HUMAN IMMUNOLOGY doi: 10.1111/sji.12295 ..................................................................................................................................................................
Chlamydia pneumoniae and Chlamydia Trachomatis Infection Differentially Modulates Human Dendritic Cell Line (MUTZ) Differentiation and Activation C. W. Armitage, C. P. O’Meara & K. W. Beagley
Abstract Institute of Health and Biomedical Innovation, Queensland University of Technology, Kelvin Grove, Qld, Australia
Received 17 November 2014; Accepted in revised form 19 March 2015 Correspondence to: Dr K. W. Beagley, Institute of Health and Biomedical Innovation, Queensland University of Technology, 60 Musk Avenue, Kelvin Grove, Qld, 4059, Australia. E-mail: [email protected]
Chlamydia trachomatis and Chlamydia pneumoniae are important human pathogens that infect the urogenital/anorectal and respiratory tracts, respectively. Whilst the ability of these bacteria to infect epithelia is well defined, there is also considerable evidence of infection of leucocytes, including dendritic cells (DCs). Using a human dendritic cell line (MUTZ), we demonstrate that the infection and replication of chlamydiae inside DCs is species and serovar specific and that live infection with C. pneumoniae is required to upregulate costimulatory markers CD80, CD83 and human leucocyte antigen (HLA)-DR on MUTZ cells, as well as induce secretion of interleukin (IL)-2, IL-6, IL-8, IL-12 (p70), interferongamma and tumour necrosis factor-alpha Conversely, C. trachomatis serovar D failed to upregulate DC costimulatory markers, but did induce secretion of high concentrations of IL-8. Interestingly, we also observed that infection of MUTZ cells with C. pneumoniae or C. trachomatis serovar L2, whilst not replicative, remained infectious and upregulated lymph node migratory marker CCR7 mRNA. Taken together, these data confirm the findings of other groups using primary DCs and demonstrate the utility of MUTZ cells for further studies of chlamydial infection.
Introduction The obligate intracellular bacteria Chlamydia trachomatis and Chlamydia pneumoniae are important human pathogens that infect and cause pathology in the reproductive and respiratory tracts, respectively. Whilst the chlamydiae generally infect mucosal epithelium, there have also been studies revealing Chlamydia spp. can infect a diverse range of leucocytes including professional antigen presenting cells [macrophages, dendritic cells (DCs)], granulocytes (neutrophils [1], mast cells) and lymphocytes (T cells) (reviewed in Beagley et al. [2]). Infection of the immune cells can allow a pathogen to escape from immune surveillance and can also impair the immune response necessary to resolve infection. Dendritic cells play pivotal roles in orchestrating the appropriate immune responses to infection and vaccination. Research has identified that, like epithelial cells, human DCs can also be infected by chlamydiae. Infection of peripheral blood monocyte-derived DCs (MoDC) [cluster of differentiation (CD)14+] with C. pneumoniae has been documented, and these MoDC developed a persistent infection lasting up to 25 days [3]. Similarly, C. trachomatis serovars E and
48
L2 have been shown to infect and survive within MoDCs [4, 5]. Whilst using primary DCs is ideal, there are significant costs, ethical considerations and experimental limitations associated with collecting donor cells. The majority of primary DCs used for research are differentiated from CD14+ monocytes that have been purified from the spleen, or more commonly the peripheral blood, and are then differentiated into DCs with recombinant IL-4 and granulocyte/macrophage colony-stimulating factor (GMCSF). The resulting cell populations are heterogeneous, which can impair experimental reproducibility between researchers. A suitable candidate DC to standardize results is MUTZ-3, a myeloid DC precursor obtained from a male leukaemia patient [6]. Similar to MoDCs, MUTZ-3 cells can be differentiated into mature DCs with IL-4 and GMCSF to display characteristics resembling immature DCs. These immature MUTZ (iMUTZ) cells express low amounts of CD14 and CD34, and intermediate amounts of CD40, CD80, CD86 and HLA-DR [7]. In response to stimuli, they can upregulate CD80, CD83, CD86, HLADR, lymph node migration marker CCR7 and are capable of secreting costimulatory cytokines necessary for CD4+
Ó 2015 John Wiley & Sons Ltd
C. W. Armitage et al. Chlamydia Spp. Infection of a Human Dendritic Cell Line 49 ..................................................................................................................................................................
and CD8+ T cell differentiation [7]. Taken together, these characteristics make MUTZ-3 cells an attractive cell model to study in detail the effects of chlamydial infections on these key immune cells.
Materials and methods Cell lines. All cell lines were maintained in a humidified incubator at 37 °C with 5% atmospheric CO2. MUTZ-3 cells and their growth partner cell line 5637 which secretes growth factors were a generous gift from Dr. Saskia Santegoets and Dr. Rik Scheper (VU University Medical Centre, the Netherlands), and Prof. Tony Cunningham (Westmead Millennium Institute, Australia). The 5637 bladder epithelial cells were maintained in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum, 100 lg/ml streptomycin sulphate and 50 lg/ml gentamycin. A total of 5647-conditioned media was collected as a supernatant and sterilized using a 0.4-lm filter. Conditioned media was then stored in aliquots at 20 °C until required. MUTZ-3 cells were maintained and propagated in MEM-alpha medium containing nucleosides (Invitrogen, Mulgrave, VIC, Australia) and supplemented with 20% heat-inactivated fetal calf serum (FCS), 100 lg/ml streptomycin sulphate, 50 lg/ml gentamycin, 50 lM beta-mercaptoethanol and 10% 0.2-lm-filtered conditioned media from 5637 cells. To differentiate MUTZ-3 cells into the DC phenotype (iMUTZ), MUTZ-3 cells were incubated for 7 days in growth media additionally supplemented with 200 U/ml of recombinant human GM-CSF (Peprotech, Hamburg, Germany) and 1000 U/ml of recombinant human IL-4 (Peprotech). Fresh iMUTZ media was applied every second day until use. McCoy (ATCC: CRL-1696) and HEC1A (ATCC: HTB-112) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in DMEM supplemented with 10% FCS, 100 lg/ml streptomycin sulphate and 50 lg/ml gentamycin. BEAS-2B (ATCC: CRL-9609) lung epithelial cells were a generous gift from Prof. Phillip Hansboro (University of Newcastle, Australia) and were maintained in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum, 100 lg/ml streptomycin sulphate and 50 lg/ml gentamycin. Chlamydia spp.. Chlamydia pneumoniae AR39 (ATCC: 53592), Chlamydia trachomatis serovar D (ATCC:VR-885) and C. trachomatis serovar L2 (ATCC: VR-902B) were purchased from the ATCC and propagated within McCoy cells as previously described [8]. Chlamydial elementary bodies were purified using a discontinuous renografin gradient as previously described [8]. To inactivate Chlamydia spp. without damaging protein structure, Chlamydia in PBS were exposed to ultraviolet (UV) light for two rounds of 20 min. Inactivation was confirmed by the inability to infect McCoy cells. Flow cytometry. Immature MUTZ cells were infected with Chlamydia spp. at a multiplicity of infection (MOI) of
