Chitinase 3-Like 1 Promotes Candida albicans Killing and Preserves Corneal Structure and Function by Controlling Host Antifungal Responses Nan Gao, Fu-Shin X. Yu Departments of Ophthalmology and Anatomy and Cell Biology, Wayne State University School of Medicine, Detroit, Michigan, USA

Chitinase 3-like 1 (CHI3L1) has been shown to play a role in promoting antibacterial responses, decreasing tissue injury, and enhancing pulmonary repair. This study sought to elucidate the role of CHI3L1 in augmenting the corneal innate immune response to Candida albicans infection in an animal model of fungal keratitis. Flagellin applied topically 24 h prior to C. albicans inoculation significantly protected the corneal from C. albicans and induced CHI3L1 expression in C57BL/6 mouse corneas. CHI3L1, however, played a detectable but minor role in flagellin-induced protection. While C. albicans keratitis was more severe in the corneas treated with Chi3l1 small interfering RNA (siRNA), corneas treated with recombinant CHI3L1 before C. albicans inoculation had markedly ameliorated keratitis, reduced fungal load, and decreased polymorphonucleocyte (PMN) infiltration in an interleukin 13 receptor ␣2 (IL-13R␣2)-dependent manner. CHI3L1 treatment resulted in the induction of the antimicrobial peptides ␤-defensin 3, CRAMP, and chemokine CXCL10 and its receptor CXCR3 in corneal epithelial cells. Importantly, CHI3L1 administered after C. albicans inoculation also had strong protection against fungal keratitis, suggesting a therapeutic window. This is the first report demonstrating that CHI3L1 is induced during fungal infection, where it acts as an immunomodulator to promote fungal clearance and to regulate antifungal innate immune responses in the cornea.

T

he cornea’s visual properties are exquisitely sensitive to inflammation-mediated damage. The cornea is an immuneprivileged site with multiple anatomical, physiological, and immunoregulatory processes that inhibit many innate and adaptive immune responses (1, 2). As such, a normal cornea is remarkably resistant to infection. However, when the epithelial barrier function is breached (3), which may occur during routine contact lens wear, opportunistic pathogens such as bacteria and fungi gain access to the deeper cellular layers of the epithelium and colonize the cornea (4). This leads to the engagement of intraepithelially expressed Toll-like receptors (TLRs) with invading pathogens (5), resulting in the abrogation of immune privilege and the reactivation of the innate immune response (6). Candida albicans is one such opportunistic pathogen that may cause corneal infection following trauma or surgery or under immunosuppressive conditions, such as the prolonged use of corticosteroids and topical anesthetic abuse (7–12). Although the fungal keratitis is rare, the incidence has increased in recent years, especially in contact lens wearers (13, 14). To date, there is no clinically amenable measure to prevent fungal keratitis. Current practice in treating fungal keratitis involves the use of topical antifungal drops, such as natamycin and amphotericin B. Topical antifungals can have toxic effects, such as punctate keratitis and recurrent corneal epithelial erosions (15). Hence, understanding the pathogenesis of fungal keratitis and host responses will aid in identifying new therapeutics to improve the prognosis of this condition. We previously developed a mouse experimental C. albicans keratitis model (9, 16) and demonstrated that that pre-exposure of the cornea to TLR5 ligand flagellin induces a strong innate defense and promotes robust resistance to corneal infection (17–19). More recently, we showed that flagellin pretreatment followed by Pseudomonas aeruginosa infection resulted in the upregulation of 890 genes and downregulation of another 37 genes (20). Among the 890 upregulated genes, chitinase 3-like 1 (CHI3L1), also

4154

iai.asm.org

termed YKL-40 in humans and BRP-39 in mice (21), is one whose expression is most extensively upregulated by flagellin pretreatment in P. aeruginosa-infected B6 mouse corneal epithelial cells (CECs). CHI3L1 belongs to the 18 glycosyl hydrolase family in mammals, which contains 6 members in humans and 7 in mice (21). Two members, CHIA and CHITI, are true chitinases, while the rest are chitinase-like proteins that lack chitinase activity as a result of mutations in their highly conserved putative enzyme sites (22, 23). Our cDNA array data revealed that among 7 mouse genes, only CHI3L1 exhibited infection-induced and flagellinaugmented expression patterns in the infected corneas (20). CHI3L1 can be readily detected in the circulation of normal individuals. However, its expression is dysregulated in the circulation and/or tissues from patients with a variety of diseases characterized by inflammation and/or tissue remodeling (24). Studies using CHI3L1 knockout mice demonstrated exacerbated inflammation, hemorrhage, and lung injury following Streptococcus pneumoniae infection, indicating the protective role of CHI3L1 in promoting bacterial clearance and augmenting host tolerance (25). In addition, CHI3L1 was found to be a critical regulator of anti-pathogenic activity such as adaptive T helper 2 (Th2) responses (26, 27). It is of interest that in the cornea, the Th2 response promotes

Received 29 July 2015 Accepted 30 July 2015 Accepted manuscript posted online 3 August 2015 Citation Gao N, Yu F-SX. 2015. Chitinase 3-like 1 promotes Candida albicans killing and preserves corneal structure and function by controlling host antifungal responses. Infect Immun 83:4154 –4164. doi:10.1128/IAI.00980-15. Editor: G. S. Deepe, Jr. Address correspondence to Fu-Shin X. Yu, [email protected]. Copyright © 2015, American Society for Microbiology. All Rights Reserved. doi:10.1128/IAI.00980-15

