Planta

Planta (1989) 178:69-75

9 Springer-Verlag 1989

Chloroplast gene expression in lettuce grown under different irradiances Brian R. Jordan 1 *, John G. Hopley 1, and William F. Thompson / 1 AFRC Institute of Horticultural Research, Littlehampton, Department of Biochemistry and Molecular Biology, Worthing Road, Littlehampton, West Sussex, BN17 6LP, UK and 2 North Carolina State University, Departments of Botany and Genetics, Raleigh, NC 27695, USA

Abstract. Chloroplast D N A sequences have been used as hybridisation probes to measure the levels of R N A transcripts present in low- and high-lightgrown lettuce (Lactuca sativa L.) plants. The transcript levels for rbc L, psa A, psb A and r D N A are not different between these two light regimes. In contrast, transcript levels for atp BE and pet BD are increased in high-light as a proportion of the chloroplast RNA. Three days after transfer from low-light into high-light, increased transcript levels were found for atp BE, although no change was detected for the psa A or psb A transcripts. In addition, young plants in high-light contain twofold more chloroplast R N A per unit chlorophyll than do low-light plants of equivalent age. Therefore, in these young high-light plants the absolute transcript levels per unit chlorophyll are much greater. With increasing leaf age the R N A per chlorophyll becomes similar for both light conditions. These results are discussed in relation to the photoregulation of chloroplast-encoded gene expression. Key words: Chloroplast D N A - Gene expression (light) - Lactuca - Light and gene expression Plastome copy number - R N A transcripts

Introduction

The net photosynthetic capacity and the light-saturated rate of photosynthesis are lower in both lowlight-grown plants and shade-adapted plants compared to equivalent plants grown in high-light or those that are sun-adapted (Boardman 1977; Bjorkman 1981). These differences are the conse* To whom correspondence should be addressed

quence of a large number of changes in the composition and organisation of the photosynthetic apparatus (Lichtenthaler et al. 1981) and enable the plant to make the most efficient use of the awLilable quantum flux (Anderson 1982, 1986). The changes in chloroplast composition have been described as "long-term" photoregulation (Anderson 19:86) in which the relative proportions of reaction-centre polypeptides, chlorophyll proteins, electron-transport components, ATP synthase, stromal enzymes, etc., are different according to the growth irradiance of the plants. The establishment of these alterations is a complex co-ordination of synthesis, degradation and assembly of the components and photoregulation may be effective at a number of levels. Our understanding of this regulation must also take into account differences in gene expression between species and the stage of leaf development at which the light environment is changed. The synthesis of chloroplast polypeptides is directed by genes located in the nuclear and chloroplast genomes, many of which are light-regalated (for reviews and discussion see Thompson et al. 1985; Tobin and Silverthorne 1985; Jordan et al. 1986b). In the majority of studies dark-grown seedlings exposed to white light or to various lightquality regimes have been used. These approaches have established that for nuclear-coded components, such as the chlorophyll a/b-binding protein and the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, photoregulation is mediated through the phytochrome system and control resides at the level of transcription (see Jordan et al. 1986a for a discussion of the role of phytochrome in gene expression). Expression of specific chloroplast-encoded genes can also be affected by light during greening (e.g., Rodermel and Bogorad 1985). However, some responses may arise primarily from more general effects such as increases in

70

B.R. Jordan et al. : The effect of irradiance on chloroplast transcripts

plastome number and-or overall transcriptional activity, rather than from gene-specific transcriptional regulation (Thompson et al. 1983; Deng and Gruissem 1987; Mullet and Klein 1987; Thompson 1988). Furthermore, for some chloroplast genes, light exposure causes only a transient increase in transcript levels followed by a return to the amounts present in dark tissue (Rodermel and Bogorad 1985). It is apparent from these studies that the photoregulation of chloroplast-encoded gene expression is not understood fully. In contrast to the extensive studies on the photoregulation of gene expression during greening, there have been few studies on fully green mature tissue grown under different irradiances. In the present study we have used chloroplast DNA sequences as hybridisation probes to investigate the levels of RNA transcripts present in chloroplasts isolated from fully green lettuce plants grown under high or low irradiance and transferred between the two light regimes.

