Bioelectromagnetics 36:294^301 (2015)
Circadian Gene Expression and Extremely Low-Frequency Magnetic Fields: An InVitro Study Nicola Manzella,1 Massimo Bracci,1* Veronica Ciarapica,1 Sara Staffolani,1 Elisabetta Strafella,1 Venerando Rapisarda,2 MatteoValentino,1 Monica Amati,1 Alfredo Copertaro,3 and Lory Santarelli1 1
Occupational Medicine, Department of Clinical and Molecular Sciences, Polytechnic University of Marche, Ancona, Italy 2 Section of Occupational Medicine, Department of Internal Medicine and Systemic Diseases, University of Catania, Catania, Italy 3 HealthcareWorkers Service, Azienda Sanitaria Unica Regionale (ASUR) Marche, Loreto Hospital, Loreto, Italy It is well known that circadian clocks are mainly regulated by light targeting signaling pathways in the hypothalamic suprachiasmatic nucleus. However, an entrainment mediated by nonphotic sensory stimuli was also suggested for peripheral clocks. Exposure to extremely low frequency (ELF) electromagnetic fields might affect circadian rhythmicity. The goal of this research was to investigate effects of ELF magnetic fields (ELF-MF) on circadian clock genes in a human fibroblast cell line. We found that an ELF-MF (0.1 mT, 50 Hz) exposure was capable of entraining expression of clock genes BMAL1, PER2, PER3, CRY1, and CRY2. Moreover, ELF-MF treatment induced an alteration in circadian clock gene expression previously entrained by serum shock stimulation. These results support the hypothesis that ELF-MF may be able to drive circadian physiologic processes by modulating peripheral clock gene expression. Bioelectromagnetics 36:294–301, 2015. © 2015 Wiley Periodicals, Inc. Key words: circadian rhythm; biological clock; ELF; fibroblasts; clock genes
INTRODUCTION Diffusion of extremely low frequency electromagnetic fields (ELF-EMF) in the human environment has raised the question of biological effects of EMF on mammalian cells. A large number of studies have reported an effect mediated by ELF-EMF exposure in mT range on processes such as cell proliferation, cell cycle regulation, cell differentiation, metabolism, and various physiological characteristics of cells [Simk o et al., 1998; De Mattei et al., 1999; Mattsson et al., 2001; Harris et al., 2002; Fatigoni et al., 2005; Wolf et al., 2005; Zwirska-Korczala et al., 2005; Polaniak et al., 2010]. However, a certain number of studies have investigated whether ELFEMF exposure at lower magnetic flux density could result in cell physiology change [Czyz et al., 2004; Shi et al., 2005; Frahm et al., 2006; Mannerling et al., 2010; Markkanen et al., 2010; Luukkonen et al., 2011; Cocek et al., 2012; Luukkonen et al., 2014] It is possible that certain cellular processes, altered by exposure to ELF-EMF, indirectly affect cell physiology [Bułdak et al., 2012; Artacho-Cordon 2015 Wiley Periodicals, Inc.
et al., 2013]. Vanderstraeten et al. [2012] hypothesized that ELF-MF contribution to alteration of cell physiological processes might stem from an alteration of circadian rhythmicity. Circadian rhythms are oscillations characterized by a period length of around 24 h [Reppert and Grant sponsor: The National (Italian) Institute for Occupational Injury Insurance (INAIL). Conflicts of interest: None Additional Supporting Information may be found in the online version of this article. *Correspondence to: Massimo Bracci, MD, PhD, Occupational Medicine, Department of Clinical and Molecular Sciences, Polytechnic University of Marche, Via Tronto 10/a, 60126 Torrette, Ancona, Italy. E-mail: [email protected] Received for review 5 August 2013; Accepted 6 March 2015 DOI: 10.1002/BEM.21915 Published online 22 March 2015 in Wiley Online Library (wileyonlinelibrary.com).
ELF-MF Modulates Clock Gene Expression
Weaver, 2002]. These endogenously generated rhythms persist in absence of external stimuli and are sustained by a molecular oscillator present in many cells and tissues throughout the organism. Intracellular clocks are regulated by a set of clock genes involved in an autoregulatory transcriptional–translational feedback loop [Reppert and Weaver, 2002; Lowrey and Takahashi, 2004]. In mammalians, the master clock and peripheral clocks work cooperatively [Silver et al., 1996; Hirota and Fukada, 2004]. The central clock is entrained mainly by lightdark cycles, while peripheral clocks can be regulated by nervous and humoral signals (such as glucocorticoids), daily feeding cycle and xenobiotic agents (such as lithium or styrene) exposure [Balsalobre et al., 2000; Osland et al., 2011; Buijs et al., 2013; Manzella et al., 2013; Stevens et al., 2014]. The circadian control system increases fitness and allows organisms to adapt to their physical and ecological environment controlling several biological processes such as proliferation, cell cycle control, and DNA damage repair [De Paula et al., 2008; Borgs et al., 2009; Sancar et al., 2010; Gaddameedhi et al., 2011]. Some alterations of cell physiological processes induced by ELF-EMF exposures might be mediated by modifications of biological clock machinery through variations of clock genes expression. In this paper, we investigated the hypothesis that extremely low frequency magnetic field (ELF-MF) could be associated with alterations of circadian rhythmicity [Vanderstraeten et al., 2012]. In particular we investigated whether an ELF-MF exposure at low magnetic flux density (0.1 mT) was capable of affecting circadian gene expression. MATERIALS AND METHODS ELF-MF Exposure Unit The ELF magnetic field exposure unit is shown in Figure 1. The unit was positioned into a waterjacketed temperature and atmosphere regulated incubator (37.0 0.1 8C and 5% CO2). The ferromagnetic core had a cross section of 4 5 cm2 with a relative magnetic permeability of 2000. It was equipped with two windings that consisted of 550 turns and inserted around the lateral columns. In the middle of the central column, there was a 4 cm air gap. Two windings were connected in series to enhance the field in the central gap, and they were fed by the main power supply line (frequency 50 Hz) through a voltage regulator (V-5 Belotti, Milano, Italy). This allowed for a current variance of 0–1.5 A. This was monitored by
295
Fig. 1. ELF-MF exposure unit schematization. Samples were placed at the center of ferromagnetic core during exposure.
a current meter (45 Fluke, Everett, WA). Magnetic flux density in the gap center was directly proportional to current flowing into the windings. Magnetic flux orientation is orthogonal to the culture flask placed horizontally in the air gap of the ferromagnetic core and it is uniform. A special resin that provided humidity and thermal protection covered the core and windings. This allowed for insertion of the exposing system inside the incubator to stabilize temperature and atmosphere. During calibration, a small loop (d ¼1 cm) (EMCO 7405-903B, EMC Hire, Bedfordshire, UK) was inserted into the gap and connected to a selective voltmeter (3581C Hewlett-Packard, Santa Clara, CA) to measure voltage, V induced by magnetic flux density, B. From induced voltage we can derive magnetic flux density amplitude value where f is frequency (50 Hz in the present study). B¼
2V p2 f d 2
The manufactured system is able to produce a magnetic flux density up to 30 mT for an applied current up to 1.5 A. During the test, the loop was Bioelectromagnetics
296
Manzella et al.