Ó 2015 John Wiley & Sons Ltd
2 or treated with UV–Chlamydia or 100 ng/ml purified Escherichia coli lipopolysaccharide (LPS) (Sigma-Aldrich, Castle Hill NSW, Australia) for 48 h at 37 °C in 5% CO2. Cells were then pelleted by centrifugation at 500 9 g for 5 min. Supernatant was collected for cytokine analysis. Cells were then blocked with 10% human AB serum (Sigma-Aldrich) in PBS for 30 min at 4 °C and then incubated with monoclonal antibodies targeting CD80 (PE), CD83 (FITC), CD86 (APC) or HLA-DR (PE-Cy7). All flow antibodies were purchased from BD PharMingen (North Ryde, NSW, Australia). Control cells were also treated with fluorophore and antibody matched isotype controls. Cells were then washed with PBS, fixed with 4% paraformaldehyde for 20 min at 4 °C and analysed using a FACS-Aria flow cytometer (BD Biosciences, North Ryde, NSW, Australia), and data were analysed using FLOWJO (Treestar Ashland, OR, USA). Cytokine secretion. Supernatant from treated iMUTZ cells was screened using a Bio-Plex Pro Human Cytokine 8-plex Assay (#M50-000007A; Bio-Rad, Gladesville, NSW, Australia) and data collected using a Bio-Plex 200 luminometer (Bio-Rad) as per the manufacturer’s instructions. IL-12 (p70) secretion was determined using a human IL-12 (p70) ELISA kit (ELISAkit.com, Scoresby, Vic., Australia) as per the manufacturer’s instructions. Concentrations of human cytokines were determined from a standard curve supplied with the Bio-Plex and ELISA kit products. Immunofluorescence. HEC1A, BEAS-2B and iMUTZ cells were grown on poly-L-lysine-coated coverslips and infected with C. trachomatis (D or L2) or C. pneumoniae at an MOI of two for 48 h. Cells were fixed with methanol for 10 min, washed twice with PBS and blocked with 10% FCS in PBS for 1 h at room temperature. Cells were then incubated with anti-C. trachomatis LPS IgG-FITC (Cellabs, Brookvalle, NSW, Australia) or anti-C. pneumoniae LPS IgGFITC (Cellabs) for 1 h at room temperature. Cells were then washed three times with PBS and incubated with DAPI for 10 min. Cells were washed twice with PBS and mounted onto slides using Prolong Gold (Invitrogen). Images were taken using a Confocal TCS SP5 microscope (Leica Microsystems; North Ryde, NSW, Australia). Quantitative reverse transcription PCR. iMUTZ cells were infected with Chlamydia spp. (MOI = 2) and RNA collected at 8, 24 and 48 h post-infection. RNA was purified from cells using Trizol (Invitrogen) as per the manufacturer’s instructions. cDNA was synthesized from RNA using Superscript III reverse transcriptase and random hexamers as per the manufacturer’s instructions (Invitrogen). Exon-spanning primer sequences for human CCR7 (forward 50 - GGACCTGGGGAAACCAATGAA -30 , reverse 50 - AGGCTTTAAAGTTCCGCACG -30 , 173 bp) and human GAPDH mRNA (forward 50 - CCACCCATGG CAAATTCC -30 , reverse 50 - TGGGATTTCCATTGATG ACAA -30 , 69 bp) were designed using Primer3 software
50 Chlamydia Spp. Infection of a Human Dendritic Cell Line C. W. Armitage et al. .................................................................................................................................................................. (PubMed Central). All PCRs were optimized and used 10 ng template cDNA, 2 mM MgCl2 and Platinum Taq polymerase (Invitrogen). Quantitative reverse transcription PCR was performed using a Rotorgene thermocycler (Qiagen, Chadstone, VIC, Australia). Conditions for amplification were an initial denaturation of 95 °C for 10 min, followed by 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 74 °C for 30 s. Initial copies per sample were quantified using a standard curve derived from purified PCR amplicons. Viability culture. To determine whether internalized Chlamydia spp. retained infectivity, iMUTZ cells were infected at an MOI of 2 and cells frozen in SPG at 24, 48 and 72 h post-infection. Prior to freezing down, cells were washed twice with PBS containing 100 lg/ml heparin sulphate (Sigma-Aldrich) to remove attached but noninternalized EBs[9]. Thawed cells were lysed by probe sonication and reinfected onto confluent McCoy cells seeded in 96-well plates the previous day. McCoy cells were infected for 48 h prior to fixation, staining and quantification by fluorescent microscopy as previously described [10]. Statistics. Statistics performed using one-way ANOVA with Tukey’s post-test column analysis. *P < 0.05, **P < 0.01, ***P < 0.001.
Results Infection of iMUTZ cells yields viable and infectious C. trachomatis and C. pneumoniae
Chlamydial infection has been reported in primary human MoDCs, and we sought to determine whether the respiratory pathogen C. pneumoniae, and urogenital/anorectal pathogens C. trachomatis serovars D and L2 were capable of infecting iMUTZ cells. Positive controls for C. pneumoniae and C. trachomatis infection were the respiratory epithelial cell BEAS-2B and the uterine epithelial cell HEC1-A. Following infection for 72 h and staining for chlamydial LPS and DNA, small inclusions consistent with C. pneumoniae AR39 were visible localized to the nuclear membrane of BEAS-2B cells (Fig. 1A). Infected iMUTZ cells also had positive LPS staining close to the nucleus, but inclusions were smaller in size suggesting poor or no growth. C. trachomatis serovar D or L2 produced large inclusions when grown in HEC1-A cells, and iMUTZ cells also stained positive but with much smaller inclusions. Within iMUTZ cells, C. trachomatis serovar D had the largest inclusion size compared to other Chlamydia spp. To determine whether the small LPS-positive inclusions were replicating chlamydiae, iMUTZ were again infected with C. pneumoniae and C. trachomatis isolates at an MOI of 2 and samples collected at 24, 48 and 72 h to determine viability (Fig. 1B). Following infection, cells were washed with PBS containing heparin sulphate to release attached but non-internalized elementary bodies (EBs) on the iMUTZ cell surface. When iMUTZ were lysed and