Material and methods Plant material and chloroplast preparations. Lettuce plants (Lactuca sativa L. cv. Celtuce) were grown for periods of 19-44 d in controlled-environment cabinets at 20 ~ C, relative humidity 70% and daylength of 12 h. Incident irradiation was provided by cool-white fluorescent lamps at an irradiance of either 20 W. m -2 (low-light) or 80 W . m -2 (high-light) over a wavelength range of 400-700 nm. Chlorophyll was determined by 80%acetone extraction (Arnon 1949) of leaf discs and calculated per leaf area and fresh weight. Chloroplasts were isolated from leaf tissue on days 19, 24, 30, 37 and 44 throughout the experimental period and a minimum of three preparations made for each time point. The chloroplasts were prepared by homogenisation of leaf tissue in an ice-cold slurry of 330 mM sorbitol, 2 mM MgClz, 1 mM ethylenediaminetetraacetic acid (EDTA), 0.1% (v/v) mercaptoethanol and 10raM N-[2-hydroxy-l,1bis(hydroxymethyl)ethyl]glycine (Tricine)-KOH; pH 7.9. The homogenate was filtered twice through Miracloth (Calbiochem, San Diego, Cal., USA) and centrifuged at 3500-g for 1 min. The pellet was resuspended in 330 mM sorbitol, 1 m M MgCI2, 1 m M MnClz, 2 m M EDTA, 5 0 m M Tricine-KOH; pH 7.9, and overlayed onto a 40% (v/v) Percoll medium in 330 mM sorbitol, 1 m M MgClz and 10 m M Tricine-KOH; pH 7.9. After centrifugation for 6 min at 3000.g in a Sorvall HB-4 rotor (Du Pont, Stevenage, Herts., UK) the intact chloroplasts were resuspended in the same resuspension medium and chlorophyll determinations made by the method of Arnon (1949). Chloroplast numbers were determined in samples of equivalent chlorophyll concentration using a haemocytometer.

Purification and electrophoresis of RNA. The R N A was purified from intact chloroplasts by the methods of Thompson et al. (1983). Samples were homogenised with an Ultra-turrax blender (Sartorius Instruments, Belmont, Surrey, UK) in an equal volume of buffer and phenol-chloroform reagent (1 : 1, v/v). The phenol contained 0.1% (w/v) hydroxyquinoline and was saturated with 50 m M 2-amino-2-(hydroxymethyl)-l,3-propanediol (Tris)-HC1; pH 8.0, and the buffer contained 50 mM Tris-HC1;

pH 8.0, 4% (w/v)p-amino-salycilate (PAS), t % (w/v) triisopropylnaphthalene sulfonic acid (TNS, sodium salt), 2% (v/v) mercaptoethanol and 1 mM aurintricarboxylic acid (ATA). The homogenate was partitioned by centrifugation at 6000.g for 12 rain and the aqueous phase subjected to a second phenol extraction. The R N A was then precipitated with 2.0 M LiC1 at 4 ~ C overnight, resuspended in 10 mM Tris-HCl (pH 7.5), 2.5 mM E D T A and reprecipitated with LiC1. The final R N A pellet was washed twice with 76% ethanol containing 0.2 M sodium acetate and dissolved in water. The R N A solution was quantified by UV absorbance at 260 nm before storage at - 7 0 ~ C. The R N A preparations were separated by denaturing electrophoresis in 1.2% (w/v) agarose gels containing formaldehyde (Maniatis et al. 1982) and electrophoretically transferred in 25 mM sodium phosphate, pH 6.5, to nylon Hybond-N (Amersham International, Amersham, Bucks., UK) using a semi-dry electroblotter (Sartorius Instruments) at 200 mA for 1-2 h.