removed and replaced by the cell culture flask for exposure. Since magnetic flux density is orthogonal to the flask, and it is uniform, induced electric field is maximum to flask periphery and linearly drops to zero at the center. For B ¼ 0.1 mT, maximum induced electric field is 0.157 mV/m in our experiments. Cell Culture and ELF-MF Exposure HuDe (human dermal fibroblasts) were purchased from the Istituto Zooprofilattico Sperimentale (Brescia, Italy) [Tiano et al., 2010]. Presence of a molecular clock was previously demonstrated in HuDe cell line [Manzella et al., 2013]. Under standard culture conditions, HuDe cells were grown in monolayer in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Carlsbad, CA) supplemented with 10% heat-inactivated fetal bovine serum and 1% penicillin–streptomycin (Gibco). Two sets of experiments were performed to investigate involvement of ELF-MF exposure in modulation of clock gene expression. In vitro experiments were carried out using ELF-MF flux density of 0.1 mT at 50 Hz as this value represents current exposure limit for the general population in most European countries [Stam, 2011]. In the first set of experiments, HuDe cells were cultured with or without ELF-MF exposure. To this end, HuDe cells were plated out five days prior to the experiment and at confluence they were shifted to serum-free DMEM medium for 48 h. The experiment started (time zero) when cells were exposed to ELFMF (0.1 mT, 50 Hz) generated by the exposure unit positioned into a water-jacketed temperature and atmosphere regulated incubator (37.0 0.1 8C and 5% CO2) for 1 h, then treatment was interrupted and cells cultured without ELF-MF exposure and collected at regular intervals time (1 h, 2 h, 3 h, 4 h, 8 h, 12 h, 16 h, 24 h, 28 h, 32 h, 36 h, 40 h, and 48 h from time zero). Control cells were sham-exposed in another incubator and subjected to the exact same procedures as experimental cells but without receiving any ELF-MF exposure. The control incubator consisted of an electric oven, where electric resistors on the walls produced an average of residual magnetic flux density of 5 mT. In the second set of experiments, the ability of ELF-MF exposure to alter gene oscillation previously entrained by serum shock stimulation was tested. The serum shock approach was a validated procedure used to induce clock gene expression [Balsalobre et al., 1998; Osland et al., 2011; Manzella et al., 2013]. Cells were starved for 48 h and then stimulated with a serum-rich medium (50% DMEM and 50% fetal bovine serum) for 2 h. Subsequently, after washing with DMEM (without serum), cells were cultured in serum-free DMEM under exposure to ELFBioelectromagnetics
MF (0.1 mT, 50 Hz), generated by the exposure unit positioned into a water-jacketed temperature and atmosphere regulated incubator (37.0 0.1 8C and 5% CO2) and harvested after 3 h, 4 h, 8 h, 12 h, 16 h, 24 h, 28 h, 32 h, 36 h, 40 h, and 48 h from start of serum shock. A second batch of fibroblasts were prepared as control for this experiment. These cells were shamexposed in another incubator and subjected to the exact same procedures as experimental cells but without ELF-MF exposure. In both experimental sets, cells were stored in the dark, only briefly exposed to visible light during experimental procedures, to avoid visible light influence. Each set of experiments was repeated three times. All experiments were performed in a blinded fashion by two independent investigators. Expression of Clock Genes Total RNA was extracted (OriGene, Rockville, MD) and checked for quantity and quality with Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE). The RNA was reverse transcribed in cDNA (Applied Biosystems, Foster City, CA), and real-time PCR was performed with Mastercycler ep Realplex (Eppendorf, Hamburg, Germany) using taqMan Gene Expression Master Mix (Applied Biosystems). Specific primer sets (BMAL1, PER2, PER3, CRY1, and CRY2) were obtained from IDT (Integrated DBA Technologies, Coralville, IA). To control variations of cDNA amount available for PCR in various samples, gene expression levels of the target sequences were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAP DH). The Forward (F) and Reverse (R) primer sequence 5’-3’ were: F: CTGTTCATTTTATCCCGACGC and R: TCCACTGACTACCAAGAAAGC for BMAL1; F: TGTTCCACAGTTTCACCTCC and R: TGGTAGCGGATTTCATTCTCG for PER2; F: TGTGTTCTGAAGCGATAGTGG and R: GATGC CCTCAACTATGCTCTC for PER3; F: TTAATAGCTGCGTCGTTCC and R: TCCCGTCT GTTTGTGATTCG for CRY1; F: GTCATATTCAAA GGTCAAGCGG and R: CATGGTTCCTACTTCAGTCTCTG for CRY2; F: GGCCATCCACAGTC TTCTG and R: CAGCCTCAAGATCATCAGCAA for GAPDH. The fold change value was calculated for each time point. Three independent replicates were conducted for each run of Real-Time PCR. Statistical Analysis Results are presented as mean SD. Twoway repeated measures analysis of variance (ANOVA) and Mann-Whitney test were performed according to
ELF-MF Modulates Clock Gene Expression
the number of group comparisons. Oscillation of gene expression was analyzed by cosinor analysis using Cosinor.exe v.2.3 (Roberto Refinetti, University of South Carolina, Salkehatchie, SC) [Refinetti et al., 2007]. Changes at the level of significance of P < 0.05 were assumed to be statistically significant. Statistical analysis was performed by SPSS software (SPSS, Chicago, IL). RESULTS ELF-MF Exposure Induces Clock Gene Expression Results showed that under starvation condition no significant oscillation of clock gene expression was found in sham-exposed samples (Fig. 2). A 1 h ELF-MF exposure induced a significant circadian variation of clock gene expression with a peak after 8 h and 32–36 h following treatment (repeated measures ANOVA analysis, P < 0.05) in 48 h observation period. All clock gene expression followed a similar curve of oscillation. Circadian cycle amplitudes decreased from the first to second cycle during observation period of 48 h. A robust 24 h oscillation of gene expression was found for ELF-MF exposed cells (cosinor analysis, P < 0.05; robustness > 90%). ELF-MF Exposure Alters Clock Gene Expression Entrained by Serum Shock Two-way ANOVA analysis revealed significant effects of time and ELF-MF treatment
297
(P < 0.05) on gene expression. A significant variation of expression of clock genes examined (repeated measures ANOVA analysis, P < 0.05) was observed after serum shock approach (Fig. 3) in both sham-exposed and ELF-MF exposed cells compared to starved cells without an entrainment by serum shock. Amplitude of the circadian cycles decreased from the first to second cycle during the observation period of 48 h. In serum-shocked shamexposed cells, among positive regulatory components of circadian transcriptional complex, a peak in BMAL1 mRNA expression was observed at 8 h and 32 h; while in the negative arm of circadian complex, the peak of transcription was at 3 h (PER2, PER3, and CRY2), at 4 h (CRY1), at 24 h (PER3), and at 28 h (PER2,CRY1, CRY2). Exposure of 0.1 mT, 50 Hz ELF-MF did not alter oscillation observed in serum-shocked cells, but did result in a significant upregulation of the expression of BMAL1, PER2, PER3, CRY1, and CRY2 over time in cells previously entrained with serum (P < 0.05, Fig. 3). Results of cosinor analysis confirmed a significant 24 h cyclic component for all clock genes (P < 0.05). Cosinor analysis confirmed upregulation by ELF-MF of BMAL1, PER2, CRY1, and CRY2, as amplitude was significantly increased after ELFMF treatment compared to sham-exposed samples (P < 0.05). No difference was found in the mesor, acrophase and period values between ELF-MF and sham-exposed cells (Table 1).
Fig. 2. Profiles (24 h) of mRNA expression in ELF-MF exposed or sham-exposed cells. At t ¼ 0 h ELF-MF (0.1mT, 50 Hz) treatment was given; at t ¼1h, ELF-MF treatment was interrupted. Bioelectromagnetics
298
Manzella et al.
Fig. 3. Profiles (24 h) of mRNA expression in ELF-MF exposed or sham-exposed cells, after serum shock stimulation. At t ¼ 0 h serum shock was given; at t ¼ 2 h, cells were exposed (hollow symbols), or sham-exposed (solid symbols) to ELF-MF (0.1mT, 50 Hz).