inoculated onto McCoy cell monolayers, culturable C. pneumoniae and C. trachomatis serovar L2 were recovered from infected iMUTZ at all three time points; however, the infection did not increase above the initial inoculum (MOI 2) over 72 h. Conversely, C. trachomatis serovar D was not culturable at 24 h post-infection consistent with the infectious EB differentiating into a non-infectious reticulate body (RB), and the infection then continued to increase to 12 inclusion forming units (IFUs)/cell over the course of 72 h suggesting chlamydial replication, albeit far lower than the 100–1000-fold replication observed in epithelial cells [11]. To determine whether C. pneumoniae or C. trachomatis infection of iMUTZ cells would upregulate the lymph node migratory gene CCR7, RNA was extracted from uninfected cells as well as cells infected for 8, 24 and 48 h and mRNA expression determined by qRT-PCR (Fig. 1C). In C. pneumoniae-infected iMUTZ cells, expression of CCR7 mRNA remained low until 48 h after infection when it increased by 16-fold. Infection with C. trachomatis serovar D failed to increase CCR7 relative to uninfected controls. Infection with C. trachomatis serovar L2 increased CCR7 expression within 8 h, which peaked at a 15-fold increase 24 h post-infection, and was eight-fold higher 48 h after infection. Taken together, these data suggest all Chlamydia spp. tested can infect iMUTZ cells, that only the urogenital isolate C. trachomatis serovar D is capable of replicating, but respiratory C. pneumoniae and anorectal/urogenital C. trachomatis serovar L2 remain as a non-replicative but still infectious form. C. pneumoniae and C. trachomatis L2 also induced upregulation of lymph node homing receptor CCR7 suggesting they would be capable of trafficking infectious chlamydiae to the lymph nodes that drain the lung and anorectal/urogenital tracts. C. pneumoniae infection, but not C. trachomatis infection, upregulates costimulation markers CD80, CD83 and HLA-DR
To determine the effect of C. pneumoniae and C. trachomatis infections on DCs, iMUTZ cells were infected at an MOI of 2 for 48 h, stained with monoclonal antibodies to CD80, CD83, CD86 and HLA-DR, fixed and analysed by flow cytometry (Fig. 2). Gating was performed using whole cell and doublet exclusion (Fig. 2A). LPS maturation of iMUTZ cells upregulated surface expression of CD80 (Fig. 2B), CD83 (Fig. 2C) and HLA-DR (Fig. 2D), but not CD86 (Fig. 2E). C. trachomatis D infection failed to induce expression of any surface markers measured, but interestingly live infection significantly downregulated surface CD86. Importantly only live infection of iMUTZ with C. pneumoniae upregulated surface expression of CD80, CD83 and HLA-DR suggesting this would costimulate T cells towards Th1 and that the mechanism is infection dependent.
Scandinavian Journal of Immunology, 2015, 82, 48–54
C. W. Armitage et al. Chlamydia Spp. Infection of a Human Dendritic Cell Line 51 .................................................................................................................................................................. A
B
C
Figure 1 MUTZ cells are infected with viable Chlamydia spp. and upregulate lymph node migration marker CCR7. (A) BEAS-2B and iMUTZ were infected with C. pneumoniae (MOI 2), and HEC1-A and iMUTZ, with C. trachomatis (D or L2). After 72 h, cells were fixed and stained with DAPI (DNA) and antichlamydial LPS for confocal microscopy. (B) iMUTZ cells were infected with C. pneumoniae or C. trachomatis (D and L2) for 24, 48 and 72 h. Cells were washed twice with PBS + 100 lg/ml of heparin sulphate and stored in SPG. iMUTZ cells were then lysed by sonication and inoculated on McCoy cells for 48 h, fixed, stained and IFUs per tube determined by fluorescent microscopy. (C) iMUTZ cells were infected with C. pneumoniae or C. trachomatis (D and L2) for 8, 24 and 48 h and RNA extracted. Relative fold change in CCR7 mDNA was determined from GAPDH cDNA controls by qRT-PCR. Scale bar = 20 lm. Error bars represent standard error of the mean (n = 3).
C. pneumoniae and C. trachomatis infection of iMUTZ cells leads to secretion of cytokines
As activation costimulation markers were observed in C. pneumoniae-infected iMUTZ cells, we also quantified the secretion of cytokines made in response to infection. Infection with C. pneumoniae led to significant increase in iMUTZ secretion of IL-2 (2.4-fold), IL-6 (35-fold), IL-8 (20-fold), IL-12 (p70) (six-fold), IFN-c (1.8 fold) and TNF-a (88-fold) (Fig. 3). This secretion was significantly dependent on C. pneumoniae being viable as the secretion was absent when iMUTZ cells were incubated with the same dose of UV-inactivated C. pneumoniae. When infected with C. trachomatis serovar D, there was a large 135-fold increase of IL-8 secretion and small 1.5-fold increase in IFN-c secretion.
Ó 2015 John Wiley & Sons Ltd
Discussion Here we report that the human dendritic cell MUTZ-3 cell can be infected with human isolates of C. trachomatis and C. pneumoniae and behave similarly to primary cells. All chlamydial species screened were able to infect and survive within MUTZ cells, which was validated by immunocytochemistry and viability culture of heparin sulphate-washed MUTZ cells lysed and reinfected onto HEp-2 cells. The genital isolate C. trachomatis serovar D was able to infect and replicate within MUTZ cells (MOI 12 following viability culture) but did not upregulate CCR7 suggesting the infected iMUTZ cell would remain within the infected tissue. C. pneumoniae and C. trachomatis L2 were able to infect iMUTZ cells but replicated poorly (with MOIs of 1-2 following viability culture), consistent with previous find-
52 Chlamydia Spp. Infection of a Human Dendritic Cell Line C. W. Armitage et al. ..................................................................................................................................................................
A
B
C
D
E
Figure 2 Expression of DC surface maturation/presentation markers in response to chlamydial infection. iMUTZ cells were treated with LPS, C. trachomatis D (live or inactivated), or C. pnuemoniae (live or inactivated) for 48 h at 37 °C. Cells were then blocked with human AB serum and stained for CD80, CD83, CD86 and HLA-DR. Cells were then fixed with 4% PFA, and flow cytometry was performed. (A) Gating strategy to determine regulation of costimulatory markers on the cell surface. Expression of CD80 (B), CD83 (C), CD86 (D) and HLA-DR (E) was determined. Error bars representative of standard error of the mean (n = 3).
Scandinavian Journal of Immunology, 2015, 82, 48–54
C. W. Armitage et al. Chlamydia Spp. Infection of a Human Dendritic Cell Line 53 .................................................................................................................................................................. A
B
D
E
C
F
Figure 3 Cytokine secretion by C. pneumoniae and C. trachomatis-infected MUTZ cells. (A) Secreted human IL-2, (B) IL-6, (C) IL-8, (D) IL-12 (p70), (E) IFN-c and (F) TNF-a were quantified from the supernatants of MUTZ cells treated for 72 h. (A–C, E–F) Quantified using Bio-Plex and (D) by IL-12 (p70) sandwich ELISA. No significant changes in IL-10 by Bio-Plex (not shown). Error bars representative of standard error of the mean (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001.