Infection and Immunity

October 2015 Volume 83 Number 10

Chitinase 3-Like 1 and Fungal Keratitis

FIG 1 CHI3L1 expression and distribution in C. albicans-infected corneas with or without flagellin pretreatment. The centers of B6 mouse corneas were gently

scratched with 26-gauge needles (1 mm long; 3 lines) followed by topical application of 500 ng flagellin dissolved in 5 ␮l PBS or of 5 ␮l PBS alone to the injury sites at ⫺24 h. At 0 h, corneas were then scratched again and inoculated with 1.0 ⫻ 105 CFU of C. albicans. A naive cornea and C. albicans-infected corneas pretreated with flagellin (Fla-CA) or the control PBS (CA) were excised at 6 hpi and subjected to RNA isolation and real-time PCR analysis (A) and to immunohistochemistry using CHI3L1 antibody and DAPI for nuclear staining (B). (A) Increase (fold) over levels in naive corneas after normalization to the levels of ␤-actin as the internal control; error bars show standard deviations. The results are representative of two independent experiments, each with 3 corneas. *, P ⬍ 0.05; **, P ⬍ 0.01 (one-way ANOVA). (B) Immunohistochemical analysis of CHI3L1. The excised corneas were embedded in OCT and sectioned (6-␮m thickness). The sections were stained with CHI3L1 (1:100) (left) or with DAPI for nuclei (right; merged). Two independent experiments were performed; one representative image for each condition is presented. E, epithelium. Strong staining of CHI3L1 at the early stage of infection (6 hpi) in flagellin-pretreated corneas in the epithelium can be seen.

tissue resistance to P. aeruginosa ocular infections (28). At present, whether CHI3L1 plays a role in fungal infection is unknown. In this study, we sought to define the role of CHI3L1 in corneal innate immunity using a mouse model of C. albicans keratitis. We showed that CHI3L1 expression was induced in response to C. albicans infection and that flagellin pretreatment greatly augmented this upregulation in B6 mouse corneas. While the downregulation of CHI3L1 increases the severity of C. albicans keratitis, recombinant CHI3L1 prevented corneal infection through its ability to induce the expression of antimicrobial peptides (AMPs) and the chemokine CXCL10, which was recently shown to control fungal burden in a CXCR3-dependent manner (29), in the corneas. Our results reveal that CHI3L1 plays a role in regulating mucosal innate immunity against fungal infection and that it might be developed as an adjuvant treatment for microbial keratitis. MATERIALS AND METHODS Candida strain. C. albicans strain SC5314, a clinical isolate capable of producing experimental keratomycosis, was cultured on YPD (yeast-peptone-dextrose) agar (Sigma) for 3 days at 25°C. Colonies were harvested after 3 days of inoculation and diluted in sterile phosphate-buffered saline (PBS). We established a conversion factor for optical density at 600 nm (OD600), 1 OD unit ⫽ 6.73 ⫻107 CFU/ml, by measuring OD600 values of PBS containing

October 2015 Volume 83 Number 10

different concentration of C. albicans strain SC5314, followed by serial dilution and standard plate count to enumerate fungi in the solutions. Animals, corneal infection procedure, and clinical scoring. Wildtype C57BL/6 mice (8 weeks of age; 20 to 24 g) were purchased from The Jackson Laboratory. Animals were treated in compliance with the ARVO Statement on the Use of Animals in Ophthalmic and Vision Research. The Institutional Animal Care and Use Committee of Wayne State University approved all animal procedures. For corneal infection, mice were anesthetized, and the corneas were gently scratched with three 1-mm incisions using a sterile 26-gauge needle. To each cornea, a 5-␮l suspension containing a 1 ⫻ 105 CFU of C. albicans strain SC5314 was applied to the surface of the scarified cornea. The anesthetized mice were kept on a fixed position with the instilled solution remaining on the ocular surface until they awakened (⬎20 min). Clinical examination was performed with corneal photography and clinical scoring as described previously (30). Ocular disease was graded in clinical scores (0 to 12), according to the scoring system we adapted from the work of Wu et al. (18, 30, 31). Fungal load determination and MPO measurement. We used our previously modified methods that allowed three assays (fungal load, myeloperoxidase [MPO] determination, and enzyme-linked immunosorbent assay [ELISA] detection of cytokines) to be performed with a single mouse cornea. Briefly, the corneas were excised from the enucleated eyes, minced, and homogenized in 100 ␮l PBS. The homogenates were divided into two parts, one for plate fungal counting and the other for cytokine ELISA and myeloperoxidase measurements (18).

Infection and Immunity

iai.asm.org

4155

Gao and Yu

FIG 2 siRNA-mediated downregulation of C. albicans-induced CHI3L1 in B6 mouse corneas. B6 mice were subconjunctivally injected with 5 ␮l control or

CHI3L1-specific siRNA (10 ␮M) once at ⫺24 and once at ⫺4 h. At 0 h, the corneas were inoculated with 1.0 ⫻ 105 CFU of C. albicans as described for Fig. 1. At 1 dpi, naive and C. albicans-infected corneas were excised and subjected to immunohistochemistry analysis using CHI3L1 antibody and DAPI for nuclear staining. The micrographs are representative of images from 3 corneas for each condition; two independent experiments were performed. E, epithelium; arrow, C. albicans invasion site. While no CHI3L1 was detected in the naive and CHI3L1 siRNA-treated, noninfected corneas, abundant expression of CHI3L1 was seen in the control siRNA- but not the CHI3L1 siRNA-treated, infected corneas; the latter had much more tissue damage than the control.