Chloroplast DNA sequences. A full description of the D N A sequences used as probes is given in Thompson et al. (1983) and Woodbury et al. (1988). The psb A sequence for the 32kilodalton (kDa), herbicide-binding DI protein is a 850-basepairs (bp) Hind III fragment containing the 3' 60% of the gene from spinach. The rbc L sequence is a 657 bp internal Pst I fragment from maize. The atp BE sequence is a Hind III, Pst I fragment of 2.4 kbp, the C-109 sequence is a Pst I, Barn fragment of 1.3 kbp containing sequences from pet D and pet B and the chloroplast r D N A is a 12.3-kbp Pst I fragment; all isolated from pea. The plasmids were isolated by alkaline lysis as described by Maniatis et al. (1982) and purified by two CsC1ethidium bromide equilibrium density centrifugations. A synthetic oligonucleotide was made to psa A by Millipore (UK), Harrow, Middlesex. The sequence for psa A, (5')CATGCCACTCAGCCAAAGAAAGATAATGGAGAGTTGGCCGAAATGAGCAC-(3'), encodes the amino-acid residues 80-96 of pea psa A (Lehmbeck et al. 1986). Preparation of slot blots and RNA/DNA hybridisation. Aliquots of R N A were denatured by heating for 30 rain at 65~ in 6% formaldehyde, 20 mM sodium phosphate. Ammonium acetate was added to the samples to a concentration of 1 M and the R N A was applied to nitrocellulose or nylon using a "Minifold I I " slot-blot apparatus (Schleicher and Schuell, supplied by Anderman & Co., Kingston-upon-Thames, Surrey, UK). The R N A was applied in triplicate for each sample at concentrations up to 5 lag per slot. The nitrocellulose filter was airdried overnight and baked for 2 h at 80 ~ C in a vacuum oven. The filter was then prehybridised overnight at 65 ~ C with 4 x SSC (SSC = 150 m M NaC1, 15 mM sodium citrate), 5 x Denhardt's reagent (0.1% w/v Ficoll 400, 0.1% w/v bovine serum albumin (BSA) and 0.1% w/v polyvinyl pyrollidone 360), 0.1% (w/v) sodium dodecyl sulfate (SDS), 100 lag.m1-1 boiled calf thymus D N A and 50 mM sodimn phosphate; pH 7.0. Plasmids containing chloroplast D N A sequences were radiolabelled by nick translation with c~-[P32}cytidine 5'-triphosphate using a BRL reagent kit. Unincorporated radionucleotides were removed by the use of Sephadex G-50 spin columns (Maniatis et al. 1982). After denaturation of the D N A probe for 10 rain in 0.2 M NaOH, the labelled probe was added to the prehybridisation medium. Hybridisation was carried out overnight at 65 ~ C. The filters were then washed 3 x 20 min at room temperature in 0.3 x SSC, 0.1% (w/v) SDS, followed by 3 x20 rain at 65 ~ C in the same solution. The oligonucleotide sequence for psa A (40 pmol) was endlabelled in a buffer containing 0.1 M Tris-HC1 (pH 8.0), l0 mM MgCla, 5 m M dithiothreitol, 1480 kBq 7-[32p]ATP (111 GBq/

B.R. Jordan et al. : The effect of irradiance on chloroplast transcripts gmol; Amersham International) and 10 units of T4 polynucleotide kinase (Pharmacia, Milton Keynes, Bucks., UK) for 45 min at 37 ~ C. The reaction was stopped by incubation at 70 ~ C for 10 rain. Nylon filters were prehybridised overnight at 52~ C in 5 x SSC, 20 mM sodium phosphate (pH 7.0), 10 x Denhardt's solution, 7% (w/v) SDS and 100 gg.m1-1 calf thymus DNA. The radiolabelled oligonucleotide was then added and the hybridisation left overnight at 52 ~ C. The filters were then washed sequentially for 1 h at the hybridisation temperature in (i) 3 x SSC, 10 m M sodium phosphate (pH 7.0), 10 x Denhardt's solution and 5% (w/v) SDS, and (ii) 1 x SSC and 1% (w/v) SDS. Northern analysis of chloroplast R N A gave a single transcript size of 6.0 kbp, as previously reported for psa A (Glick et al. 1986), Autoradiography of the filters was at - 7 0 ~ C using Kodak X A R or Fuji RX film with a single intensifying screen (Du Pont; Cronex).