DISCUSSION Although a number of reports have been published regarding biological effects caused by ELFEMF (50/60 Hz) [IARC, 2002; Lagroye et al., 2011], there is still need for more basic research in this area in particular for ELF-EMF exposures at lower magnetic flux density, since knowledge of underlying molecular mechanisms will shed light on potential health risks. Recently, a role for ELF-MF exposure in altering circadian rhythmicity was proposed to explain interaction of ELF-MF with a number of biological processes [Vanderstraeten et al., 2012]. Kumlin et al. [2005] reported an exposure to 50Hz 0.1 mT ELF-MF seemed to cause a rhythm in the 6hydroxymelatonin sulfate excretion in mice by enhancing sensitivity of the pineal gland to circadian light rhythm. It was hypothesized that MF signal goes to the pineal gland through the eyes, then stimulates pineal cells so they are more receptive to signals from the biological clock. Potential involvement of ELF-MF on circadian gene expression can be further supported by evidence of the role of EMF in regulation of calcium fluxes and PKC enzyme, which are known as modulators of clock gene expression [Korzh-Sleptsova et al., 1995; Uckun et al., 1995; Dibirdik et al., 1998]. It was well demonstrated that clock genes play a pivotal role in many cell processes regulation and are not specifically expressed in suprachiasmatic nucleus but are widely Bioelectromagnetics
distributed [Welsh et al., 1995; Albrecht et al., 1997; Oishi et al., 1998; Balsalobre et al., 1998; Manzella et al., 2013]. In this study, we investigated whether ELFMF exposure at 0.1 mT and 50 Hz was capable of influencing clock gene expression in a fibroblast cell line (HuDe). To do so, we first investigated the effect of 1 h ELF-MF exposure on clock gene expression. Compared to sham-exposed cells, ELF-MF exposed cells showed a significant variation in clock gene expression during the 48 h observation period. Circadian cycle amplitude decreased from the first to second cycle during observation period of 48 h. It is likely, that ELF-MF induced clock gene expression could be attenuated because of a gradual loss of entraining effect mediated by ELF-MF. Next, we investigated the ability of ELFMF exposure to alter gene oscillation previously entrained by serum shock stimulation. Our findings demonstrated that ELF-MF exposure altered serum shock-induced clock gene expression with significant effects on the increase of amplitude of circadian oscillation. No effect of ELF-MF exposure on acrophase value was observed in our study; however, ELFMF stimulation in a phase of gene clock oscillation different from start of entrainment by serum shock (i.e., in nadir of clock gene expression curve) could also result in an alteration of acrophase value. Circadian rhythms regulate various biological processes, and life itself, on several levels of its organ-
8.3 0.1 4.6 0.6 1.3 0.6 5.6 0.3 3.0 0.6 2.5 0.5 1.7 0.6 1.5 0.5 2.0 0.6 1.4 0.4 2.6 0.5 1.7 0.2* 1.1 0.3* 1.8 0.3* 1.3 0.3* 1.7 0.4 1.1 0.3 0.7 0.2 1.2 0.3 0.9 0.2
1.8 0.6 1.3 0.4 1.2 0.4 1.5 0.5 1.1 0.3
8.3 0.1 4.2 1.3 1.5 0.5 5.1 0.5 2.5 0.9 P < 0.05 (ELF-MF exposure VS. sham exposure)
24.2 0.3 24.4 0.3 24.1 1.5 24.7 0.3 25.0 0.8 24.2 0.2 24.3 0.8 24.5 0.6 24.8 0.2 25.2 0.5 BMAL1 PER2 PER3 CRY1 CRY2
*
ELF-MF exposure Sham exposure ELF-MF exposure Sham exposure
299
ization: subcellular and cellular (cell cycle, transcription factors’ activity oscillations), tissue and organ (oscillations in electrical activity of the brain, heartbeats), and organism (circadian rhythms) [Zaporozhan and Ponomarenko, 2010]. A large body of evidence has revealed that deregulation of clock genes is a crucial endogenous factor contributing to disease development [Schernhammer et al., 2001; Reppert and Weaver, 2002; Filipski et al., 2002; Fu et al., 2002; Takahashi et al., 2008; Zieker et al., 2010]. Recent studies demonstrated relationships between disturbance of rhythms in clock gene expression and development of diseases such as obesity, hypertension, type 2 diabetes, coronary heart disease, as well as cancer development [Tahira et al., 2011; Delezie and Challet, 2011; Evans and Davidson, 2013; Kelleher et al., 2014; Zhao et al., 2014]. Our findings evidenced that 50 Hz ELF-MF at 0.1 mT acted not only as a trigger in modulating expression of clock genes, but also altered oscillation of gene expression previously triggered by another synchronizer. These results indicate influence of ELFMF (0.1 mT, 50 Hz) on circadian clock gene expression according to in vitro evidence of the bioregulatory capabilities of ELF-MF reported in other studies [Czyz et al., 2004; Frahm et al., 2006; Mannerling et al., 2010; Markkanen et al., 2010; Luukkonen et al., 2011; Cocek et al., 2012; Luukkonen et al., 2014]. Therefore, it is our speculation that ELFMF may be able to affect circadian rhythmicity of many physiologic processes through a modulation in circadian clock gene expression. This in vitro study supports the hypothesis that the circadian clock pathway may act as a mediator between living beings and their physical environment.
*
ELF-MF exposure Sham exposure ELF-MF exposure Sham exposure
Acrophase (h) Mesor Amplitude Period (h)
TABLE 1. Results of Cosinor Analysis of mRNA Expression Profiles in Cells Entrained by Serum Shock Stimulation. Cells Were Exposed or Sham-Exposed to ELF-MF (0.1 mT, 50 Hz).
ELF-MF Modulates Clock Gene Expression
ACKNOWLEDGEMENT The authors thank Professor Valter Mariani Primiani for his contribution in technical equipment and Mrs. Megan Conner for her revision of the English language. REFERENCES Albrecht U, Sun ZS, Eichele G, Lee CC. 1997. A differential response of two putative mammalian circadian regulators, mper1 and mper2, to light. Cell 91:1055–1064. Artacho-Cordon F, Salinas-Asensio Mdel M, Calvente I, RıosArrabal S, Roman-Marinetto E, Olea N, Nu~nez MI. 2013. Could radiotherapy effectiveness be enhanced by electromagnetic field treatment? Int J Mol Sci 14: 14974–14995. Bioelectromagnetics
300
Manzella et al.
Balsalobre A, Damiola F, Schibler U. 1998. A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell 93:929–937. Balsalobre A, Brown SA, Marcacci L, Tronche F, Kellendonk C, Reichardt HM, Sch€utz G, Schibler U. 2000. Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science 289:2344–2347. Borgs L, Beukelaers P, Vandenbosch R, Belachew S, Nguyen L, Malgrange B. 2009. Cell “circadian” cycle: New role for mammalian core clock genes. Cell Cycle 8:832–837. Buijs R, Salgado R, Sabath E, Escobar C. 2013. Peripheral circadian oscillators: Time and food. Prog Mol Biol Transl Sci 119:83–103. Bułdak RJ, Polaniak R, Bułdak L, Zwirska-Korczala K, Skonieczna M, Monsiol A, Kukla M, Duława-Bułdak A, Birkner E. 2012. Short-term exposure to 50 Hz ELFEMF alters the cisplatin-induced oxidative response in AT478 murine squamous cell carcinoma cells. Bioelectromagnetics 33:641–651. Cocek A, Hahn A, Martonova J, Ambrus M, Dohnalova A, Nedbalova M, Jandova A. 2012. The impact of lower induction values of 50Hz external electromagnetic fields on in vitro T lymphocyte adherence capabilities. Electromagn Biol Med 31:166–177. Czyz J, Nikolova T, Schuderer J, Kuster N, Wobus AM. 2004. Non-thermal effects of power-line magnetic fields (50Hz) on gene expression levels of pluripotent embryonic stem cells-the role of tumour suppressor p53. Mutat Res 557: 63–74. De Mattei M, Caruso A, Traina GC, Pezzetti F, Baroni T, Sollazzo V. 1999. Correlation between pulsed electromagnetic fields exposure time and cell proliferation increase in human osteosarcoma cell lines and human normal osteoblast cells in vitro. Bioelectromagnetics 20:177–182. De Paula RM, Lamb TM, Bennett L, Bell-Pedersen D. 2008. A connection between MAPK pathways and circadian clocks. Cell Cycle 7:2630–2634. Delezie J, Challet E. 2011. Interactions between metabolism and circadian clocks: reciprocal disturbances. Ann N Y Acad Sci 1243:30–46. Dibirdik I, Kristupaitis D, Kurosaki T, Tuel-Ahlgren L, Chu A, Pond D, Tuong D, Luben R, Uckun FM. 1998. Stimulation of Src family protein-tyrosine kinases as a proximal and mandatory step for SYK kinase-dependent phospholipase Cg2 activation in lymphoma B cells exposed to low energy electromagnetic fields. J Biol Chem 273:4035–4039. Evans JA, Davidson AJ. 2013. Health consequences of circadian disruption in humans and animal models. Prog Mol Biol Transl Sci 119:283–323. Fatigoni C, Dominici L, Moretti M, Villarini M, Monarca S. 2005. Genotoxic effects of extremely low frequency (ELF) magnetic fields (MF) evaluated by the Tradescantiamicronucleus assay. Environ Toxicol 20:585–591. Frahm J, Lantow M, Lupke M, Weiss DG, Simko M. 2006. Alteration in cellular functions in mouse macrophages after exposure to 50Hz magnetic fields. J Cell Biochem 99:168–177. Filipski E, King VM, Li X, Granda TG, Mormont MC, Liu X, Claustrat B, Hastings MH, Levi F. 2002. Host circadian clock as a control point in tumor progression. J Natl Cancer Inst 94:690–697. Fu L, Pelicano H, Liu J, Huang P, Lee C. 2002. The circadian gene Period2 plays an important role in tumor suppression and DNA damage response in vivo. Cell 111:41–50.