Real-time PCR. Mouse cornea RNA was extracted using an RNeasy minikit (Qiagen), according to the manufacturer’s instructions. cDNA was generated with an oligo(dT) primer (Invitrogen) followed by analysis using real-time PCR with the Power SYBR green PCR master mix (AB Applied Biosystems, University Park, IL) based on the expression of ␤-actin. Generated cDNA was amplified by PCR by using primers for mouse CHI3L1, IL-1␤, SLPI, BD3, IL-1Ra, CXCL10, CXCR3, and ␤-actin as the internal control. The PCR primers were as follows: mChi3l1, GTACAAG CTGGTCTGCTACTT (forward) and ATGTGCTAAGCATGTTGTCGC (reverse); mIL-1␤, AAGGAGAACCAAGCAACGACAAAA (forward) and TGGGGAACTCTGCAGACTCAAACT (reverse); mSLPI, CCTGCG GCCTTTTACCTTTC (forward) and GCTTCCTCCACACTGGTTTG (reverse); mBD3, GTCTCAGTCATGAGGATCCATTACCT (forward) and GCTAGGGAGCACTTGTTTGCATTTAA (reverse); mIL1RA, GGG ACCCTACAGTCACCTAA (forward) and GGTCCTTGTAAGTACCC AGAC (reverse); mCXCL10, ATGAACCCAAGTGCTGCCGTC (forward) and TTAAGGAGCCCTTTTAGACCTTT (reverse); mCXCR3, TA CCTTGAGGTTAGTGAACGTCA (forward) and CGCTCTCGTTTTCC CCATAATC (reverse); and m␤-actin, GACGGCCAGGTCATCACT ATTG (forward) and AGGAAGGCTGGAAAAGAGCC (reverse). Immunohistochemistry. At various times, the corneas were excised from sacrificed mice and frozen in OCT compound; the posterior segment, along with the lens, was removed after the global parts were just frozen. The corneas were cut into 6-␮m-thick sections by cryostat sectioning. The sections were mounted on polylysine-coated glass slides. Immunohistochemistry was performed as described previously (18–20), using IL13Ra2 (R&D Systems), CHI3L1 (R&D Systems), CXCL10 (1:100;

4156

iai.asm.org

Peprotech), and CXCR3 (1:250; Abnova), followed by Cy3- and fluorescein isothiocyanate (FITC)-conjugated secondary antibodies (Jackson ImmunoResearch, Inc.). Slides were mounted with 4=,6=-diamidino-2-phenylindole (DAPI) mounting medium. Controls were similarly treated, but the primary antibody was replaced with nonspecific rabbit IgG. CHI3L1 knockdown or recombinant protein application. Mice were anesthetized as prescribed previously (18–20), and 500 ng CHI3L1 recombinant protein was injected subconjunctivally 4 h before or 3 h after C. albicans infection. For CHI3L1 knockdown, mice were injected subconjunctivally with 5 ␮l small interfering RNA (siRNA) (10 ␮M) at ⫺1 day and reinjected with 5 ␮l siRNA 4 h prior to infection. Statistical analysis. Data are presented as means and standard deviations. Statistical differences among three or more groups were identified using one-way analysis of variance (ANOVA). Differences were considered statistically significant at a P value of ⬍0.05. Between two groups, an unpaired, two-tailed Student’s t test was used to determine statistical significance for data from fungal counts, cytokine ELISA, and the MPO assay. A nonparametric Mann-Whitney U test was performed to determine statistical significance for clinical scores. Experiments were repeated at least twice to ensure reproducibility.

RESULTS

Infection induced CHI3L1 expression is augmented by flagellin pretreatment. Our genome-wide cDNA array study (20) revealed that bacterial infection induced CHI3L1 expression, which was further augmented by flagellin pretreatment. We used PCR and

Infection and Immunity

October 2015 Volume 83 Number 10

Chitinase 3-Like 1 and Fungal Keratitis

FIG 3 Effects of altering CHI3L1 expression on C. albicans keratitis. B6 mice were either treated with siRNAs as described in Fig. 2 or subconjunctivally injected with 5 ␮l recombinant CHI3L1 protein (100 ng/␮l) or BSA as a control at ⫺4 h. The treated corneas were then inoculated with 1.0 ⫻ 105 CFU of C. albicans. a, control siRNA; b, Chi3l siRNA; c, BSA; d, recombinant CHI3L1. The infected corneas were photographed at 1 and 3 dpi (A) under a dissection microscope and are representative of 5 corneas (arrowheads [b], melting points). Disease severity is represented by clinical scores assessed at 1 and 3 dpi, where the horizontal line represents the mean clinical score. A nonparametric Mann-Whitney U test was performed to compare CHI3L1 manipulated groups to the controls (B). A group of mice (n ⫽ 5) were euthanized at either 1 or 3 dpi; the corneas were excised. Three corneas were processed for the standard plate count to determine the number of fungi in each cornea; the results are CFU per cornea (C) and MPO level (units/cornea) (D). Two excised corneas were processed for immunohistochemistry, as described for Fig. 1, and stained with NIMP-R14 antibody for neutrophils and DAPI for nuclei (E). The results are representative of two independent experiments. *, P ⬍ 0.05; **, P ⬍ 0.01 (one-way ANOVA). Note the severe keratitis in CHI3L1 knockdown corneas and extensive protection by recombinant CHI3L1.