Quantitation of RNA/DNA hybridisation. Scintillation counting of individual hybridisation slots cut from the nitrocellulose filters was in 2,5-di[5'-tert.-butylbenz-oxazoly(2')]thiophen (BBOT) scintiltant (0.04% w/v BBOT, 8% w/v naphthalene in 3 : 2 v/v toluene: 2-methoxyethanol). The mean of the triplicates was calculated and blank slots (no R N A applied) used to correct for background. The cpm/slot varied by < +_10% of the mean for the triplicates.

71 Table 1. Chloroplast R N A was isolated from 19- to 37-d-old high- or low-light-grown lettuce. The R N A was bound to nitrocellulose using a slot-blot apparatus (5 gg R N A per slot and triplicates for each sample) and hybridised with c p D N A sequences. After autoradiography the hybridisation was quantified by scintillation counting. The data are the mean_4-_SE (n = number of separate R N A preparations) and * indicates significant difference at 0.4% from analysis of variance

D N A sequence (n)

atpBE(13) psbA (7) psaA (3) rbcL (7) r D N A (5)

D N A - R N A hybridisation (cpm/slot) at two irradiances: 20 W , m -2

80 W . m -z

114_+ 18" 217+_ 15 202_+ 16 777+- 77 2024+105

204_+ 25* 259+_ 32 233_+ 45 718+- 66 2346+_176

Results

The transcript levels for six chloroplast-encoded D N A sequences were determined from plants grown under different irradiances. To measure the transcript levels, R N A was isolated from intact chloroplasts prepared from tissue grown under the different light regimes. This R N A was then bound to nitrocellulose or nylon using a slot-blot apparatus and radiolabelled D N A sequences hybridised to it. The extent of hybridisation was visualized by autoradiography and quantitated by scintillation counting. Table 1 shows quantitative experimental data for the transcript levels present in chloroplast R N A isolated from plants grown under low and high irradiance. R N A was isolated on 13 separate occasions and the atp BE sequence hybridised to it. The transcript levels for this sequence were found to be consistently increased in the R N A isolated from the high-light-grown plants and Northern analysis confirms this increase, with the 2.4-kbp transcript being particularly enhanced (Fig. 1). An increase in atp BE transcripts was also maintained at the different times that R N A was isolated between 19 and 37 d growth. The C-109 sequence (pet BD) also increased in higher irradiance as determined by autoradiography (Fig. 2), although accurate quantitation by scintillation counting was not possible because of the low levels of radioactivity present in the hybridisation. In contrast, using the same R N A preparations no significant difference was found for rbc L, psa A or psb A transcripts, between high- or low-light or

Fig. 1. Northern analysis of chloroplast R N A hybridised against the atp BE gene sequence. Lane a=high-light-grown lettuce; lane b=low-tight-grown lettuce. The lettuce were 24 d old at the time of R N A isolation

during development. Ribosomal R N A firom the different irradiances showed no variation in hybridisation and was used as a control throughout these experiments. Representative R N A hybridisation to these chloroplast D N A sequences is also illustrated in Fig. 2. Because leaf growth and development is not equivalent under these different irradiances, direct comparisons of transcript levels on a leaf-age basis does not necessarily provide an accurate reflection of the response to light. Changes obtained in plants

72

B.R. Jordan et al. : The effect of irradiance on chloroplast transcripts

Fig. 2. Representative autoradiographs of chloroplast R N A isolated from high- or low-light-grown lettuce and hybridised against radiolabelled c p D N A sequences. 5 gg R N A per slot for atp BE and C109; 1 gg R N A per slot for chloroplast rDNA, rbc L, psa A and psb A

Table 2. Lettuce plants were grown at low irradiance (20 W. m -2) or high irradiance (80 W . m - 2 ) for 24 d or transferred on day 21 (Day 0) from low into high irradiance and allowed to acclimate for 3 d. Chloroplast R N A was isolated and bound to nitrocellulose. The R N A was then hybridised with the atp BE, psb A and psa A sequences, cpm/slot represents the average of three slots and the results are < _+10%