Bioelectromagnetics
Gaddameedhi S, Selby CP, Kaufmann WK, Smart RC, Sancar A. 2011. Control of skin cancer by the circadian rhythm. Proc Natl Acad Sci USA 108:18790–18795. Harris PA, Lamb J, Heaton B, Wheatley DN. 2002. Possible attenuation of the G2 DNA damage cell cycle checkpoint in HeLa cells by extremely low frequency (ELF) electromagnetic fields. Cancer Cell Int 2:3. Hirota T, Fukada Y. 2004. Resetting mechanism of central and peripheral circadian clocks in mammals. Zoolog Sci 21:359–368. IARC. 2002. Non-ionizing radiation. Part 1: Static and extremely low-frequency (ELF) electric and magnetic fields. International Agency for Research on Cancer (IARC) Monogr Eval Carcinog Risks Hum 80:1–395. Kelleher FC, Rao A, Maguire A. 2014. Circadian molecular clocks and cancer. Cancer Lett 342:9–18. Korzh-Sleptsova IL, Lindstrom E, Mild KH, Berglund A, Lundgren E. 1995. Low frequency MFs increased inositol 1,4,5-trisphosphate levels in the Jurkat cell line. FEBS Lett 359:151–154. Kumlin T, Heikkinen P, Laitinen JT, Juutilainen J. 2005. Exposure to a 50-hz magnetic field induces a circadian rhythm in 6hydroxymelatonin sulfate excretion in mice. J Radiat Res 46:313–318. Lagroye I, Percherancier Y, Juutilainen J, De Gannes FP, Veyret B. 2011. ELF magnetic fields: animal studies, mechanisms of action. Prog Biophys Mol Biol 107:369–373. Lowrey PL, Takahashi JS. 2004. Mammalian circadian biology: Elucidating genome-wide levels of temporal organization. Annu Rev Genomics Hum Genet 5:407–441. Luukkonen J, Liimatainen A, H€oyt€o A, Juutilainen J, Naarala J. 2011. Pre-exposure to 50Hz magnetic fields modifies menadione-induced genotoxic effects in human SH-SY5Y neuroblastoma cells. PLoS One 6:e18021. Luukkonen J, Liimatainen A, Juutilainen J, Naarala J. 2014. Induction of genomic instability, oxidative processes, and mitochondrial activity by 50Hz magnetic fields in human SH-SY5Y neuroblastoma cells. Mutat Res Fundam Mol Mech Mutagen 760:33–41. Mannerling AC, Simko M, Mild KH, Mattsson MO. 2010. Effects of 50-Hz magnetic field exposure on superoxide radical anion formation and HSP70 induction in human K562 cells. Radiat Environ Biophys 49:731–741. Manzella N, Bracci M, Staffolani S, Strafella E, Rapisarda V, Valentino M, Amati M, Copertaro A, Santarelli L. 2013. Styrene altered clock gene expression in serumshocked cultured human fibroblasts. Biosci Biotechnol Biochem 77:1296–1298. Markkanen A, Naarala J, Juutilainen J. 2010. A study on the effects of 50Hz magnetic fields on UV-induced radical reactions in murine fibroblasts. J Radiat Res 51:609–613. Mattsson MO, Lindstrom E, Still M, Lindstrom P, Mild KH, Lundgren E. 2001. [Ca2þ] (i) rise in Jurkat E 6–1 cell lines from different sources as a response to 50 Hz magnetic field exposure is a reproducible effect and independent of poly-L-lysine treatment. Cell Biol Int 25:901–907. Oishi K, Sakamoto K, Okada T, Nagase T, Ishida N. 1998. Antiphase circadian expression between BMAL1 and period homologue mRNA in the suprachiasmatic nucleus and peripheral tissues of rats. Biochem Biophys Res Commun 253:199–203. Osland TM, Fernø J, Håvik B, Heuch I, Ruoff P, Lærum OD, Steen VM. 2011. Lithium differentially affects clock gene
ELF-MF Modulates Clock Gene Expression expression in serum-shocked NIH-3T3 cells. J Psychopharmacol 25:924–933. Polaniak R, Bułdak RJ, Karon M, Birkner K, Kukla M, Zwirska-Korczala K, Birkner E. 2010. Influence of an extremely low frequency magnetic field (ELF-EMF) on antioxidative vitamin E properties in AT478 murine squamous cell carcinoma culture in vitro. Int J Toxicol 29:221–230. Refinetti R, Lissen GC, Halberg F. 2007. Procedures for numerical analysis of circadian rhythms. Biol Rhythm Res 38:275– 325. Reppert SM, Weaver DR. 2002. Coordination of circadian timing in mammals. Nature 418:935–941. Sancar A, Lindsey-Boltz LA, Kang TH, Reardon JT, Lee JH, Ozturk N. 2010. Circadian clock control of the cellular response to DNA damage. FEBS Lett 584:2618–2625. Schernhammer ES, Laden F, Speizer FE, Willett WC, Hunter DJ, Kawachi I, Colditz GA. 2001. Rotating night shifts and risk of breast cancer in women participating in the nurses’ health study. J Natl Cancer Inst 93:1563–1568. Shi Y, Bao X, Huo X, Shen Z, Song T. 2005. 50-Hz magnetic field (0.1-mT) alters c-fos mRNA expression of early post implantation mouse embryos and serum estradiol levels of gravid mice. Birth Defects Res B Dev Reprod Toxicol 74:196–200. Silver R, LeSauter J, Tresco PA, Lehman MN. 1996. A diffusible coupling signal from the transplanted suprachiasmatic nucleus controlling circadian locomotor rhythms. Nature 382:810–813. Simko M, Kriehuber R, Weiss DG, Luben RA. 1998. Effects of 50Hz EMF exposure on micronucleus formation and apoptosis in transformed and nontransformed human cell lines. Bioelectromagnetics 19:85–91. Stam R. 2011. Comparison of International Policies on Electromagnetic Fields (Power Frequency and Radiofrequency Fields). Bilthoven, Netherlands: National Institute for Public Health and the Environment. pp 1-13. Stevens RG, Brainard GC, Blask DE, Lockley SW, Motta ME. 2014. Breast cancer and circadian disruption from electric lighting in the modern world. CA Cancer J Clin 64: 207–218. Tahira K, Ueno T, Fukuda N, Aoyama T, Tsunemi A, Matsumoto S, Nagura C, Matsumoto T, Soma M, Shimba S, Matsumoto Y. 2011. Obesity alters the expression profile of clock genes in peripheral blood mononuclear cells. Arch Med Sci 7:933–940.
301
Takahashi JS, Hong HK, Ko CH, McDearmon EL. 2008. The genetics of mammalian circadian order and disorder: implications for physiology and disease. Nat Rev Genet 9:764–775. Tiano L, Armeni T, Venditti E, Barucca G, Mincarelli L, Damiani E. 2010. Modified TiO(2) particles differentially affect human skin fibroblasts exposed to UVA light. Free Radic Biol Med 49:408–415. Uckun FM, Kurosaki T, Jin J, Jun X, Morgan A, Takata M, Bolen J, Luben RA. 1995. Exposure of B-lineage lymphoid cells to low energy electromagnetic fields stimulates Lyn kinase. J Biol Chem 270:27666–27670. Vanderstraeten J, Verschaeve L, Burda H, Bouland C, de Brouwer C. 2012. Health effects of extremely lowfrequency magnetic fields: reconsidering the melatonin hypothesis in the light of current data on magnetoreception. J Appl Toxicol 32:952–958. Welsh DK, Logothetis DE, Meister M, Reppert SM. 1995. Individual neurons dissociated from rat suprachiasmatic nucleus express independently phased circadian firing rhythms. Neuron 14:697–706. Wolf FI, Torsello A, Tedesco B, Fasanella S, Boninsegna A, D’Ascenzo M, Grassi C, Azzena GB, Cittadini A. 2005. 50Hz extremely low frequency electromagnetic fields enhance cell proliferation and DNA damage: Possible involvement of a redox mechanism. Biochim Biophys Acta 1743:120–129. Zaporozhan V, Ponomarenko A. 2010. Mechanisms of geomagnetic field influence on gene expression using influenza as a model system: basics of physical epidemiology. Int J Environ Res Public Health 7:938–965. Zhao H, Zeng ZL, Yang J, Jin Y, Qiu MZ, Hu XY, Han J, Liu KY, Liao JW, Xu RH, Zou QF. 2014. Prognostic relevance of Period1 (Per1) and Period2 (Per2) expression in human gastric cancer. Int J Clin Exp Pathol 7:619–630. Zieker D, Jenne I, Koenigsrainer I, Zdichavsky M, Nieselt K, Buck K, Zieker J, Beckert S, Glatzle J, Spanagel R, Koenigsrainer A, Northoff H, Loeffler M. 2010. Circadian expression of clock- and tumor suppressor genes in human oral mucosa. Cell Physiol Biochem 26:155–166. Zwirska-Korczala K, Jochem J, Adamczyk-Sowa M, Sowa P, Polaniak R, Birkner E, Latocha M, Pilc K, Suchanek R. 2005. Effect of extremely low frequency of electromagnetic fields on cell proliferation, antioxidative enzyme activities and lipid peroxidation in 3T3-L1 preadipocytes-an in vitro study. J Physiol Pharmacol 56:101–108.