immunohistochemistry to confirm CHI3L1 expression in response to C. albicans infection and flagellin pretreatment in B6 mouse corneas (Fig. 1). Real-time-PCR (Fig. 1A) revealed an expression pattern similar to that detected by the cDNA array: infection moderately increased CHI3L1 mRNA expression, which was greatly enhanced by flagellin pretreatment. Immunohistochemistry showed that while there was little staining for CHI3L1 in the normal control and some staining in C. albicans-infected corneas at 6 h postinfection (hpi), the whole epithelial layer was positively stained with CHI3L1 with higher intensity at the apical layer in flagellin-pretreated corneas (Fig. 1B). CHI3L1 plays a role in controlling the severity of C. albicans keratitis. Having shown infection-induced CHI3L1 expression in the cornea, we next assessed the function of CHI3L1 using sub-

October 2015 Volume 83 Number 10

conjunctival injections of either recombinant protein or CHI3L1 siRNA (32). To each mouse cornea, CHI3L1 siRNA or recombinant protein was injected subconjunctivally 4 h or 24 h prior to C. albicans inoculation, respectively. Figure 2 shows the downregulation of CHI3L1 by Chi3l1-specific siRNA. There was no detectable staining of CHI3L1 in the naive cornea (Fig. 2A), and CHI3L1 knockdown did not cause any visible changes in corneal morphology (Fig. 2B). In the infected, control siRNA-treated cornea, the epithelium was intact, albeit thinner, with abundant CHI3L1 staining; many infiltrated cells were also CHI3L1 positive at 24 hpi (Fig. 2C). In the infected, Chi3l1 siRNA-treated cornea, the epithelium was broken and detached, with massive infiltrations in the stroma; there was little staining of CHI3L1 (Fig. 2D), indicative of successful knockdown by siRNA.

Infection and Immunity

iai.asm.org

4157

Gao and Yu

FIG 4 siRNA-mediated downregulation of IL-13R␣2 in B6 mouse corneas. B6 mouse corneas were treated with control and IL-13R␣2 siRNA, followed by C. albicans inoculation as described in Fig. 2. At 1 dpi, naive and C. albicans-infected, control or IL-13R␣2 siRNA-treated corneas were subjected to immunohistochemistry analysis using IL-13R␣2 antibody and DAPI for nuclear staining. The micrographs are representative of images from 3 corneas for each condition; two independent experiments were performed. E, epithelium. IL-13R␣2 was primarily expressed in the basal epithelial cells as well as some infiltrated cells of infected corneas, and IL-13R␣2 siRNA downregulated its expression, resulting in more edema and tissue damage.

Figure 3 shows C. albicans keratitis severity in CHI3L1 siRNAand recombinant protein-treated corneas. At 1 and 3 days postinfection (dpi), infected corneas were photographed and processed for fungal count and other analyses. The control corneas, subconjunctivally injected with either nonspecific siRNA (condition a) or bovine serum albumin (BSA) (condition c), were partially opaque; little change was observed from 1 dpi to 3 dpi in either slit lamp microscopy images (Fig. 3A) or clinical scores (Fig. 3B). CHI3L1 siRNA-treated corneas (condition b) exhibited more severe keratitis with multiple foci of corneal melting (Fig. 3B, arrowheads), compared to nonspecific-siRNA-treated corneas. Corneas that received recombinant CHI3L1 (condition d), on the other hand, showed few signs of infection or inflammation (Fig. 3A), with clinical scores significantly lower than those of the controls at 1 dpi and more so at 3 dpi (Fig. 3B). As shown in Fig. 3C, while ⬃2 ⫻ 103 CFU C. albicans organisms were detected in the control corneas, depletion of CHI3L1 resulted in an increase in fungal load of ⬃2.4-fold (Fig. 3C). In recombinant-CHI3L1-pretreated corneas, a 5.2-fold decrease in fungal load was detected (396 ⫾ 86 CFU), indicating that C. albicans was able to colonize in the injured corneas in the presence of CHI3L1. At 3 dpi, only CHI3L1downregulated corneas had few recoverable C. albicans, a marked decrease in the number of pathogens that remained in the cornea compared to 1 dpi. For polymorphonucleocyte (PMN) infiltration detected by the MPO assay, it was found that while Chi3l1 siRNA greatly exacerbated PMN infiltration, recombinant CHI3L1 diminished it in the infected corneas (Fig. 3D). At 3 dpi, although the pathogen load was low, the levels of PMN in CHI3L1 siRNAtreated corneas remained high, consistent with the high clinical