4oo/ 7

T: E 200

Day from transfer

Irradiance (W. m - 2)

Chlorophyll a/b ratio

D N A - R N A hybridisation (cpm/slot) psb A

psa A

atp BE

20

2.9

224

220

140

Day 3

20 80 20~80

3.1 4.0 3.5

288 247 261

197 210 183

131 252 257

shortly after a transfer between light environments should, however, reflect light acclimation more clearly. Table 2 shows representative data of chloroplast R N A isolated from plants transferred between irradiance conditions and hybridised to the atp BE, psa A and psb A sequences. The R N A was isolated from plants grown for 24 d in continuous low- or high-light, or from plants transferred between the light regimes on day 21. Transcripts in plants transferred from low- to high-light increased for atp BE to the level of those in continuous high-light plants, while psa A and psb A did not change. To obtain an indication of absolute transcript levels, R N A was measured per unit chlorophyll from isolated chloroplasts. Figure 3 illustrates chloroplast R N A levels over a period of 25 d growth in high- or low-light in relation to chlorophyll content. The younger plants grown under high-light contain approx, twofold more R N A per unit chlorophyll than low-light tissue. With increasing leaf age the RNA-to-chlorophyll ratio be-

o

~

~

n-

",c,o~

0 Day 0

j

I

I

I

I

20

30

40

50

Days from sowing Fig. 3. Chloroplasts were isolated from high- or low-lightgrown lettuce over a period of growth. Chlorophyll concentration was determined and R N A isolated from the chloroplasts. The data are representative of three separate experiments. e - - o , high-light; o o, low-light

comes similar for the two light regimes. Throughout this period the low-light plants contain approx. 50% more chlorophyll per unit fresh weight (e.g. 1514gg chlorophyll/g in low-light and 961 gg chlorophyll/g in high-light) and approx. 10% less chlorophyll per unit area (21 gg chlorophyll/cm / in high-light and 18 gg chlorophyll/cm 2 in lowlight). Figure 4 shows the total R N A transcripts as cpm per unit chlorophyll for the atp BE, psb A and rbc L genes. It is apparent from these data that young plants grown under high irradiance undergo a substantial increase in chloroplast gene transcripts on a chlorophyll basis. However, in 24d-old high-light plants the chloroplasts are smaller and there are 2.5-fold more chloroplasts on a chlorophyll basis than in low-light (data not shown). This reflects an increase in chloroplast division under the high-light regime and may also indicate an increase in chloroplast D N A copy number (Possingham and Lawrence 1983).

B.R. Jordan et al. : The effect of irradiance on chloroplast transcripts atp BE

20

10

0

I

1

I

.,? O X

psb A

_o

40

i

E 20 D. O

I

I

80

o ~ ~

rbc L

40

0

I

I

20

30

I 40

Days from sowing

Fig. 4. Chloroplast RNA isolated from high- and low-lightgrown lettuce of different ages was hybridised against the atp BE, psb A and rbc L gene sequences. The hybridisation was quantified by scintillation counting and calculated as cpm per total RNA per mg chlorophyll, o - - o , high-light; zx--zx, lowlight

Discussion

The transcript level per unit chloroplast R N A for the atp BE gene was consistently greater by twofold in chloroplasts isolated from high-light plants (Tables 1, 2; Figs. 1, 2). The atp BE transcript also increased in amounts in plants after acclimating for 3 d to higher irradiance (Table 2). Lettuce plants grown under the same conditions as in the present study have two- to threefold greater ATP synthase (CFI) enzyme activity in high-light (Davies et al. 1986a) and a corresponding increase in CFI protein as determined immunochemically (Davies et al. 1987). Furthermore, the CFI protein was increased on transfer to a higher irradiance, taking 3-4 d to reach the characteristic level of the new light regime. It is therefore likely that the steadystate transcript level for the atp BE gene is reflected in the CFrprotein content in plants grown under