Bioelectromagnetics
Circadian Gene Expression and Extremely Low-Frequency Magnetic Fields: An InVitro Study Nicola Manzella,1 Massimo Bracci,1* Veronica Ciarapica,1 Sara Staffolani,1 Elisabetta Strafella,1 Venerando Rapisarda,2 MatteoValentino,1 Monica Amati,1 Alfredo Copertaro,3 and Lory Santarelli1 1
Occupational Medicine, Department of Clinical and Molecular Sciences, Polytechnic University of Marche, Ancona, Italy 2 Section of Occupational Medicine, Department of Internal Medicine and Systemic Diseases, University of Catania, Catania, Italy 3 HealthcareWorkers Service, Azienda Sanitaria Unica Regionale (ASUR) Marche, Loreto Hospital, Loreto, Italy It is well known that circadian clocks are mainly regulated by light targeting signaling pathways in the hypothalamic suprachiasmatic nucleus. However, an entrainment mediated by nonphotic sensory stimuli was also suggested for peripheral clocks. Exposure to extremely low frequency (ELF) electromagnetic fields might affect circadian rhythmicity. The goal of this research was to investigate effects of ELF magnetic fields (ELF-MF) on circadian clock genes in a human fibroblast cell line. We found that an ELF-MF (0.1 mT, 50 Hz) exposure was capable of entraining expression of clock genes BMAL1, PER2, PER3, CRY1, and CRY2. Moreover, ELF-MF treatment induced an alteration in circadian clock gene expression previously entrained by serum shock stimulation. These results support the hypothesis that ELF-MF may be able to drive circadian physiologic processes by modulating peripheral clock gene expression. Bioelectromagnetics 36:294–301, 2015. © 2015 Wiley Periodicals, Inc. Key words: circadian rhythm; biological clock; ELF; fibroblasts; clock genes
INTRODUCTION Diffusion of extremely low frequency electromagnetic fields (ELF-EMF) in the human environment has raised the question of biological effects of EMF on mammalian cells. A large number of studies have reported an effect mediated by ELF-EMF exposure in mT range on processes such as cell proliferation, cell cycle regulation, cell differentiation, metabolism, and various physiological characteristics of cells [Simk o et al., 1998; De Mattei et al., 1999; Mattsson et al., 2001; Harris et al., 2002; Fatigoni et al., 2005; Wolf et al., 2005; Zwirska-Korczala et al., 2005; Polaniak et al., 2010]. However, a certain number of studies have investigated whether ELFEMF exposure at lower magnetic flux density could result in cell physiology change [Czyz et al., 2004; Shi et al., 2005; Frahm et al., 2006; Mannerling et al., 2010; Markkanen et al., 2010; Luukkonen et al., 2011; Cocek et al., 2012; Luukkonen et al., 2014] It is possible that certain cellular processes, altered by exposure to ELF-EMF, indirectly affect cell physiology [Bułdak et al., 2012; Artacho-Cordon 2015 Wiley Periodicals, Inc.
et al., 2013]. Vanderstraeten et al. [2012] hypothesized that ELF-MF contribution to alteration of cell physiological processes might stem from an alteration of circadian rhythmicity. Circadian rhythms are oscillations characterized by a period length of around 24 h [Reppert and Grant sponsor: The National (Italian) Institute for Occupational Injury Insurance (INAIL). Conflicts of interest: None Additional Supporting Information may be found in the online version of this article. *Correspondence to: Massimo Bracci, MD, PhD, Occupational Medicine, Department of Clinical and Molecular Sciences, Polytechnic University of Marche, Via Tronto 10/a, 60126 Torrette, Ancona, Italy. E-mail: [email protected] Received for review 5 August 2013; Accepted 6 March 2015 DOI: 10.1002/BEM.21915 Published online 22 March 2015 in Wiley Online Library (wileyonlinelibrary.com).
ELF-MF Modulates Clock Gene Expression
Weaver, 2002]. These endogenously generated rhythms persist in absence of external stimuli and are sustained by a molecular oscillator present in many cells and tissues throughout the organism. Intracellular clocks are regulated by a set of clock genes involved in an autoregulatory transcriptional–translational feedback loop [Reppert and Weaver, 2002; Lowrey and Takahashi, 2004]. In mammalians, the master clock and peripheral clocks work cooperatively [Silver et al., 1996; Hirota and Fukada, 2004]. The central clock is entrained mainly by lightdark cycles, while peripheral clocks can be regulated by nervous and humoral signals (such as glucocorticoids), daily feeding cycle and xenobiotic agents (such as lithium or styrene) exposure [Balsalobre et al., 2000; Osland et al., 2011; Buijs et al., 2013; Manzella et al., 2013; Stevens et al., 2014]. The circadian control system increases fitness and allows organisms to adapt to their physical and ecological environment controlling several biological processes such as proliferation, cell cycle control, and DNA damage repair [De Paula et al., 2008; Borgs et al., 2009; Sancar et al., 2010; Gaddameedhi et al., 2011]. Some alterations of cell physiological processes induced by ELF-EMF exposures might be mediated by modifications of biological clock machinery through variations of clock genes expression. In this paper, we investigated the hypothesis that extremely low frequency magnetic field (ELF-MF) could be associated with alterations of circadian rhythmicity [Vanderstraeten et al., 2012]. In particular we investigated whether an ELF-MF exposure at low magnetic flux density (0.1 mT) was capable of affecting circadian gene expression. MATERIALS AND METHODS ELF-MF Exposure Unit The ELF magnetic field exposure unit is shown in Figure 1. The unit was positioned into a waterjacketed temperature and atmosphere regulated incubator (37.0 0.1 8C and 5% CO2). The ferromagnetic core had a cross section of 4 5 cm2 with a relative magnetic permeability of 2000. It was equipped with two windings that consisted of 550 turns and inserted around the lateral columns. In the middle of the central column, there was a 4 cm air gap. Two windings were connected in series to enhance the field in the central gap, and they were fed by the main power supply line (frequency 50 Hz) through a voltage regulator (V-5 Belotti, Milano, Italy). This allowed for a current variance of 0–1.5 A. This was monitored by
295
Fig. 1. ELF-MF exposure unit schematization. Samples were placed at the center of ferromagnetic core during exposure.
a current meter (45 Fluke, Everett, WA). Magnetic flux density in the gap center was directly proportional to current flowing into the windings. Magnetic flux orientation is orthogonal to the culture flask placed horizontally in the air gap of the ferromagnetic core and it is uniform. A special resin that provided humidity and thermal protection covered the core and windings. This allowed for insertion of the exposing system inside the incubator to stabilize temperature and atmosphere. During calibration, a small loop (d ¼1 cm) (EMCO 7405-903B, EMC Hire, Bedfordshire, UK) was inserted into the gap and connected to a selective voltmeter (3581C Hewlett-Packard, Santa Clara, CA) to measure voltage, V induced by magnetic flux density, B. From induced voltage we can derive magnetic flux density amplitude value where f is frequency (50 Hz in the present study). B¼
2V p2 f d 2
The manufactured system is able to produce a magnetic flux density up to 30 mT for an applied current up to 1.5 A. During the test, the loop was Bioelectromagnetics
296
Manzella et al.
