MünchenHalbergmoos, Germany). Contrast was adjusted by use of
Table 2 Sequences of probes used for in situ hybridization
Adobe Photoshop CS5 Extended (Adobe Systems Software, Dublin, Ireland). Immunohistochemistry Coronal cryostat sections (40 μm) were processed free-floating as previously described (Rath et al. 2007). Sections were incubated in goat anti-ARNTL (BMAL1 N-20) polyclonal IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted 1/200. For specificity controls, see Supporting Information. The primary antiserum was detected with biotinylated donkey anti-goat IgG (Santa Cruz Biotechnology) diluted 1/500, and the chromogenic reaction was performed in a combination of ABC-Vectastain (Vector Laboratories, Burlingame, CA, USA) diluted 1/100 and diaminobenzidine. For colocalization studies, sections were incubated in the same goat anti-ARNTL (BMAL1 N-20) polyclonal IgG diluted 1/200 in combination with either mouse anti-NeuN monoclonal IgG (Millipore, Hellerup, Denmark) diluted 1/100 or mouse anti-glial fibrillary acidic protein (GFAP) monoclonal IgG (Millipore) diluted 1/400, respectively. The primary antibodies were detected in a combination of Alexa Fluor 488 donkey anti-goat IgG (Invitrogen, Taastrup, Denmark) and Alexa Fluor 568 rabbit anti-mouse IgG (Invitrogen). Diaminobenzidine-stained sections were photographed in an Axiophot microscope (Carl Zeiss Microscopy) equipped with a Plan Apochromat objective with a numerical aperture of 0.32 and an AxioCam HR digital camera by use of AxioVision 4.4 (Carl Zeiss Vision).
Transcript
GenBank accession number
Position
Per2
NM_011066.3
390–353
GTGAGTGTTGGACGATTCCACTAACATCCGCAGCTCCT
803–766
GCCACTTGGTTAGAGATGTACAGGATCTTCCCAGAAAC
Nr1d1
NM_145434.3
Probe sequence (5′-3′)
3,520–3,485
TGTGATTATTCTCTGAAGAGTCAATGCTTCCAAAGT
552–515
TAGAGCCAATGTAGGTGATAACACCACCTGTGTTGTTA
1,419–1,384
CTAACTTGTCATGGGCATAGGTGAAGATTTCTCGAT
Cell Tissue Res
For fluorescence microscopy, sections were photographed in an Axioplan 2 epifluoresence microscope (Carl Zeiss Microscopy) equipped with a Plan Neofluar objective with a numerical aperture of 0.50 and an AxioCam MR digital camera by use of AxioVision 4.4 (Carl Zeiss Vision). Contrast was adjusted by use of Adobe Photoshop CS5 Extended (Adobe Systems Software). Western blot analysis Protein extraction from tissue samples and protein measurements was performed as previously described (Rath et al. 2006). A sample of 50 μg protein per lane was run in a NuPage 4–12 % Bis Tris gel (Life Technologies) at 200 V for 50 min and blotted at 30 V for 2 h by use of the XCell SureLock system (Invitrogen). HiMark Pre-Stained HMW Protein Standard (Invitrogen) and Precision Plus Protein Kaleidoscope (Bio-Rad Laboratories, Copenhagen, Denmark) molecular weight markers were run simultaneously. The membrane was blocked in 2 % skim milk for 30 min and incubated in goat anti-ARNTL (BMAL1 N-20) polyclonal IgG (Santa Cruz Biotechnology) diluted 1/500 in 2 % skim milk at 4ºC overnight. The blot was subsequently washed and incubated in Alexa Fluor 790 donkey anti-goat IgG (Invitrogen) diluted 1/1,000 in 2 % skim milk at room temperature for 1 h. The blot was scanned in an Odyssey Infrared Imager (Li-Cor Biosciences, Cambridge, UK). The digital image was converted to grayscale and the contrast adjusted by use of Adobe Photoshop CS5 Extended (Adobe Systems Software). Statistical analysis Quantitative data obtained by qRT-PCR or in situ hybridization were analyzed by use of GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA, USA). Data are presented as means ± standard error of mean (SEM). Quantitative data were analyzed by one-way analysis of variance (ANOVA). A twotailed p value of 0.05 was considered to represent statistical significance.Circadiandatawerefittedtosine-wavecurvesto mathematically estimate the times of peaking gene expression.