73

different irradiances. Other plant species (spinach: Berzborn et al. 1981; pea: Leong and Anderson 1984; tomato: Davies et al. 1986b) also show the same changes in the levels of C F I in response to growth irradiance. It would seem therefore that changes in chloroplast gene expression for components of the CFrcomplex is an important adaptive strategy to alterations in irradiance and may be important in regulating overall chloroplast gene expression by modulation of the chloroplast ATP/ N A D P H ratio (Melis et al. 1985). In addition to the increase in atp BE transcripts under high irradiance, the transcript level for the C-109 sequence also increased. This sequence overlaps both the pet D and pet B genes (subunit 4 polypeptide and cytochrome b6, respectively, of the cytochrome befcomplex) and is found in the "' gene cluster" spanning psb B, psb H, pet B:and pet D. Although the gene produets of this region are associated with different thylakoid protein complexes, these genes frequently give rise to large polycistronic transcripts covering the entire region from psb B to pet D (Rock et al. 1987). It is therefore difficult at this stage to determine the exact gene that is changing and giving rise to the apparent increase we have observed with the C109 sequence. However, the cytochrome b6f complex is known to change rapidly in response to irradiance (Anderson 1986; Chow and Anderson 1987) and consequently the increase in transcripts detected by C109 may reflect the increased synthesis of the cytochrome b6f components. Studies on the electron-transport chain during photosynthetic light acclimation have indicated that decreased efficiency under low-light or on transfer into low-light is the result of inhibition of photosystem II (PSII) and probably associated with the 32-kDa-DI protein (Davies et aL 1986b). Both the synthesis and the rate of degradation of this protein are known to be light-regulated (Bennett 1984), synthesis being regulated by photophosphorylation and degradation by electrontransport activity. The control of the turnover of this protein is particularly important if it is part of the PSII reaction centre itself (Deisenhofer et al. 1985; Nixon et al. 1986). In the present study, psb A-transcript levels were not increased with the increase in irradiance on a plastid-RNA basis, although they do increase substantially in absolute terms during leaf development (Fig. 4). If PSII reaction-centre polypeptides increase under increased irradiance (Chow and Hope 1987)ithen this could be reflected in the absolute transcript measurements for both psb A and psa A. Furthermore, the rbc L RNA transcripts per unit plastid RNA

74

B.R. Jordan et al. : The effect of irradiance on chloroplast transcripts

are the same in either high or low irradiance and the increased levels of ribulose-l,5-bisphosphate carboxylase/oxygenase protein that are consistently found in high-light plants (Bjorkman 1981 ; Besford 1986) are probably related to absolute rbc L transcript levels (Fig. 4). Similar results have been obtained for rbc L transcript levels in mature tobacco plants transferred into high irradiance (Prioul and Reyss 1987). From the results on transcript levels per unit R N A it is apparent that irradiance can cause changes in the relative abundance of some plastid transcripts, while others remain unaltered. As these R N A transcript levels are determined by transcription and-or turnover, light could be acting upon a number of different processes (Deng and Gruissem 1987; Mullet and Klein 1987; Klein et al. 1988, and for a review and discussion; Thompson 1988). In addition, the total levels of chloroplast RNA may be light-regulated during development (Fig. 3). Consequently, the increased chloroplast protein content present in high-light leaves (Bjorkman 1981, Boardman 1977) is likely to be the product of a total increase in biosynthetic capacity, in addition to differential regulation of some transcripts. The increase in total RNA may be the result of increased plastome copy number, particularly during the rapid growth period of the leaf (Scott and Possingham 1980; Possingham and Lawrence 1983). As net photosynthetic capacity is greater in young high-light plants (20-30% full leaf expansion), the relationship between chloroplast gene copy number and photosynthetic potential is likely to be an important mechanism through which light influences leaf development. The authors wish to acknowledge Dr. D. Vince-Prue for her support of this project. The advice and encouragement of Drs. T.A. Dyer and R.B. Flavell (AFRC I.P.S.R., Cambridge) has been greatly appreciated. We would also like to thank Cathy Townley for statistical analysis of data and Tim Warren for the synthesis of the psa A oligonucleotide. The financial support of the Agricultural and Food Research Council, Gatsby Charitable Foundation, the United States Department of Agriculture (grant 85-CRCR-1-1914) and the North Atlantic Treaty Organisation (NATO; grant No. 701/84) is acknowledged.