removed and replaced by the cell culture flask for exposure. Since magnetic flux density is orthogonal to the flask, and it is uniform, induced electric field is maximum to flask periphery and linearly drops to zero at the center. For B ¼ 0.1 mT, maximum induced electric field is 0.157 mV/m in our experiments. Cell Culture and ELF-MF Exposure HuDe (human dermal fibroblasts) were purchased from the Istituto Zooprofilattico Sperimentale (Brescia, Italy) [Tiano et al., 2010]. Presence of a molecular clock was previously demonstrated in HuDe cell line [Manzella et al., 2013]. Under standard culture conditions, HuDe cells were grown in monolayer in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Carlsbad, CA) supplemented with 10% heat-inactivated fetal bovine serum and 1% penicillin–streptomycin (Gibco). Two sets of experiments were performed to investigate involvement of ELF-MF exposure in modulation of clock gene expression. In vitro experiments were carried out using ELF-MF flux density of 0.1 mT at 50 Hz as this value represents current exposure limit for the general population in most European countries [Stam, 2011]. In the first set of experiments, HuDe cells were cultured with or without ELF-MF exposure. To this end, HuDe cells were plated out five days prior to the experiment and at confluence they were shifted to serum-free DMEM medium for 48 h. The experiment started (time zero) when cells were exposed to ELFMF (0.1 mT, 50 Hz) generated by the exposure unit positioned into a water-jacketed temperature and atmosphere regulated incubator (37.0 0.1 8C and 5% CO2) for 1 h, then treatment was interrupted and cells cultured without ELF-MF exposure and collected at regular intervals time (1 h, 2 h, 3 h, 4 h, 8 h, 12 h, 16 h, 24 h, 28 h, 32 h, 36 h, 40 h, and 48 h from time zero). Control cells were sham-exposed in another incubator and subjected to the exact same procedures as experimental cells but without receiving any ELF-MF exposure. The control incubator consisted of an electric oven, where electric resistors on the walls produced an average of residual magnetic flux density of 5 mT. In the second set of experiments, the ability of ELF-MF exposure to alter gene oscillation previously entrained by serum shock stimulation was tested. The serum shock approach was a validated procedure used to induce clock gene expression [Balsalobre et al., 1998; Osland et al., 2011; Manzella et al., 2013]. Cells were starved for 48 h and then stimulated with a serum-rich medium (50% DMEM and 50% fetal bovine serum) for 2 h. Subsequently, after washing with DMEM (without serum), cells were cultured in serum-free DMEM under exposure to ELFBioelectromagnetics
MF (0.1 mT, 50 Hz), generated by the exposure unit positioned into a water-jacketed temperature and atmosphere regulated incubator (37.0 0.1 8C and 5% CO2) and harvested after 3 h, 4 h, 8 h, 12 h, 16 h, 24 h, 28 h, 32 h, 36 h, 40 h, and 48 h from start of serum shock. A second batch of fibroblasts were prepared as control for this experiment. These cells were shamexposed in another incubator and subjected to the exact same procedures as experimental cells but without ELF-MF exposure. In both experimental sets, cells were stored in the dark, only briefly exposed to visible light during experimental procedures, to avoid visible light influence. Each set of experiments was repeated three times. All experiments were performed in a blinded fashion by two independent investigators. Expression of Clock Genes Total RNA was extracted (OriGene, Rockville, MD) and checked for quantity and quality with Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE). The RNA was reverse transcribed in cDNA (Applied Biosystems, Foster City, CA), and real-time PCR was performed with Mastercycler ep Realplex (Eppendorf, Hamburg, Germany) using taqMan Gene Expression Master Mix (Applied Biosystems). Specific primer sets (BMAL1, PER2, PER3, CRY1, and CRY2) were obtained from IDT (Integrated DBA Technologies, Coralville, IA). To control variations of cDNA amount available for PCR in various samples, gene expression levels of the target sequences were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAP DH). The Forward (F) and Reverse (R) primer sequence 5’-3’ were: F: CTGTTCATTTTATCCCGACGC and R: TCCACTGACTACCAAGAAAGC for BMAL1; F: TGTTCCACAGTTTCACCTCC and R: TGGTAGCGGATTTCATTCTCG for PER2; F: TGTGTTCTGAAGCGATAGTGG and R: GATGC CCTCAACTATGCTCTC for PER3; F: TTAATAGCTGCGTCGTTCC and R: TCCCGTCT GTTTGTGATTCG for CRY1; F: GTCATATTCAAA GGTCAAGCGG and R: CATGGTTCCTACTTCAGTCTCTG for CRY2; F: GGCCATCCACAGTC TTCTG and R: CAGCCTCAAGATCATCAGCAA for GAPDH. The fold change value was calculated for each time point. Three independent replicates were conducted for each run of Real-Time PCR. Statistical Analysis Results are presented as mean SD. Twoway repeated measures analysis of variance (ANOVA) and Mann-Whitney test were performed according to
ELF-MF Modulates Clock Gene Expression
the number of group comparisons. Oscillation of gene expression was analyzed by cosinor analysis using Cosinor.exe v.2.3 (Roberto Refinetti, University of South Carolina, Salkehatchie, SC) [Refinetti et al., 2007]. Changes at the level of significance of P < 0.05 were assumed to be statistically significant. Statistical analysis was performed by SPSS software (SPSS, Chicago, IL). RESULTS ELF-MF Exposure Induces Clock Gene Expression Results showed that under starvation condition no significant oscillation of clock gene expression was found in sham-exposed samples (Fig. 2). A 1 h ELF-MF exposure induced a significant circadian variation of clock gene expression with a peak after 8 h and 32–36 h following treatment (repeated measures ANOVA analysis, P < 0.05) in 48 h observation period. All clock gene expression followed a similar curve of oscillation. Circadian cycle amplitudes decreased from the first to second cycle during observation period of 48 h. A robust 24 h oscillation of gene expression was found for ELF-MF exposed cells (cosinor analysis, P < 0.05; robustness > 90%). ELF-MF Exposure Alters Clock Gene Expression Entrained by Serum Shock Two-way ANOVA analysis revealed significant effects of time and ELF-MF treatment
297
(P < 0.05) on gene expression. A significant variation of expression of clock genes examined (repeated measures ANOVA analysis, P < 0.05) was observed after serum shock approach (Fig. 3) in both sham-exposed and ELF-MF exposed cells compared to starved cells without an entrainment by serum shock. Amplitude of the circadian cycles decreased from the first to second cycle during the observation period of 48 h. In serum-shocked shamexposed cells, among positive regulatory components of circadian transcriptional complex, a peak in BMAL1 mRNA expression was observed at 8 h and 32 h; while in the negative arm of circadian complex, the peak of transcription was at 3 h (PER2, PER3, and CRY2), at 4 h (CRY1), at 24 h (PER3), and at 28 h (PER2,CRY1, CRY2). Exposure of 0.1 mT, 50 Hz ELF-MF did not alter oscillation observed in serum-shocked cells, but did result in a significant upregulation of the expression of BMAL1, PER2, PER3, CRY1, and CRY2 over time in cells previously entrained with serum (P < 0.05, Fig. 3). Results of cosinor analysis confirmed a significant 24 h cyclic component for all clock genes (P < 0.05). Cosinor analysis confirmed upregulation by ELF-MF of BMAL1, PER2, CRY1, and CRY2, as amplitude was significantly increased after ELFMF treatment compared to sham-exposed samples (P < 0.05). No difference was found in the mesor, acrophase and period values between ELF-MF and sham-exposed cells (Table 1).
Fig. 2. Profiles (24 h) of mRNA expression in ELF-MF exposed or sham-exposed cells. At t ¼ 0 h ELF-MF (0.1mT, 50 Hz) treatment was given; at t ¼1h, ELF-MF treatment was interrupted. Bioelectromagnetics
298
Manzella et al.
Fig. 3. Profiles (24 h) of mRNA expression in ELF-MF exposed or sham-exposed cells, after serum shock stimulation. At t ¼ 0 h serum shock was given; at t ¼ 2 h, cells were exposed (hollow symbols), or sham-exposed (solid symbols) to ELF-MF (0.1mT, 50 Hz).