ings using primary MoDCs [3–5]. Interestingly, both C. pneumoniae and C. trachomatis L2 upregulated expression of CCR7 mRNA suggesting these infected cells would attempt to migrate to draining lymph nodes. This is not surprising as C. trachomatis L2 is one of the three serovars (L1-3) responsible for lymphatic infection, ulceration and blockage, clinically termed lymphogranuloma venereum. C. trachomatis serovars D-K share 99.5% DNA CDS homology with C. trachomatis serovars L1-3, with most of the difference occurring in C. trachomatis L1-3 deletion of cytotoxin precursors (CT164-CT167) in the plasticity zone [12]. This small loss of genes may account for C. trachomatis L2 ability to disseminate or, conversely, C. trachomatis D-K ability to remain localized to the genital tract. Similar to C. trachomatis L2 dissemination, respiratory C. pneumoniae infection is also thought to disseminate to distant tissues and is associated with atherosclerosis, arthritis and Alzheimer’s disease [13–15]. The mechanism of dissemination is principally due to DCs trafficking infectious Chlamydia spp. and remains poorly understood in human studies. To determine whether maturation and cytokines secretion profile of iMUTZ cells following infection with C. pneumoniae and C. trachomatis was upregulated, cells were infected and surface markers and cytokine secretion quantified. Live C. pneumoniae lead to increased expression of costimulatory surface molecules CD80, CD83 and HLADR as well as secretion of Th1-skewing cytokines IL-12 (p70), IFN-c and TNF-a, but also IL-6. This is consistent
Ó 2015 John Wiley & Sons Ltd
with C. pneumoniae infection of human MoDCs, which also upregulate costimulatory markers (CD80, CD83, CD38), and proinflammatory cytokines (IL-6 and IL-12) [16]. Conversely, infection MUTZ cells with C. trachomatis D did not upregulate costimulatory markers and only secreted IL-2, IL-8 and IFN-c. The large amount of IL-8 secreted (together with no change in CCR7 expression) suggests C. trachomatis D-infected DCs may play an important role in neutrophil chemotaxis, rather than antigen processing and presentation in lymph nodes draining the reproductive tract and warrants further investigation. In mouse models of reproductive tract chlamydial infection, the recruitment of neutrophils is important in clearance of infection, but also leads to the development of fallopian tube/oviduct occlusion and infertility [17]. Taken together, these data support the use of MUTZ-3 cells as potential surrogates for primary cells for future research investigating the host–pathogen relationship between human C. pneumoniae and C. trachomatis infections. The ability of MUTZ-3 cells to be transfected with plasmids/siRNA allows further insights into the host– pathogen relationship within DCs [7]. Furthermore, the mechanism of how C. pneumoniae and C. trachomatis L2 remain infectious but non-replicative within DCs is important to determine, and the ability to indefinitely expand MUTZ cells will help determine which peptides (host versus pathogen) are being presented on HLA-ABC and DR, DB, DQ. The use of MUTZ-3 cells will allow more
54 Chlamydia Spp. Infection of a Human Dendritic Cell Line C. W. Armitage et al. .................................................................................................................................................................. in-depth and manipulative experiments to be performed which are difficult or impossible with senescent postmitotic primary MoDCs.
Acknowledgment The authors wish to thank Prof. Tony Cunningham (Westmead Millennium Institute, Australia) for supplying the MUTZ and 5637 cell lines. The authors have no conflict of interests.
References 1 Rupp J, Pfleiderer L, Jugert C et al. Chlamydia pneumoniae hides inside apoptotic neutrophils to silently infect and propagate in macrophages. PLoS ONE 2009;4:e6020. 2 Beagley KW, Huston WM, Hansbro PM, Timms P. Chlamydial infection of immune cells: altered function and implications for disease. Crit Rev Immunol 2009;29:275–305. 3 Wittkop U, Krausse-Opatz B, Gust TC et al. Fate of Chlamydophila pneumoniae in human monocyte-derived dendritic cells: long lasting infection. Microb Pathog 2006;40:101–9. 4 Matyszak MK, Young JL, Gaston JS. Uptake and processing of Chlamydia trachomatis by human dendritic cells. Eur J Immunol 2002;32:742–51. 5 Gervassi A, Alderson MR, Suchland R, Maisonneuve JF, Grabstein KH, Probst P. Differential regulation of inflammatory cytokine secretion by human dendritic cells upon Chlamydia trachomatis infection. Infect Immun 2004;72:7231–9. 6 Masterson AJ, Sombroek CC, De Gruijl TD et al. MUTZ-3, a human cell line model for the cytokine-induced differentiation of dendritic cells from CD34+ precursors. Blood 2002;15 :701–3. 7 van Helden SF, van Leeuwen FN, Figdor CG. Human and murine model cell lines for dendritic cell biology evaluated. Immunol Lett 2008;15 :191–7.
8 Armitage CW, O’Meara CP, Harvie MC, Timms P, Wijburg OL, Beagley KW. Evaluation of intra and extraepitheilal secretory IgA (SIgA) in chlamydial infections. Immunology 2014;14 :12317. 9 Scidmore MA, Rockey DD, Fischer ER, Heinzen RA, Hackstadt T. Vesicular interactions of the Chlamydia trachomatis inclusion are determined by chlamydial early protein synthesis rather than route of entry. Infect Immun 1996;1996 :5366–72. 10 Armitage CW, O’Meara CP, Harvie MCG, Timms P, Blumberg RS, Beagley KW.Divergent outcomes following transcytosis of IgG targeting intracellular and extracellular chlamydial antigens. Immunol Cell Biol 2014;92 417–26. 11 Lyons JM, Ito JI Jr, Morre SA. Chlamydia trachomatis serovar E isolates from patients with different clinical manifestations have similar courses of infection in a murine model: host factors as major determinants of C. trachomatis mediated pathogenesis. J Clin Pathol 2004;57:657–9. 12 Carlson JH, Hughes S, Hogan D et al. Polymorphisms in the Chlamydia trachomatis cytotoxin locus associated with ocular and genital isolates. Infect Immun 2004;72:7063–72. 13 Balin BJ, Gerard HC, Arking EJ et al. Identification and localization of Chlamydia pneumoniae in the Alzheimer’s brain. Med Microbiol Immunol 1998;187:23–42. 14 Hammond CJ, Hallock LR, Howanski RJ, Appelt DM, Little CS, Balin BJ. Immunohistological detection of Chlamydia pneumoniae in the Alzheimer’s disease brain. BMC Neurosci 2010;11:121. 15 Braun J, Laitko S, Treharne J et al. Chlamydia pneumoniae–a new causative agent of reactive arthritis and undifferentiated oligoarthritis. Ann Rheum Dis 1994;53:100–5. 16 Flego D, Bianco M, Quattrini A et al. Chlamydia pneumoniae modulates human monocyte-derived dendritic cells functions driving the induction of a Type 1/Type 17 inflammatory response. Microbes Infect 2013;15:105–14. 17 Lee HY, Schripsema JH, Sigar IM, Murray CM, Lacy SR, Ramsey KH. A link between neutrophils and chronic disease manifestations of Chlamydia muridarum urogenital infection of mice. FEMS Immunol Med Microbiol 2010;1 :108–16.