4158

iai.asm.org

scores (Fig. 3B). PMN infiltration was further confirmed with immunohistochemistry using a NIMP-R14 antibody: an increase was observed in CHI3L1 siRNA-treated corneas, while a decrease occurred in recombinant CHI3L1-treated corneas at 1 dpi (Fig. 3E). Taken together, the results showed that CHI3L1 may regulate innate defense against C. albicans infection in B6 mouse corneas. CHI3L1 exerts protective effects through IL-13 receptor ␣2 in the corneal epithelium. CHI3L1 is a secreted protein with a well-defined signal sequence (33). To function as an immunomodulator, it is expected to transmit its signal through a cell surface receptor. There are two presumable receptors of CHI3L1, IL-13R␣2 (34) and protease-activated receptor 2 (PAR2) (35). CHI3L1 was shown to play a critical role in antipneumococcal responses, including augmenting bacterial clearance (23) in an IL-13R␣2-dependent manner (34). Therefore, we focused on IL13R␣2 and employed an siRNA approach. Figure 4 shows IL13R␣2 knockdown in C. albicans-infected corneas, as detected by immunohistochemistry. In the naive corneas, IL-13R␣2 was expressed in multiple layers of the epithelium: at the basal side of basal cells and at cell-cell junctions. In infected cells, IL-13R␣2 was detected mostly in the basal epithelial cells, with strong staining at cell-cell junctions. At what appeared to be the site of C. albicans invasion, IL-13R␣2 was expressed in multiple layers of cells. In IL-13R␣2 knockdown corneas, tissue edema and damage were apparent and no cell-specific IL-13R␣2 expression was detected, indicating successful downregulation by siRNA treatment. Figure 5 shows the severities of C. albicans keratitis in the corneas treated with IL-13R␣2 siRNA. In IL-13R␣2-downregulated corneas, the severities of keratitis were higher than those in the

Infection and Immunity

October 2015 Volume 83 Number 10

Chitinase 3-Like 1 and Fungal Keratitis

FIG 5 Effects of IL-13R␣2 downregulation on C. albicans keratitis and on CHI3L1-mediated protection. B6 mice were subconjunctivally injected with 5 ␮l of

control or CHI3L1-specific siRNA (10 ␮M) twice at ⫺24 and then ⫺6 hpi. At ⫺4 hpi, the mice were divided into two groups; one group was subconjunctivally injected with CHI3L1 recombinant protein (500 ng/cornea), and another group received the same amount of BSA to serve as a control. At 0 hpi, the corneas were inoculated with 1.0 ⫻ 105 CFU C. albicans. a, control siRNA; b, control siRNA and recombinant CHI3L1; c, IL-13R␣2 siRNA; d, IL-13R␣2 siRNA and recombinant CHI3L1. The infected corneas (n ⫽ 5) were photographed at 1 dpi (A), and the disease severity is represented by clinical scores analyzed with the nonparametric Mann-Whitney U test (B). The corneas were then excised and subjected to a standard plate count to determine the number of fungus in each cornea (C) and MPO level (units/cornea) (D). The results are representative of two independent experiments. **, P ⬍ 0.01 (one-way ANOVA). IL-13R␣2 downregulation increased the severity of fungal keratitis and abolished recombinant-CHI3L1-mediated protection.

control siRNA-treated corneas, with significantly increased clinical scores, fungal burden, and PMN infiltration. To determine if protection mediated by exogenously added CHI3L1 is through IL-13R␣2, a group of mice were treated with 500 ng/ml recombinant CHI3L1. In the control siRNA-treated corneas, exogenous CHI3L1 ameliorated C. albicans keratitis, as shown in Fig. 3. In IL-13R␣2-downregulated corneas, CHI3L1 made no significant difference in keratitis severity, as determined by clinical scores, fungal burden, and PMN infiltration, suggesting that CHI3L1 functions through IL-13R␣2 in corneal fungal infection. Taken together, our data indicate that CHI3L1 functions as an immunomodulator, rather than an effector. CHI3L1 plays a minor role in flagellin-induced protection in B6 mouse corneas. Having shown that flagellin augments the expression of CHI3L1 and that the presence of recombinant CHI3L1 promotes innate defense against C. albicans infection in the cornea, we then assessed whether CHI3L1 is required for flagellininduced protection. The corneas were first treated with Chi3l1 or control siRNA by subconjunctival injection and then pretreated with 500 ng flagellin 24 h before C. albicans inoculation. Figure 6 shows that whereas flagellin pretreatment prevented C. albicans infection, CHI3L1 siRNA, as shown above (Fig. 3), increased the severity of fungal keratitis at 24 hpi. In CHI3L1 siRNA-treated corneas, flagellin remained effective in inducing protection against C. albicans infection, with a reduced clinical score, greatly increased fungal clearance, and markedly decreased MPO activity compared to those of the CHI3L1 siRNA-treated controls. However, while flagellin pretreatment alone resulted in total eradication of C. albicans, each of 5 corneas treated with CHI3L1 siRNA and flagellin had more than 100 (120 to 300) recoverable C. albicans organisms, indicative of a minor but nevertheless detectable role of