DISCUSSION Although a number of reports have been published regarding biological effects caused by ELFEMF (50/60 Hz) [IARC, 2002; Lagroye et al., 2011], there is still need for more basic research in this area in particular for ELF-EMF exposures at lower magnetic flux density, since knowledge of underlying molecular mechanisms will shed light on potential health risks. Recently, a role for ELF-MF exposure in altering circadian rhythmicity was proposed to explain interaction of ELF-MF with a number of biological processes [Vanderstraeten et al., 2012]. Kumlin et al. [2005] reported an exposure to 50Hz 0.1 mT ELF-MF seemed to cause a rhythm in the 6hydroxymelatonin sulfate excretion in mice by enhancing sensitivity of the pineal gland to circadian light rhythm. It was hypothesized that MF signal goes to the pineal gland through the eyes, then stimulates pineal cells so they are more receptive to signals from the biological clock. Potential involvement of ELF-MF on circadian gene expression can be further supported by evidence of the role of EMF in regulation of calcium fluxes and PKC enzyme, which are known as modulators of clock gene expression [Korzh-Sleptsova et al., 1995; Uckun et al., 1995; Dibirdik et al., 1998]. It was well demonstrated that clock genes play a pivotal role in many cell processes regulation and are not specifically expressed in suprachiasmatic nucleus but are widely Bioelectromagnetics
distributed [Welsh et al., 1995; Albrecht et al., 1997; Oishi et al., 1998; Balsalobre et al., 1998; Manzella et al., 2013]. In this study, we investigated whether ELFMF exposure at 0.1 mT and 50 Hz was capable of influencing clock gene expression in a fibroblast cell line (HuDe). To do so, we first investigated the effect of 1 h ELF-MF exposure on clock gene expression. Compared to sham-exposed cells, ELF-MF exposed cells showed a significant variation in clock gene expression during the 48 h observation period. Circadian cycle amplitude decreased from the first to second cycle during observation period of 48 h. It is likely, that ELF-MF induced clock gene expression could be attenuated because of a gradual loss of entraining effect mediated by ELF-MF. Next, we investigated the ability of ELFMF exposure to alter gene oscillation previously entrained by serum shock stimulation. Our findings demonstrated that ELF-MF exposure altered serum shock-induced clock gene expression with significant effects on the increase of amplitude of circadian oscillation. No effect of ELF-MF exposure on acrophase value was observed in our study; however, ELFMF stimulation in a phase of gene clock oscillation different from start of entrainment by serum shock (i.e., in nadir of clock gene expression curve) could also result in an alteration of acrophase value. Circadian rhythms regulate various biological processes, and life itself, on several levels of its organ-
8.3 0.1 4.6 0.6 1.3 0.6 5.6 0.3 3.0 0.6 2.5 0.5 1.7 0.6 1.5 0.5 2.0 0.6 1.4 0.4 2.6 0.5 1.7 0.2* 1.1 0.3* 1.8 0.3* 1.3 0.3* 1.7 0.4 1.1 0.3 0.7 0.2 1.2 0.3 0.9 0.2
1.8 0.6 1.3 0.4 1.2 0.4 1.5 0.5 1.1 0.3
8.3 0.1 4.2 1.3 1.5 0.5 5.1 0.5 2.5 0.9 P < 0.05 (ELF-MF exposure VS. sham exposure)
24.2 0.3 24.4 0.3 24.1 1.5 24.7 0.3 25.0 0.8 24.2 0.2 24.3 0.8 24.5 0.6 24.8 0.2 25.2 0.5 BMAL1 PER2 PER3 CRY1 CRY2
*
ELF-MF exposure Sham exposure ELF-MF exposure Sham exposure
299
ization: subcellular and cellular (cell cycle, transcription factors’ activity oscillations), tissue and organ (oscillations in electrical activity of the brain, heartbeats), and organism (circadian rhythms) [Zaporozhan and Ponomarenko, 2010]. A large body of evidence has revealed that deregulation of clock genes is a crucial endogenous factor contributing to disease development [Schernhammer et al., 2001; Reppert and Weaver, 2002; Filipski et al., 2002; Fu et al., 2002; Takahashi et al., 2008; Zieker et al., 2010]. Recent studies demonstrated relationships between disturbance of rhythms in clock gene expression and development of diseases such as obesity, hypertension, type 2 diabetes, coronary heart disease, as well as cancer development [Tahira et al., 2011; Delezie and Challet, 2011; Evans and Davidson, 2013; Kelleher et al., 2014; Zhao et al., 2014]. Our findings evidenced that 50 Hz ELF-MF at 0.1 mT acted not only as a trigger in modulating expression of clock genes, but also altered oscillation of gene expression previously triggered by another synchronizer. These results indicate influence of ELFMF (0.1 mT, 50 Hz) on circadian clock gene expression according to in vitro evidence of the bioregulatory capabilities of ELF-MF reported in other studies [Czyz et al., 2004; Frahm et al., 2006; Mannerling et al., 2010; Markkanen et al., 2010; Luukkonen et al., 2011; Cocek et al., 2012; Luukkonen et al., 2014]. Therefore, it is our speculation that ELFMF may be able to affect circadian rhythmicity of many physiologic processes through a modulation in circadian clock gene expression. This in vitro study supports the hypothesis that the circadian clock pathway may act as a mediator between living beings and their physical environment.
*
ELF-MF exposure Sham exposure ELF-MF exposure Sham exposure
Acrophase (h) Mesor Amplitude Period (h)
TABLE 1. Results of Cosinor Analysis of mRNA Expression Profiles in Cells Entrained by Serum Shock Stimulation. Cells Were Exposed or Sham-Exposed to ELF-MF (0.1 mT, 50 Hz).
ELF-MF Modulates Clock Gene Expression
ACKNOWLEDGEMENT The authors thank Professor Valter Mariani Primiani for his contribution in technical equipment and Mrs. Megan Conner for her revision of the English language. REFERENCES Albrecht U, Sun ZS, Eichele G, Lee CC. 1997. A differential response of two putative mammalian circadian regulators, mper1 and mper2, to light. Cell 91:1055–1064. Artacho-Cordon F, Salinas-Asensio Mdel M, Calvente I, RıosArrabal S, Roman-Marinetto E, Olea N, Nu~nez MI. 2013. Could radiotherapy effectiveness be enhanced by electromagnetic field treatment? Int J Mol Sci 14: 14974–14995. Bioelectromagnetics
300
Manzella et al.
Balsalobre A, Damiola F, Schibler U. 1998. A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell 93:929–937. Balsalobre A, Brown SA, Marcacci L, Tronche F, Kellendonk C, Reichardt HM, Sch€utz G, Schibler U. 2000. Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science 289:2344–2347. Borgs L, Beukelaers P, Vandenbosch R, Belachew S, Nguyen L, Malgrange B. 2009. Cell “circadian” cycle: New role for mammalian core clock genes. Cell Cycle 8:832–837. Buijs R, Salgado R, Sabath E, Escobar C. 2013. Peripheral circadian oscillators: Time and food. Prog Mol Biol Transl Sci 119:83–103. Bułdak RJ, Polaniak R, Bułdak L, Zwirska-Korczala K, Skonieczna M, Monsiol A, Kukla M, Duława-Bułdak A, Birkner E. 2012. Short-term exposure to 50 Hz ELFEMF alters the cisplatin-induced oxidative response in AT478 murine squamous cell carcinoma cells. Bioelectromagnetics 33:641–651. Cocek A, Hahn A, Martonova J, Ambrus M, Dohnalova A, Nedbalova M, Jandova A. 2012. The impact of lower induction values of 50Hz external electromagnetic fields on in vitro T lymphocyte adherence capabilities. Electromagn Biol Med 31:166–177. Czyz J, Nikolova T, Schuderer J, Kuster N, Wobus AM. 2004. Non-thermal effects of power-line magnetic fields (50Hz) on gene expression levels of pluripotent embryonic stem cells-the role of tumour suppressor p53. Mutat Res 557: 63–74. De Mattei M, Caruso A, Traina GC, Pezzetti F, Baroni T, Sollazzo V. 1999. Correlation between pulsed electromagnetic fields exposure time and cell proliferation increase in human osteosarcoma cell lines and human normal osteoblast cells in vitro. Bioelectromagnetics 20:177–182. De Paula RM, Lamb TM, Bennett L, Bell-Pedersen D. 2008. A connection between MAPK pathways and circadian clocks. Cell Cycle 7:2630–2634. Delezie J, Challet E. 2011. Interactions between metabolism and circadian clocks: reciprocal disturbances. Ann N Y Acad Sci 1243:30–46. Dibirdik I, Kristupaitis D, Kurosaki T, Tuel-Ahlgren L, Chu A, Pond D, Tuong D, Luben R, Uckun FM. 1998. Stimulation of Src family protein-tyrosine kinases as a proximal and mandatory step for SYK kinase-dependent phospholipase Cg2 activation in lymphoma B cells exposed to low energy electromagnetic fields. J Biol Chem 273:4035–4039. Evans JA, Davidson AJ. 2013. Health consequences of circadian disruption in humans and animal models. Prog Mol Biol Transl Sci 119:283–323. Fatigoni C, Dominici L, Moretti M, Villarini M, Monarca S. 2005. Genotoxic effects of extremely low frequency (ELF) magnetic fields (MF) evaluated by the Tradescantiamicronucleus assay. Environ Toxicol 20:585–591. Frahm J, Lantow M, Lupke M, Weiss DG, Simko M. 2006. Alteration in cellular functions in mouse macrophages after exposure to 50Hz magnetic fields. J Cell Biochem 99:168–177. Filipski E, King VM, Li X, Granda TG, Mormont MC, Liu X, Claustrat B, Hastings MH, Levi F. 2002. Host circadian clock as a control point in tumor progression. J Natl Cancer Inst 94:690–697. Fu L, Pelicano H, Liu J, Huang P, Lee C. 2002. The circadian gene Period2 plays an important role in tumor suppression and DNA damage response in vivo. Cell 111:41–50.