Scandinavian Journal of Immunology, 2015, 82, 48–54
Chlamydia pneumoniae and Chlamydia Trachomatis Infection Differentially Modulates Human Dendritic Cell Line (MUTZ) Differentiation and Activation C. W. Armitage, C. P. O’Meara & K. W. Beagley
Abstract Institute of Health and Biomedical Innovation, Queensland University of Technology, Kelvin Grove, Qld, Australia
Received 17 November 2014; Accepted in revised form 19 March 2015 Correspondence to: Dr K. W. Beagley, Institute of Health and Biomedical Innovation, Queensland University of Technology, 60 Musk Avenue, Kelvin Grove, Qld, 4059, Australia. E-mail: [email protected]
Chlamydia trachomatis and Chlamydia pneumoniae are important human pathogens that infect the urogenital/anorectal and respiratory tracts, respectively. Whilst the ability of these bacteria to infect epithelia is well defined, there is also considerable evidence of infection of leucocytes, including dendritic cells (DCs). Using a human dendritic cell line (MUTZ), we demonstrate that the infection and replication of chlamydiae inside DCs is species and serovar specific and that live infection with C. pneumoniae is required to upregulate costimulatory markers CD80, CD83 and human leucocyte antigen (HLA)-DR on MUTZ cells, as well as induce secretion of interleukin (IL)-2, IL-6, IL-8, IL-12 (p70), interferongamma and tumour necrosis factor-alpha Conversely, C. trachomatis serovar D failed to upregulate DC costimulatory markers, but did induce secretion of high concentrations of IL-8. Interestingly, we also observed that infection of MUTZ cells with C. pneumoniae or C. trachomatis serovar L2, whilst not replicative, remained infectious and upregulated lymph node migratory marker CCR7 mRNA. Taken together, these data confirm the findings of other groups using primary DCs and demonstrate the utility of MUTZ cells for further studies of chlamydial infection.
Introduction The obligate intracellular bacteria Chlamydia trachomatis and Chlamydia pneumoniae are important human pathogens that infect and cause pathology in the reproductive and respiratory tracts, respectively. Whilst the chlamydiae generally infect mucosal epithelium, there have also been studies revealing Chlamydia spp. can infect a diverse range of leucocytes including professional antigen presenting cells [macrophages, dendritic cells (DCs)], granulocytes (neutrophils [1], mast cells) and lymphocytes (T cells) (reviewed in Beagley et al. [2]). Infection of the immune cells can allow a pathogen to escape from immune surveillance and can also impair the immune response necessary to resolve infection. Dendritic cells play pivotal roles in orchestrating the appropriate immune responses to infection and vaccination. Research has identified that, like epithelial cells, human DCs can also be infected by chlamydiae. Infection of peripheral blood monocyte-derived DCs (MoDC) [cluster of differentiation (CD)14+] with C. pneumoniae has been documented, and these MoDC developed a persistent infection lasting up to 25 days [3]. Similarly, C. trachomatis serovars E and
48
L2 have been shown to infect and survive within MoDCs [4, 5]. Whilst using primary DCs is ideal, there are significant costs, ethical considerations and experimental limitations associated with collecting donor cells. The majority of primary DCs used for research are differentiated from CD14+ monocytes that have been purified from the spleen, or more commonly the peripheral blood, and are then differentiated into DCs with recombinant IL-4 and granulocyte/macrophage colony-stimulating factor (GMCSF). The resulting cell populations are heterogeneous, which can impair experimental reproducibility between researchers. A suitable candidate DC to standardize results is MUTZ-3, a myeloid DC precursor obtained from a male leukaemia patient [6]. Similar to MoDCs, MUTZ-3 cells can be differentiated into mature DCs with IL-4 and GMCSF to display characteristics resembling immature DCs. These immature MUTZ (iMUTZ) cells express low amounts of CD14 and CD34, and intermediate amounts of CD40, CD80, CD86 and HLA-DR [7]. In response to stimuli, they can upregulate CD80, CD83, CD86, HLADR, lymph node migration marker CCR7 and are capable of secreting costimulatory cytokines necessary for CD4+
Ó 2015 John Wiley & Sons Ltd
C. W. Armitage et al. Chlamydia Spp. Infection of a Human Dendritic Cell Line 49 ..................................................................................................................................................................
and CD8+ T cell differentiation [7]. Taken together, these characteristics make MUTZ-3 cells an attractive cell model to study in detail the effects of chlamydial infections on these key immune cells.
Materials and methods Cell lines. All cell lines were maintained in a humidified incubator at 37 °C with 5% atmospheric CO2. MUTZ-3 cells and their growth partner cell line 5637 which secretes growth factors were a generous gift from Dr. Saskia Santegoets and Dr. Rik Scheper (VU University Medical Centre, the Netherlands), and Prof. Tony Cunningham (Westmead Millennium Institute, Australia). The 5637 bladder epithelial cells were maintained in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum, 100 lg/ml streptomycin sulphate and 50 lg/ml gentamycin. A total of 5647-conditioned media was collected as a supernatant and sterilized using a 0.4-lm filter. Conditioned media was then stored in aliquots at 20 °C until required. MUTZ-3 cells were maintained and propagated in MEM-alpha medium containing nucleosides (Invitrogen, Mulgrave, VIC, Australia) and supplemented with 20% heat-inactivated fetal calf serum (FCS), 100 lg/ml streptomycin sulphate, 50 lg/ml gentamycin, 50 lM beta-mercaptoethanol and 10% 0.2-lm-filtered conditioned media from 5637 cells. To differentiate MUTZ-3 cells into the DC phenotype (iMUTZ), MUTZ-3 cells were incubated for 7 days in growth media additionally supplemented with 200 U/ml of recombinant human GM-CSF (Peprotech, Hamburg, Germany) and 1000 U/ml of recombinant human IL-4 (Peprotech). Fresh iMUTZ media was applied every second day until use. McCoy (ATCC: CRL-1696) and HEC1A (ATCC: HTB-112) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in DMEM supplemented with 10% FCS, 100 lg/ml streptomycin sulphate and 50 lg/ml gentamycin. BEAS-2B (ATCC: CRL-9609) lung epithelial cells were a generous gift from Prof. Phillip Hansboro (University of Newcastle, Australia) and were maintained in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum, 100 lg/ml streptomycin sulphate and 50 lg/ml gentamycin. Chlamydia spp.. Chlamydia pneumoniae AR39 (ATCC: 53592), Chlamydia trachomatis serovar D (ATCC:VR-885) and C. trachomatis serovar L2 (ATCC: VR-902B) were purchased from the ATCC and propagated within McCoy cells as previously described [8]. Chlamydial elementary bodies were purified using a discontinuous renografin gradient as previously described [8]. To inactivate Chlamydia spp. without damaging protein structure, Chlamydia in PBS were exposed to ultraviolet (UV) light for two rounds of 20 min. Inactivation was confirmed by the inability to infect McCoy cells. Flow cytometry. Immature MUTZ cells were infected with Chlamydia spp. at a multiplicity of infection (MOI) of
Ó 2015 John Wiley & Sons Ltd