October 2015 Volume 83 Number 10

CHI3L1 in flagellin-induced protection against C. albicans in B6 mouse corneas. CHI3L1 stimulates the expression of antimicrobial peptides and anti-inflammatory factor in the cornea. In vivo studies were next undertaken to determine if CHI3L1, as an immunomodulator, alters corneal response to infection by assessing the expression of AMPs, proinflammatory cytokine IL-1␤, and IL-1 receptor antagonist (IL-1Ra) (Fig. 7). Exposure of the cornea to CHI3L1 resulted in the upregulation of mBD3 (mouse ␤-defensin 3), CRAMP (cathelin-related antimicrobial peptide), and SLPI (secretory leukocyte protease inhibitor). C. albicans infection led to the upregulation of SLPI with or without CHI3L1 pretreatment, while its presence augmented the expression of mBD3 and CRAMP significantly. CHI3L1 alone induced moderate expression of IL-1␤ (1.734-fold) and a more robust expression of IL-1Ra (6.5499-fold). C. albicans infection resulted in marked increases in both IL-1␤ and IL-1Ra, while exogenous CHI3L1 significantly dampened IL-1␤ but not IL-1Ra expression in infected corneas, suggesting that CHI3L1 alters the balance between IL-1␤ and IL1Ra. Overall, these data demonstrate that CHI3L1 plays an anti-inflammatory role in response to C. albicans infection in the cornea. CXCL10 and CXCR3 expression in B6 mouse corneas in response to C. albicans infection. Our recent studies of P. aeruginosa keratitis identified CXCL10 as a major chemokine induced by infection and augmented by flagellin pretreatment in a gamma interferon- and interferon regulatory factor 1 (IRF1)-dependent manner (30). We also found that epithelium-expressed CXCL10 had fungicidal activity and played a role in C. albicans eradication in mouse corneas (29). We next investigated whether CHI3L1 regulates CXCL10 expression and CXCR3 signaling in vivo. At the

Infection and Immunity

iai.asm.org

4159

Gao and Yu

FIG 6 Effects of CHI3L1 downregulation on flagellin-induced protection. B6 mouse corneas were pretreated with flagellin or PBS at ⫺24 h as described in Fig. 1, followed by subconjunctival injection of CHI3L1-specific siRNA once at ⫺24 and once at ⫺4 h. At 0 h, the corneas were inoculated with 1.0 ⫻ 105 CFU of C. albicans. Eyes were photographed and scored (numbers are given in each panel) at 24 hpi. The corneas were excised and subjected to a standard plate count to determine the number of fungi in each cornea and MPO level (units/cornea) (C). The results are representative of two independent experiments (n ⫽ 5 each), and P values were generated using one-way ANOVA. **, P ⬍ 0.01.

mRNA levels (Fig. 8A), CHI3L1 treatment and infection each resulted in the induction of CXCL10 and CXCR3 in the cornea. Treatment of corneas with CHI3L1, followed by C. albicans infection, resulted in a marked increase in CXCL10 expression. However, there were no significant differences in CXCR3 expression in infected corneas with or without CHI3L1 treatment. At the protein level (Fig. 8B), no expression of CXCL10 and CXCR3 was detected in the naive cornea. CHI3L1 alone induced CXCL10 and CXCR3 expression at 4 h, mostly in the basal layers of the epithelium. This is different from flagellin-treated corneas, where CXCR3-positive cells were found in the stroma beneath the epithelium (29). At 1 dpi, as shown above, CXCL10 was mostly expressed in the damaged epithelium, while CXCR3 was found in the infiltrating cells in the stroma or in an intraepithelial cell cluster that contained mainly natural killer cells and neutrophils (29). Interestingly, exogenous CHI3L1 markedly increased epithelial expression of CXCL10 and the number of CXCR3-positive cells in the stroma. Hence, the CXCL10-CXCR3 signaling axis is, at least in part, regulated by CHI3L1in mouse corneas in response to infection. Postinfection application of CHI3L1 ameliorates C. albicans keratitis in B6 mice. In the aforementioned experiments, CHI3L1 was applied to the cornea prior to C. albicans inoculation. To ensure that the results were clinically relevant, we next investigated whether postinfection application of CHI3L1 protects corneas from fungal keratitis, using subconjunctival injections of 500 ng/cornea recombinant CHI3L1 (Fig. 9). At 1 dpi, the BSA-con-

4160

iai.asm.org

taining PBS-treated eyes showed significant keratitis, with a mean clinical score of 5.5 ⫾ 0.58, whereas the CHI3L1-treated corneas exhibited low levels of inflammation with a few small areas of faint opacification (Fig. 9A) and a much lower clinical score of 0.75 ⫾ 0.50. Moreover, postinfection application of CHI3L1 significantly decreased the fungal burden (Fig. 9B), with averages of 1,772 ⫾ 452 CFU in the control and 30 ⫾ 20 CFU in CHI3L1-treated corneas, and decreased PMN infiltration in the latter (Fig. 9C) at 1 dpi, suggesting that CHI3L1 is capable of inducing protection against C. albicans keratitis even after the infection has occurred in the cornea. DISCUSSION

CHI3L1 is a multifunctional protein that has been implicated as a critical regulator of anti-infectious and adaptive T helper 2 (Th2) responses (18, 24). Using a C. albicans keratitis model, we tested the hypothesis that CHI3L1 plays a role in antifungal responses. These studies demonstrate that C. albicans infection stimulates corneal epithelial CHI3L1 production. Recombinant CHI3L1 applied prior to C. albicans inoculation greatly reduced the severity of fungal keratitis, including markedly decreased fungal load and corneal inflammation. siRNA downregulation of CHI3L1, on the other hand, resulted in a more severe fungal keratitis, including persistent inflammation and corneal melting, but, surprisingly, was less effective at reducing fungal load. CHI3L1 required IL13R␣2 for signal transduction, as its downregulation increased fungal keratitis severity in B6 mouse corneas and abolished exog-