Bioelectromagnetics
Gaddameedhi S, Selby CP, Kaufmann WK, Smart RC, Sancar A. 2011. Control of skin cancer by the circadian rhythm. Proc Natl Acad Sci USA 108:18790–18795. Harris PA, Lamb J, Heaton B, Wheatley DN. 2002. Possible attenuation of the G2 DNA damage cell cycle checkpoint in HeLa cells by extremely low frequency (ELF) electromagnetic fields. Cancer Cell Int 2:3. Hirota T, Fukada Y. 2004. Resetting mechanism of central and peripheral circadian clocks in mammals. Zoolog Sci 21:359–368. IARC. 2002. Non-ionizing radiation. Part 1: Static and extremely low-frequency (ELF) electric and magnetic fields. International Agency for Research on Cancer (IARC) Monogr Eval Carcinog Risks Hum 80:1–395. Kelleher FC, Rao A, Maguire A. 2014. Circadian molecular clocks and cancer. Cancer Lett 342:9–18. Korzh-Sleptsova IL, Lindstrom E, Mild KH, Berglund A, Lundgren E. 1995. Low frequency MFs increased inositol 1,4,5-trisphosphate levels in the Jurkat cell line. FEBS Lett 359:151–154. Kumlin T, Heikkinen P, Laitinen JT, Juutilainen J. 2005. Exposure to a 50-hz magnetic field induces a circadian rhythm in 6hydroxymelatonin sulfate excretion in mice. J Radiat Res 46:313–318. Lagroye I, Percherancier Y, Juutilainen J, De Gannes FP, Veyret B. 2011. ELF magnetic fields: animal studies, mechanisms of action. Prog Biophys Mol Biol 107:369–373. Lowrey PL, Takahashi JS. 2004. Mammalian circadian biology: Elucidating genome-wide levels of temporal organization. Annu Rev Genomics Hum Genet 5:407–441. Luukkonen J, Liimatainen A, H€oyt€o A, Juutilainen J, Naarala J. 2011. Pre-exposure to 50Hz magnetic fields modifies menadione-induced genotoxic effects in human SH-SY5Y neuroblastoma cells. PLoS One 6:e18021. Luukkonen J, Liimatainen A, Juutilainen J, Naarala J. 2014. Induction of genomic instability, oxidative processes, and mitochondrial activity by 50Hz magnetic fields in human SH-SY5Y neuroblastoma cells. Mutat Res Fundam Mol Mech Mutagen 760:33–41. Mannerling AC, Simko M, Mild KH, Mattsson MO. 2010. Effects of 50-Hz magnetic field exposure on superoxide radical anion formation and HSP70 induction in human K562 cells. Radiat Environ Biophys 49:731–741. Manzella N, Bracci M, Staffolani S, Strafella E, Rapisarda V, Valentino M, Amati M, Copertaro A, Santarelli L. 2013. Styrene altered clock gene expression in serumshocked cultured human fibroblasts. Biosci Biotechnol Biochem 77:1296–1298. Markkanen A, Naarala J, Juutilainen J. 2010. A study on the effects of 50Hz magnetic fields on UV-induced radical reactions in murine fibroblasts. J Radiat Res 51:609–613. Mattsson MO, Lindstrom E, Still M, Lindstrom P, Mild KH, Lundgren E. 2001. [Ca2þ] (i) rise in Jurkat E 6–1 cell lines from different sources as a response to 50 Hz magnetic field exposure is a reproducible effect and independent of poly-L-lysine treatment. Cell Biol Int 25:901–907. Oishi K, Sakamoto K, Okada T, Nagase T, Ishida N. 1998. Antiphase circadian expression between BMAL1 and period homologue mRNA in the suprachiasmatic nucleus and peripheral tissues of rats. Biochem Biophys Res Commun 253:199–203. Osland TM, Fernø J, Håvik B, Heuch I, Ruoff P, Lærum OD, Steen VM. 2011. Lithium differentially affects clock gene
ELF-MF Modulates Clock Gene Expression expression in serum-shocked NIH-3T3 cells. J Psychopharmacol 25:924–933. Polaniak R, Bułdak RJ, Karon M, Birkner K, Kukla M, Zwirska-Korczala K, Birkner E. 2010. Influence of an extremely low frequency magnetic field (ELF-EMF) on antioxidative vitamin E properties in AT478 murine squamous cell carcinoma culture in vitro. Int J Toxicol 29:221–230. Refinetti R, Lissen GC, Halberg F. 2007. Procedures for numerical analysis of circadian rhythms. Biol Rhythm Res 38:275– 325. Reppert SM, Weaver DR. 2002. Coordination of circadian timing in mammals. Nature 418:935–941. Sancar A, Lindsey-Boltz LA, Kang TH, Reardon JT, Lee JH, Ozturk N. 2010. Circadian clock control of the cellular response to DNA damage. FEBS Lett 584:2618–2625. Schernhammer ES, Laden F, Speizer FE, Willett WC, Hunter DJ, Kawachi I, Colditz GA. 2001. Rotating night shifts and risk of breast cancer in women participating in the nurses’ health study. J Natl Cancer Inst 93:1563–1568. Shi Y, Bao X, Huo X, Shen Z, Song T. 2005. 50-Hz magnetic field (0.1-mT) alters c-fos mRNA expression of early post implantation mouse embryos and serum estradiol levels of gravid mice. Birth Defects Res B Dev Reprod Toxicol 74:196–200. Silver R, LeSauter J, Tresco PA, Lehman MN. 1996. A diffusible coupling signal from the transplanted suprachiasmatic nucleus controlling circadian locomotor rhythms. Nature 382:810–813. Simko M, Kriehuber R, Weiss DG, Luben RA. 1998. Effects of 50Hz EMF exposure on micronucleus formation and apoptosis in transformed and nontransformed human cell lines. Bioelectromagnetics 19:85–91. Stam R. 2011. Comparison of International Policies on Electromagnetic Fields (Power Frequency and Radiofrequency Fields). Bilthoven, Netherlands: National Institute for Public Health and the Environment. pp 1-13. Stevens RG, Brainard GC, Blask DE, Lockley SW, Motta ME. 2014. Breast cancer and circadian disruption from electric lighting in the modern world. CA Cancer J Clin 64: 207–218. Tahira K, Ueno T, Fukuda N, Aoyama T, Tsunemi A, Matsumoto S, Nagura C, Matsumoto T, Soma M, Shimba S, Matsumoto Y. 2011. Obesity alters the expression profile of clock genes in peripheral blood mononuclear cells. Arch Med Sci 7:933–940.
301
Takahashi JS, Hong HK, Ko CH, McDearmon EL. 2008. The genetics of mammalian circadian order and disorder: implications for physiology and disease. Nat Rev Genet 9:764–775. Tiano L, Armeni T, Venditti E, Barucca G, Mincarelli L, Damiani E. 2010. Modified TiO(2) particles differentially affect human skin fibroblasts exposed to UVA light. Free Radic Biol Med 49:408–415. Uckun FM, Kurosaki T, Jin J, Jun X, Morgan A, Takata M, Bolen J, Luben RA. 1995. Exposure of B-lineage lymphoid cells to low energy electromagnetic fields stimulates Lyn kinase. J Biol Chem 270:27666–27670. Vanderstraeten J, Verschaeve L, Burda H, Bouland C, de Brouwer C. 2012. Health effects of extremely lowfrequency magnetic fields: reconsidering the melatonin hypothesis in the light of current data on magnetoreception. J Appl Toxicol 32:952–958. Welsh DK, Logothetis DE, Meister M, Reppert SM. 1995. Individual neurons dissociated from rat suprachiasmatic nucleus express independently phased circadian firing rhythms. Neuron 14:697–706. Wolf FI, Torsello A, Tedesco B, Fasanella S, Boninsegna A, D’Ascenzo M, Grassi C, Azzena GB, Cittadini A. 2005. 50Hz extremely low frequency electromagnetic fields enhance cell proliferation and DNA damage: Possible involvement of a redox mechanism. Biochim Biophys Acta 1743:120–129. Zaporozhan V, Ponomarenko A. 2010. Mechanisms of geomagnetic field influence on gene expression using influenza as a model system: basics of physical epidemiology. Int J Environ Res Public Health 7:938–965. Zhao H, Zeng ZL, Yang J, Jin Y, Qiu MZ, Hu XY, Han J, Liu KY, Liao JW, Xu RH, Zou QF. 2014. Prognostic relevance of Period1 (Per1) and Period2 (Per2) expression in human gastric cancer. Int J Clin Exp Pathol 7:619–630. Zieker D, Jenne I, Koenigsrainer I, Zdichavsky M, Nieselt K, Buck K, Zieker J, Beckert S, Glatzle J, Spanagel R, Koenigsrainer A, Northoff H, Loeffler M. 2010. Circadian expression of clock- and tumor suppressor genes in human oral mucosa. Cell Physiol Biochem 26:155–166. Zwirska-Korczala K, Jochem J, Adamczyk-Sowa M, Sowa P, Polaniak R, Birkner E, Latocha M, Pilc K, Suchanek R. 2005. Effect of extremely low frequency of electromagnetic fields on cell proliferation, antioxidative enzyme activities and lipid peroxidation in 3T3-L1 preadipocytes-an in vitro study. J Physiol Pharmacol 56:101–108.
Bioelectromagnetics