Results Clock genes are expressed with a circadian profile in the neocortex To determine if clock genes are expressed in the neocortex of the 129SV mouse, animals were housed in a controlled 12-h light/12-h darkness schedule, transferred to constant darkness for 2 days and sacrificed at 3-h intervals throughout a 24-h
period. The entire neocortex was removed and samples were used for qRT-PCR for circadian expression analyses of the six core clock genes Per1 (Fig. 1a), Per2 (Fig. 1b), Arntl (Fig. 1c), Clock (Fig. 1d), Cry1 (Fig. 1e), and Nr1d1 (Fig. 1f), as well as the clock-controlled gene Dbp (Fig. 1g). All seven genes were found to be expressed in the mouse neocortex; among these, Per1, Per2, Arntl, Cry1, Nr1d1, and Dbp exhibited significant differences in expression throughout the subjective day–night cycle (Fig. 1a–c, e–g; Table 3), whereas Clock was expressed at constant levels (Fig. 1d; Table 3). The temporal expression profiles differed between the analyzed genes. The highest expression levels of Per1, Per2, and Cry1 were detected in the middle of the subjective night (CT16–CT19), Arntl showed the highest expression levels at the subjective night–day transition (CT24), whereas Nr1d1 expression peaked late in the subjective day (CT11), and peaking levels of Dbp transcripts were detected early in the subjective night (CT15) (Table 3). Clock genes are expressed with a circadian profile in the cerebellum In a similar circadian series, the expression profiles of clock genes were analyzed in the cerebellum of the mouse by use of qRT-PCR (Fig. 2). All seven analyzed clock and clockcontrolled genes were expressed in the cerebellum with Per1, Per2, Arntl, Cry1, Nr1d1, and Dbp exhibiting significant differences in expression throughout the subjective day– night cycle (Fig. 2a–c, e–g; Table 3), whereas Clock was expressed constitutively (Fig. 2d; Table 3). The sequential peaks of expression were similar to those of the neocortex; thus, Per1, Per2, and Cry1 peaked in the middle of the night (CT16-CT19), followed by Arntl at the night–day transition (CT2), Nr1d1 late in the subjective day (CT11), and Dbp early in the subjective night (CT13) (Table 3). Clock gene expression is delayed in the neocortex and cerebellum as compared to the SCN In an effort to combine temporal, spatial, and quantitative analysis of clock gene expression, brains from mice housed in a 12-h light/12-h darkness environment and sacrificed at 4-h intervals were subjected to radiochemical in situ hybridization (Fig. 3). Per2 and Nr1d1 were detected and found to exhibit daily variations in the neocortex, cerebellar cortex, and SCN (Fig. 3a–l; Table 4). Further, the quantitative in situ hybridization analyses confirmed that both neocortical and cerebellar Per2 expression peaked in the middle of the dark period (ZT15) (Fig. 3a, b; Table 4), whereas Nr1d1 expression peaked late in the day in both tissues (ZT8–ZT10) (Fig. 3d, e; Table 4). This temporal pattern of expression was delayed by approximately 5 h as compared to that of the SCN for both
Cell Tissue Res Fig. 1 Quantitative real-time RTPCR analysis of circadian expression of clock and clockcontrolled genes in the mouse neocortex. Mice were transferred to constant darkness 2 days before they were euthanized. Mice were sacrificed at 3-h intervals throughout the subjective day/ subjective night cycle; three mice were analyzed at each time point. Mean values ± SEM are indicated on the graphs. Significance levels representing two-tailed p values based on one-way ANOVA analyses are displayed: *p