Infection and Immunity

October 2015 Volume 83 Number 10

Chitinase 3-Like 1 and Fungal Keratitis

FIG 7 Effects of CHI3L1 on the expression of BD3, CRAMP, SLPI, IL-1␤, and IL-1Ra in B6 mouse corneas in response to C. albicans infection. B6 corneas were treated with CHI3L1 or BSA for 24 h and then either directly processed for real-time PCR analysis or inoculated with C. albicans. The infected corneas were excised and subjected to real-time PCR analysis at 24 hpi. The results are presented as the increase (fold) over the value for BSA-treated and noninfected corneas (set at 1) after normalization to the level of ␤-actin as the internal control. BD3 and CRAMP results are based on the scale on the left and SLPI, IL-1␤, and IL-1Ra results use the scale on the right. The results are representative of two independent experiments, each with 3 corneas. *, P ⬍ 0.05; **, P ⬍ 0.01 (one-way ANOVA). CHI3L1 and infection caused differential expression of AMPs and IL-1␤ signaling.

enous CHI3L1’s ability to enhance innate protection. Consistent with the notion that it is an immunomodulator, CHI3L1 was shown to induce significant upregulation of AMPs, SLPI, ␤-defensin-3, and CRAMP. It also exhibited differential effects on the expression of IL-1␤ and the natural inhibitor IL-1Ra in mouse corneas in response to infection. Moreover, CHI3L1 stimulated the expression of multifaceted CXCL10 and its receptor CXCR3 in the epithelium and further enhanced epithelial expression of CXCL10 in response to C. albicans infection. Taken together, our results suggest that CHI3L1 plays an important regulatory role through IL-13R␣2 in promoting corneal innate immunity against C. albicans infection. CHI3L1 is known not to be expressed under physiological conditions but is induced in patients with inflammatory diseases and cancer (35–37) It has been identified as a serum protein with high concentrations in inflammatory diseases, and the elevated levels have been correlated with poor prognosis and a shorter survival of patients with cancer (38, 39). A recent study reported that CHI3L1 played a protective role in lung injury by ameliorating inflammation and accelerating repair by augmenting alternative macrophage activation, fibroblast proliferation, and matrix deposition (40). In studies of infection, CHI3L1 was reported to promote

October 2015 Volume 83 Number 10

Streptococcus pneumoniae killing and augment host tolerance to lung antibacterial responses (23). Our studies have revealed that CHI3L1 expression was induced in response to P. aeruginosa (20) and C. albicans (this study) infection. Moreover, CHI3L1 was mostly expressed in the epithelium in which the invading C. albicans are trapped and eradicated within 3 dpi (29). This markedly elevated expression of CHI3L1 in flagellin-pretreated corneas implicates its protective role(s) in response to infection. By downregulating or exogenously applying CHI3L1 in the cornea, we unambiguously demonstrated that CHI3L1 plays a protective role in C. albicans keratitis. CHI3L1 knockdown greatly increased the severity of C. albicans keratitis, including significantly increased clinical scores and PMN infiltration, as assessed by the levels of MPO at both 1 and 3 dpi. The pathogenesis of keratitis observed in CHI3L1-downregulated mice is similar to that observed in CHI3L1 knockout mice, in which pulmonary infection of Streptococcus pneumoniae resulted in severe pneumonia, increased neutrophil infiltration, and elevated level of MPO (23). Interestingly, while clinical scores and PMN infiltration remained high and largely unchanged from 1 dpi to 3 dpi, the fungal load in CHI3L1 siRNA-treated corneas was greatly decreased, from 5,000 to about 100 CFU C. albicans organisms per cornea.

Infection and Immunity

iai.asm.org

4161

Gao and Yu

FIG 9 Effects of postinfection application of CHI3L1 on C. albicans keratitis. Mouse corneas were inoculated with 1.0 ⫻ 105 CFU of C. albicans. Three hours after inoculation, 500 ng recombinant CHI3L1 or BSA in 5 ␮l PBS was injected into the subconjunctival space. Eyes were photographed and scored (scores are shown in each micrograph) at 24 hpi (A). The corneas were excised and subjected to the standard plate count to determine the number of fungi in each cornea (B) and MPO level (units/cornea) (C). The results are means and standard deviations (n ⫽ 5) and are representative of two independent experiments. **, P ⬍ 0.01 (Student’s t test).

FIG 8 CXCL10 and CXCR3 expression and distribution in C. albicans-infected corneas with or without CHI3L1 pretreatment. The corneas from Fig. 7 were also subjected to real-time PCR to determine the expression of CXCL10 (A) and CXCR3 (B) at the mRNA level. The results are representative of two independent experiments, each with 3 corneas. **, P ⬍ 0.01 (one-way ANOVA). (C) Two corneas from each condition described for Fig. 7 were used for immunohistochemistry to detect the expression and distribution of CXCL10 and CXCR3 in uninfected corneas treated with CHI3L1 (b) or with BSA as the control (a) and in infected corneas treated with BSA (c) or with CHI3L1 (d). The corneal sections were costained with anti-CXCL10 (red) or anti-CXCR3 (green) antibodies or DAPI (blue) for nuclei. The DAPI staining was merged with CXCL10 and CXCR3 images. Two independent experiments were performed. Arrowhead, aggregation of infiltrative cells. In noninfected corneas, CHI3L1 induced CXCL10 and CXCR3 expression in the basal epithelium, whereas in infected corneas, it enhanced CXCL10 expression in the epithelial layer and CXCR3 in the infiltrated cells in the stroma.