2 or treated with UV–Chlamydia or 100 ng/ml purified Escherichia coli lipopolysaccharide (LPS) (Sigma-Aldrich, Castle Hill NSW, Australia) for 48 h at 37 °C in 5% CO2. Cells were then pelleted by centrifugation at 500 9 g for 5 min. Supernatant was collected for cytokine analysis. Cells were then blocked with 10% human AB serum (Sigma-Aldrich) in PBS for 30 min at 4 °C and then incubated with monoclonal antibodies targeting CD80 (PE), CD83 (FITC), CD86 (APC) or HLA-DR (PE-Cy7). All flow antibodies were purchased from BD PharMingen (North Ryde, NSW, Australia). Control cells were also treated with fluorophore and antibody matched isotype controls. Cells were then washed with PBS, fixed with 4% paraformaldehyde for 20 min at 4 °C and analysed using a FACS-Aria flow cytometer (BD Biosciences, North Ryde, NSW, Australia), and data were analysed using FLOWJO (Treestar Ashland, OR, USA). Cytokine secretion. Supernatant from treated iMUTZ cells was screened using a Bio-Plex Pro Human Cytokine 8-plex Assay (#M50-000007A; Bio-Rad, Gladesville, NSW, Australia) and data collected using a Bio-Plex 200 luminometer (Bio-Rad) as per the manufacturer’s instructions. IL-12 (p70) secretion was determined using a human IL-12 (p70) ELISA kit (ELISAkit.com, Scoresby, Vic., Australia) as per the manufacturer’s instructions. Concentrations of human cytokines were determined from a standard curve supplied with the Bio-Plex and ELISA kit products. Immunofluorescence. HEC1A, BEAS-2B and iMUTZ cells were grown on poly-L-lysine-coated coverslips and infected with C. trachomatis (D or L2) or C. pneumoniae at an MOI of two for 48 h. Cells were fixed with methanol for 10 min, washed twice with PBS and blocked with 10% FCS in PBS for 1 h at room temperature. Cells were then incubated with anti-C. trachomatis LPS IgG-FITC (Cellabs, Brookvalle, NSW, Australia) or anti-C. pneumoniae LPS IgGFITC (Cellabs) for 1 h at room temperature. Cells were then washed three times with PBS and incubated with DAPI for 10 min. Cells were washed twice with PBS and mounted onto slides using Prolong Gold (Invitrogen). Images were taken using a Confocal TCS SP5 microscope (Leica Microsystems; North Ryde, NSW, Australia). Quantitative reverse transcription PCR. iMUTZ cells were infected with Chlamydia spp. (MOI = 2) and RNA collected at 8, 24 and 48 h post-infection. RNA was purified from cells using Trizol (Invitrogen) as per the manufacturer’s instructions. cDNA was synthesized from RNA using Superscript III reverse transcriptase and random hexamers as per the manufacturer’s instructions (Invitrogen). Exon-spanning primer sequences for human CCR7 (forward 50 - GGACCTGGGGAAACCAATGAA -30 , reverse 50 - AGGCTTTAAAGTTCCGCACG -30 , 173 bp) and human GAPDH mRNA (forward 50 - CCACCCATGG CAAATTCC -30 , reverse 50 - TGGGATTTCCATTGATG ACAA -30 , 69 bp) were designed using Primer3 software
50 Chlamydia Spp. Infection of a Human Dendritic Cell Line C. W. Armitage et al. .................................................................................................................................................................. (PubMed Central). All PCRs were optimized and used 10 ng template cDNA, 2 mM MgCl2 and Platinum Taq polymerase (Invitrogen). Quantitative reverse transcription PCR was performed using a Rotorgene thermocycler (Qiagen, Chadstone, VIC, Australia). Conditions for amplification were an initial denaturation of 95 °C for 10 min, followed by 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 74 °C for 30 s. Initial copies per sample were quantified using a standard curve derived from purified PCR amplicons. Viability culture. To determine whether internalized Chlamydia spp. retained infectivity, iMUTZ cells were infected at an MOI of 2 and cells frozen in SPG at 24, 48 and 72 h post-infection. Prior to freezing down, cells were washed twice with PBS containing 100 lg/ml heparin sulphate (Sigma-Aldrich) to remove attached but noninternalized EBs[9]. Thawed cells were lysed by probe sonication and reinfected onto confluent McCoy cells seeded in 96-well plates the previous day. McCoy cells were infected for 48 h prior to fixation, staining and quantification by fluorescent microscopy as previously described [10]. Statistics. Statistics performed using one-way ANOVA with Tukey’s post-test column analysis. *P < 0.05, **P < 0.01, ***P < 0.001.
Results Infection of iMUTZ cells yields viable and infectious C. trachomatis and C. pneumoniae
Chlamydial infection has been reported in primary human MoDCs, and we sought to determine whether the respiratory pathogen C. pneumoniae, and urogenital/anorectal pathogens C. trachomatis serovars D and L2 were capable of infecting iMUTZ cells. Positive controls for C. pneumoniae and C. trachomatis infection were the respiratory epithelial cell BEAS-2B and the uterine epithelial cell HEC1-A. Following infection for 72 h and staining for chlamydial LPS and DNA, small inclusions consistent with C. pneumoniae AR39 were visible localized to the nuclear membrane of BEAS-2B cells (Fig. 1A). Infected iMUTZ cells also had positive LPS staining close to the nucleus, but inclusions were smaller in size suggesting poor or no growth. C. trachomatis serovar D or L2 produced large inclusions when grown in HEC1-A cells, and iMUTZ cells also stained positive but with much smaller inclusions. Within iMUTZ cells, C. trachomatis serovar D had the largest inclusion size compared to other Chlamydia spp. To determine whether the small LPS-positive inclusions were replicating chlamydiae, iMUTZ were again infected with C. pneumoniae and C. trachomatis isolates at an MOI of 2 and samples collected at 24, 48 and 72 h to determine viability (Fig. 1B). Following infection, cells were washed with PBS containing heparin sulphate to release attached but non-internalized elementary bodies (EBs) on the iMUTZ cell surface. When iMUTZ were lysed and
inoculated onto McCoy cell monolayers, culturable C. pneumoniae and C. trachomatis serovar L2 were recovered from infected iMUTZ at all three time points; however, the infection did not increase above the initial inoculum (MOI 2) over 72 h. Conversely, C. trachomatis serovar D was not culturable at 24 h post-infection consistent with the infectious EB differentiating into a non-infectious reticulate body (RB), and the infection then continued to increase to 12 inclusion forming units (IFUs)/cell over the course of 72 h suggesting chlamydial replication, albeit far lower than the 100–1000-fold replication observed in epithelial cells [11]. To determine whether C. pneumoniae or C. trachomatis infection of iMUTZ cells would upregulate the lymph node migratory gene CCR7, RNA was extracted from uninfected cells as well as cells infected for 8, 24 and 48 h and mRNA expression determined by qRT-PCR (Fig. 1C). In C. pneumoniae-infected iMUTZ cells, expression of CCR7 mRNA remained low until 48 h after infection when it increased by 16-fold. Infection with C. trachomatis serovar D failed to increase CCR7 relative to uninfected controls. Infection with C. trachomatis serovar L2 increased CCR7 expression within 8 h, which peaked at a 15-fold increase 24 h post-infection, and was eight-fold higher 48 h after infection. Taken together, these data suggest all Chlamydia spp. tested can infect iMUTZ cells, that only the urogenital isolate C. trachomatis serovar D is capable of replicating, but respiratory C. pneumoniae and anorectal/urogenital C. trachomatis serovar L2 remain as a non-replicative but still infectious form. C. pneumoniae and C. trachomatis L2 also induced upregulation of lymph node homing receptor CCR7 suggesting they would be capable of trafficking infectious chlamydiae to the lymph nodes that drain the lung and anorectal/urogenital tracts. C. pneumoniae infection, but not C. trachomatis infection, upregulates costimulation markers CD80, CD83 and HLA-DR
To determine the effect of C. pneumoniae and C. trachomatis infections on DCs, iMUTZ cells were infected at an MOI of 2 for 48 h, stained with monoclonal antibodies to CD80, CD83, CD86 and HLA-DR, fixed and analysed by flow cytometry (Fig. 2). Gating was performed using whole cell and doublet exclusion (Fig. 2A). LPS maturation of iMUTZ cells upregulated surface expression of CD80 (Fig. 2B), CD83 (Fig. 2C) and HLA-DR (Fig. 2D), but not CD86 (Fig. 2E). C. trachomatis D infection failed to induce expression of any surface markers measured, but interestingly live infection significantly downregulated surface CD86. Importantly only live infection of iMUTZ with C. pneumoniae upregulated surface expression of CD80, CD83 and HLA-DR suggesting this would costimulate T cells towards Th1 and that the mechanism is infection dependent.