References Anderson, J.M. (1982) The significance of grana stacking in chlorophyll b-containing chloroplasts. Photobiochem. Photobiophys. 3, 225 241 Anderson, J.M. (1986) Photoregulation of the composition, function, and structure of thylakoid membranes. Annu. Rev. Plant Physiol. 37, 93-136 Arnon, D.I. (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 24, 1 15 Bennett, J. (1984) Control of protein turnover by photosynthetic electron transport. Nature 310, 547-548

Berzborn, R.J., Miiller, D., Roos, P., Andersson, B. (1981) Significance of different quantitative determinations of photosynthetic ATP-synthetase CF1 distribution and grana formation. In: Structure and molecular organization of the photosynthetic apparatus. (Proc. V Int. Photosynth. Congr.) vol. III, pp. 107-120, Akoyunoglou, G., ed. Balaban International Science Services, Philadelphia Besford, R.T. (1986) Changes in some Calvin cycle enzymes of the tomato during acclimation to irradiance. J. Exp. Bot. 37, 20(~210 Bjorkman, O. (1981) Responses to different quantum flux densities. In: Encyclopedia of plant physiology, N. S. vol. 12A: Physiological plant ecology I, pp. 57-107, Lange, O.L., Nobel, P.S., Osmond, C.B., Ziegler, H., eds. Springer, Berlin Heidelberg New York Boardman, N.K. (1977) Comparative photosynthesis of sun and shade plants. Annu. Rev. Plant Physiol. 28, 355 377 Chow, W.S., Anderson, J.M. (1987) Photosynthetic responses of Pisum sativum to an increase in irradiance during growth. II. Thylakoid membrane components. Aust. J. Plant Physiol. 14, 9-19 Chow, W.S., Hope, A.B. (1987) The stoichiometries of supramolecular complexes in thylakoid membranes from spinach chloroplasts. Aust. J. Plant Physiol. 14, 21-28 Davies, E.C., Chow, W.S., Jordan, B.R. (1986a) A study of factors which regulate the membrane appression of lettuce thylakoids in relation to irradiance. Photosynth. Res. 9, 359-370 Davies, E.C., Chow, W.S., Le Fay, J.M., Jordan, B.R. (1986b) Acclimation of tomato leaves to changes in light intensity : Effects on the function of the thylakoid membrane. J. Exp. Bot. 37, 211~20 Davies, E.C., Jordan, B.R., Partis, M.D., Chow, W.S. (1987) Immunochemical investigation of thylakoid coupling factor protein during photosynthetic acclimation to irradiance. J. Exp. Bot. 38, 1517-1527 Deisenhofer, J., Epp, O., Miki, K., Huber, R., Michel, H. (1985) Structure of the protein subunits in the photosynthetic reaction centre of Rhodopseudomonas viridis at 3A resolution. Nature 318, 618-624 Deng, X-W., Gruissem, W. (1987) Control of plastid gene expression during development: the limited role of transcriptional regulation. Cell 49, 379-387 Glick, R.E., McCauley, S.W., Gruissem, W., Melis, A. (1986) Light quality regulates expression of chloroplast genes and assembly of photosynthetic membrane complexes. Proc. Natl. Acad. Sci. USA 83, 4287~4291 Jordan, B.R., Partis, M.D., Thomas, B. (1986a) The biology and molecular biology of phytochrome. In : Oxford surveys of plant molecular and cell biology, vol. 3, pp. 315-362, Miflin, B.J., ed. Oxford University Press Jordan, B.R., Thomas, B., Partis, M.D. (1986b) Light activated genes: prospects for modifying them to increase crop productivity. In: Biotechnology and crop improvement and protection (Monograph 34) pp. 49-59, Day, P.R., ed. The Lavenham Press Ltd, Lavenham, Suffolk, UK Klein, R.R., Mason, H.S., Mullett, J.E. (1988) Light-regulated translation of chloroplast proteins. [. Transcripts of psa Apsa B, psb A, and rbc L are associated with polysomes in dark-grown and illuminated barley seedlings. J. Cell Biol. 106, 28%301 Lehmbeck, J., Rasmussen, O.F., Bookjans, G.B., Jepsen, B.R., Stummann, B.M., Henningsen, K.W. (1986) Sequence of two genes in pea chloroplast DNA coding for 84 and 82 kD polypeptides of the photosystem I complex. Plant Mol. Biol. 7, 3-10 Leong, T.Y., Anderson, J.M. (1984) Adaptation of the thylak-