Scandinavian Journal of Immunology, 2015, 82, 48–54
C. W. Armitage et al. Chlamydia Spp. Infection of a Human Dendritic Cell Line 51 .................................................................................................................................................................. A
B
C
Figure 1 MUTZ cells are infected with viable Chlamydia spp. and upregulate lymph node migration marker CCR7. (A) BEAS-2B and iMUTZ were infected with C. pneumoniae (MOI 2), and HEC1-A and iMUTZ, with C. trachomatis (D or L2). After 72 h, cells were fixed and stained with DAPI (DNA) and antichlamydial LPS for confocal microscopy. (B) iMUTZ cells were infected with C. pneumoniae or C. trachomatis (D and L2) for 24, 48 and 72 h. Cells were washed twice with PBS + 100 lg/ml of heparin sulphate and stored in SPG. iMUTZ cells were then lysed by sonication and inoculated on McCoy cells for 48 h, fixed, stained and IFUs per tube determined by fluorescent microscopy. (C) iMUTZ cells were infected with C. pneumoniae or C. trachomatis (D and L2) for 8, 24 and 48 h and RNA extracted. Relative fold change in CCR7 mDNA was determined from GAPDH cDNA controls by qRT-PCR. Scale bar = 20 lm. Error bars represent standard error of the mean (n = 3).
C. pneumoniae and C. trachomatis infection of iMUTZ cells leads to secretion of cytokines
As activation costimulation markers were observed in C. pneumoniae-infected iMUTZ cells, we also quantified the secretion of cytokines made in response to infection. Infection with C. pneumoniae led to significant increase in iMUTZ secretion of IL-2 (2.4-fold), IL-6 (35-fold), IL-8 (20-fold), IL-12 (p70) (six-fold), IFN-c (1.8 fold) and TNF-a (88-fold) (Fig. 3). This secretion was significantly dependent on C. pneumoniae being viable as the secretion was absent when iMUTZ cells were incubated with the same dose of UV-inactivated C. pneumoniae. When infected with C. trachomatis serovar D, there was a large 135-fold increase of IL-8 secretion and small 1.5-fold increase in IFN-c secretion.
Ó 2015 John Wiley & Sons Ltd
Discussion Here we report that the human dendritic cell MUTZ-3 cell can be infected with human isolates of C. trachomatis and C. pneumoniae and behave similarly to primary cells. All chlamydial species screened were able to infect and survive within MUTZ cells, which was validated by immunocytochemistry and viability culture of heparin sulphate-washed MUTZ cells lysed and reinfected onto HEp-2 cells. The genital isolate C. trachomatis serovar D was able to infect and replicate within MUTZ cells (MOI 12 following viability culture) but did not upregulate CCR7 suggesting the infected iMUTZ cell would remain within the infected tissue. C. pneumoniae and C. trachomatis L2 were able to infect iMUTZ cells but replicated poorly (with MOIs of 1-2 following viability culture), consistent with previous find-
52 Chlamydia Spp. Infection of a Human Dendritic Cell Line C. W. Armitage et al. ..................................................................................................................................................................
A
B
C
D
E
Figure 2 Expression of DC surface maturation/presentation markers in response to chlamydial infection. iMUTZ cells were treated with LPS, C. trachomatis D (live or inactivated), or C. pnuemoniae (live or inactivated) for 48 h at 37 °C. Cells were then blocked with human AB serum and stained for CD80, CD83, CD86 and HLA-DR. Cells were then fixed with 4% PFA, and flow cytometry was performed. (A) Gating strategy to determine regulation of costimulatory markers on the cell surface. Expression of CD80 (B), CD83 (C), CD86 (D) and HLA-DR (E) was determined. Error bars representative of standard error of the mean (n = 3).
Scandinavian Journal of Immunology, 2015, 82, 48–54
C. W. Armitage et al. Chlamydia Spp. Infection of a Human Dendritic Cell Line 53 .................................................................................................................................................................. A
B
D
E
C
F
Figure 3 Cytokine secretion by C. pneumoniae and C. trachomatis-infected MUTZ cells. (A) Secreted human IL-2, (B) IL-6, (C) IL-8, (D) IL-12 (p70), (E) IFN-c and (F) TNF-a were quantified from the supernatants of MUTZ cells treated for 72 h. (A–C, E–F) Quantified using Bio-Plex and (D) by IL-12 (p70) sandwich ELISA. No significant changes in IL-10 by Bio-Plex (not shown). Error bars representative of standard error of the mean (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001.