B.R. Jordan et al. : The effect of irradiance on chloroplast transcripts oid membranes of pea chloroplasts to light intensities. II. Regulation of electron transport capacities, electron carriers, coupling factor (CF 1) activity and rates of photosynthesis. Photosynth. Res. 5, 117-128 Lichtenthaler, H.K., Buschman, C., Doll, M., Fietz, H.-J., Bach, T., Kozel, U., Meier, D., Rahmsdorf, U. (1981) Photosynthetic activity, chloroplast ultrastructure, and leaf characteristics of high-light and low-light plants of sun and shade leaves. Photosynth. Res. 2, 115 141 Maniatis, T., Fritsch, E.F., Sambrook, J. (1982) Molecular cloning. Cold Spring Harbor, N.Y., USA Melis, A., Manodori, A., Glick, R.E., Ghirardi, M.L., McCauley, S.W., Neale, P.J. (1985) The mechanism of photosynthetic membrane adaptation to environmental stress conditions: a hypothesis on the role of electron-transport capacity and of ATP-NADPH pool in the regulation of thylakoid membrane organisation and function. Physiol. V6g. 23, 75% 765 Mullet, J.E., Klein, R.R. (1987) Transcription and RNA stability are important determinants of higher plant chloroplast RNA levels. EMBO J. 6, 1571-1579 Nixon, P.J., Dyer, T.A., Barber, J., Hunter, C.N. (1986) Immunological evidence for the presence of the D1 and D2 proteins in the PS2 cores of higher plants. FEBS Lett. 209, 83-86 Possingham, J.V., Lawrence, M.E. (1983) Controls to plastid division. Int. Rev. Cytol. 84, 1 56 Prioul, J.-L., Reyss, A. (1987) Acclimation of ribulose bisphos-

75

phate carboxylase and mRNAs to changing irradiance in adult tobacco leaves. Plant Physiol. 84, 1238-1243 Rock, D.C., Barkan, A., Taylor, W.C. (1987) The maize plastid psbB-psbF-petB-petD gene cluster: spliced and unspliced pet B and pet D RNAs encode alternative products. Curr. Genet. 12, 69-77 Rodermel, S.R., Bogorad, L. (1985) Maize plastid photogenes: mapping and photoregulation of transcript levels during light-induced development. J. Cell Biol. 100, 463M.76 Scott, S., Possingham, J.V. (1980) Chloroplast DNA in expanding spinach leaves. J. Exp. Bot. 31, 1081 1092 Thompson, W.F. (1988) Photoregulation: diverse gene responses in greening seedlings. Plant Cell Environ. 11, 319328 Thompson, W.F., Everett, M., Polans, N.O., Jorgensen, R.A., Palmer, J.D. (1983) Phytochrome control of RNA levels in developing pea and mungbean leaves. Planta 1158, 487500 Thompson, W.F., Kaufman, L.S., Watson, J.C. (1985) Induction of plant gene expression by light. Bio Essays 3, 153-159 Tobin, E.M., Silverthorne, J. (1985) Light regulation of gene expression in higher plants. Annu. Rev. Plant Physiol. 36, 569-593 Woodbury, N.W., Roberts, L.L., Palmer, J.D., Thompson, W.F. (1988) A transcription map of the pea chloroplast genome. Curr. Genet. 14, 75 89 Received 30 June; accepted 8 December 1988