ings using primary MoDCs [3–5]. Interestingly, both C. pneumoniae and C. trachomatis L2 upregulated expression of CCR7 mRNA suggesting these infected cells would attempt to migrate to draining lymph nodes. This is not surprising as C. trachomatis L2 is one of the three serovars (L1-3) responsible for lymphatic infection, ulceration and blockage, clinically termed lymphogranuloma venereum. C. trachomatis serovars D-K share 99.5% DNA CDS homology with C. trachomatis serovars L1-3, with most of the difference occurring in C. trachomatis L1-3 deletion of cytotoxin precursors (CT164-CT167) in the plasticity zone [12]. This small loss of genes may account for C. trachomatis L2 ability to disseminate or, conversely, C. trachomatis D-K ability to remain localized to the genital tract. Similar to C. trachomatis L2 dissemination, respiratory C. pneumoniae infection is also thought to disseminate to distant tissues and is associated with atherosclerosis, arthritis and Alzheimer’s disease [13–15]. The mechanism of dissemination is principally due to DCs trafficking infectious Chlamydia spp. and remains poorly understood in human studies. To determine whether maturation and cytokines secretion profile of iMUTZ cells following infection with C. pneumoniae and C. trachomatis was upregulated, cells were infected and surface markers and cytokine secretion quantified. Live C. pneumoniae lead to increased expression of costimulatory surface molecules CD80, CD83 and HLADR as well as secretion of Th1-skewing cytokines IL-12 (p70), IFN-c and TNF-a, but also IL-6. This is consistent
Ó 2015 John Wiley & Sons Ltd
with C. pneumoniae infection of human MoDCs, which also upregulate costimulatory markers (CD80, CD83, CD38), and proinflammatory cytokines (IL-6 and IL-12) [16]. Conversely, infection MUTZ cells with C. trachomatis D did not upregulate costimulatory markers and only secreted IL-2, IL-8 and IFN-c. The large amount of IL-8 secreted (together with no change in CCR7 expression) suggests C. trachomatis D-infected DCs may play an important role in neutrophil chemotaxis, rather than antigen processing and presentation in lymph nodes draining the reproductive tract and warrants further investigation. In mouse models of reproductive tract chlamydial infection, the recruitment of neutrophils is important in clearance of infection, but also leads to the development of fallopian tube/oviduct occlusion and infertility [17]. Taken together, these data support the use of MUTZ-3 cells as potential surrogates for primary cells for future research investigating the host–pathogen relationship between human C. pneumoniae and C. trachomatis infections. The ability of MUTZ-3 cells to be transfected with plasmids/siRNA allows further insights into the host– pathogen relationship within DCs [7]. Furthermore, the mechanism of how C. pneumoniae and C. trachomatis L2 remain infectious but non-replicative within DCs is important to determine, and the ability to indefinitely expand MUTZ cells will help determine which peptides (host versus pathogen) are being presented on HLA-ABC and DR, DB, DQ. The use of MUTZ-3 cells will allow more
54 Chlamydia Spp. Infection of a Human Dendritic Cell Line C. W. Armitage et al. .................................................................................................................................................................. in-depth and manipulative experiments to be performed which are difficult or impossible with senescent postmitotic primary MoDCs.
Acknowledgment The authors wish to thank Prof. Tony Cunningham (Westmead Millennium Institute, Australia) for supplying the MUTZ and 5637 cell lines. The authors have no conflict of interests.
References 1 Rupp J, Pfleiderer L, Jugert C et al. Chlamydia pneumoniae hides inside apoptotic neutrophils to silently infect and propagate in macrophages. PLoS ONE 2009;4:e6020. 2 Beagley KW, Huston WM, Hansbro PM, Timms P. Chlamydial infection of immune cells: altered function and implications for disease. Crit Rev Immunol 2009;29:275–305. 3 Wittkop U, Krausse-Opatz B, Gust TC et al. Fate of Chlamydophila pneumoniae in human monocyte-derived dendritic cells: long lasting infection. Microb Pathog 2006;40:101–9. 4 Matyszak MK, Young JL, Gaston JS. Uptake and processing of Chlamydia trachomatis by human dendritic cells. Eur J Immunol 2002;32:742–51. 5 Gervassi A, Alderson MR, Suchland R, Maisonneuve JF, Grabstein KH, Probst P. Differential regulation of inflammatory cytokine secretion by human dendritic cells upon Chlamydia trachomatis infection. Infect Immun 2004;72:7231–9. 6 Masterson AJ, Sombroek CC, De Gruijl TD et al. MUTZ-3, a human cell line model for the cytokine-induced differentiation of dendritic cells from CD34+ precursors. Blood 2002;15 :701–3. 7 van Helden SF, van Leeuwen FN, Figdor CG. Human and murine model cell lines for dendritic cell biology evaluated. Immunol Lett 2008;15 :191–7.
8 Armitage CW, O’Meara CP, Harvie MC, Timms P, Wijburg OL, Beagley KW. Evaluation of intra and extraepitheilal secretory IgA (SIgA) in chlamydial infections. Immunology 2014;14 :12317. 9 Scidmore MA, Rockey DD, Fischer ER, Heinzen RA, Hackstadt T. Vesicular interactions of the Chlamydia trachomatis inclusion are determined by chlamydial early protein synthesis rather than route of entry. Infect Immun 1996;1996 :5366–72. 10 Armitage CW, O’Meara CP, Harvie MCG, Timms P, Blumberg RS, Beagley KW.Divergent outcomes following transcytosis of IgG targeting intracellular and extracellular chlamydial antigens. Immunol Cell Biol 2014;92 417–26. 11 Lyons JM, Ito JI Jr, Morre SA. Chlamydia trachomatis serovar E isolates from patients with different clinical manifestations have similar courses of infection in a murine model: host factors as major determinants of C. trachomatis mediated pathogenesis. J Clin Pathol 2004;57:657–9. 12 Carlson JH, Hughes S, Hogan D et al. Polymorphisms in the Chlamydia trachomatis cytotoxin locus associated with ocular and genital isolates. Infect Immun 2004;72:7063–72. 13 Balin BJ, Gerard HC, Arking EJ et al. Identification and localization of Chlamydia pneumoniae in the Alzheimer’s brain. Med Microbiol Immunol 1998;187:23–42. 14 Hammond CJ, Hallock LR, Howanski RJ, Appelt DM, Little CS, Balin BJ. Immunohistological detection of Chlamydia pneumoniae in the Alzheimer’s disease brain. BMC Neurosci 2010;11:121. 15 Braun J, Laitko S, Treharne J et al. Chlamydia pneumoniae–a new causative agent of reactive arthritis and undifferentiated oligoarthritis. Ann Rheum Dis 1994;53:100–5. 16 Flego D, Bianco M, Quattrini A et al. Chlamydia pneumoniae modulates human monocyte-derived dendritic cells functions driving the induction of a Type 1/Type 17 inflammatory response. Microbes Infect 2013;15:105–14. 17 Lee HY, Schripsema JH, Sigar IM, Murray CM, Lacy SR, Ramsey KH. A link between neutrophils and chronic disease manifestations of Chlamydia muridarum urogenital infection of mice. FEMS Immunol Med Microbiol 2010;1 :108–16.
Scandinavian Journal of Immunology, 2015, 82, 48–54
![[An isolation procedure of Chlamydia pneumoniae and Chlamydia trachomatis].](/assets/img/hold.png)