Hence, it appears that endogenous CHI3L1 was involved in inflammation resolution while invading pathogens were being eradicated by the inherent innate microbial killing mechanisms in the corneas. The addition of recombinant CHI3L1 to the control mice, on the other hand, resulted in reduced severity of infection, with opacification in a small area, markedly reduced fungal burden, and moderately decreased PMN infiltration at 1 dpi and no keratitis at 3 dpi. Taken together, our data show for the first time a role of CHI3L1 in innate defense against fungal infection in a mammalian tissue.

4162

iai.asm.org

CHI3L1 was recently shown to bind to the IL-13R␣2 and to activate several signaling pathways in macrophages (34). CHI3L1 was reported to protect skeletal muscle from TNF-␣-induced inflammation and insulin resistance and to induce mucin-5AC production in human bronchial epithelial cells via protease-activated receptor 2 (35, 41). Hence, CHI3L1 may signal via different pathways in a cell- and/or tissue-specific manner. In the cornea, IL13R␣2 was expressed in CECs, and infection further enhanced its expression at the basal epithelial cells, suggesting autocrine signaling of CHI3L1. Subconjunctival injection of IL-13R␣2 siRNA resulted in its downregulation and in severe tissue destruction in C. albicans-infected corneas compared to that treated with the control siRNA. At 1 dpi, IL-13R␣2 downregulation markedly increased the severity of C. albicans keratitis and abolished the protective effects of recombinant CHI3L1, suggesting that CHI3L1 acts mostly through IL-13R␣2. Hence, the epithelium-produced CHI3L1 functions as an immunomodulator to regulate innate defense of in the cornea. The aforementioned data suggest that the antifungal activity of CHI3L1 is due to its downstream effectors such as antimicrobial and anti-inflammatory molecules. Indeed, we observed that CHI3L1 alone was sufficient to induce the expressions of mouse ␤-defensin-3, CRAMP, and SLPI, all of which have well-characterized fungicidal activities (42, 43). CHI3L1 has also been shown to possess pro- and anti-inflammatory properties (35, 36, 40) and to induce the expression of proinflammatory cytokines, such as IL-1␤ (34). Our study shows for the first time that while CHI3L1 induces IL-1␤ expression, it has more profound effects on IL-1Ra

Infection and Immunity

October 2015 Volume 83 Number 10

Chitinase 3-Like 1 and Fungal Keratitis

in naive corneas. In B6 corneas, infection induced large increases in the expression of IL-␤ and its natural inhibitor, IL-1Ra, assessed by SYBR green real-time PCR. Since SYBR green qPCR gives a relative quantification (the control, naive corneas were used as the reference sample with a value of 1), the extremely large increase in their expression shown in Fig. 7 may result from the lack of basal expression of the genes. Indeed, semiquantitative RT-PCR was unable to detect any IL-1␤ and IL-1Ra expression in naive corneas (data not show). The lack of detectable basal expression of IL-1␤ and highly inducible and parallel expression of IL-1Ra may reflect the exquisite sensitivity of the cornea to inflammation-mediated damage and the fact that the eye is an immune-privileged site where innate immunity remains silent in homeostasis and can be quickly induced in response to infection. IL-1␤ is a major driver of innate immunity and yet can cause exuberant inflammation if not properly controlled (44, 45). The expression patterns of IL-1␤ and IL-1Ra detected in the cornea in response to C. albicans infection are indicative of the unique response of the immune-privileged site (46). Importantly, CHI3L1 exhibited an inhibitory effect on IL-1␤ but not IL-1Ra in response to C. albicans infection, hence altering the ratio of these two highly inducible members of the IL-1 subfamily of cytokines. The balance between IL-1␤ and IL1Ra in local tissues has been known to play an important role in the susceptibility to and severity of many infections and inflammatory diseases (47). The ability to decrease the ratio of IL-␤ and IL-1Ra may represent a mechanism underlying the anti-inflammatory and protective role of CHI3L1 in the cornea. It is of interest that anakinra, recombinant IL-1Ra, has been used clinically to treat rheumatoid arthritis (48) and low-insulin-resistance type 2 diabetes (49, 50) by suppressing IL-1␤-caused inflammation. Hence, modulating IL-1␤ and IL-1Ra expression may be an underlying mechanism for CHI3L1 to suppress C. albicans keratitis, and anakinra might be used as an adjunctive therapeutic to lower infection-caused inflammation. We previously showed that recombinant CXCL10 inhibited C. albicans growth in vitro and accelerated fungal clearance and inflammation resolution in vivo (29). We also showed that CXCR3 was exclusively expressed in infiltrated cells (29). In the present study, we observed that CHI3L1 induced CXCL10 expression in the basal epithelial cells. Surprisingly, we also observed strong expression of CXCR3 in several layers on the basal side of the epithelium, raising the possibility of autocrine signaling in the epithelium. At 1 dpi, CXCL10 can be detected mostly in the epithelium, while CXCR3-positive cells are either in the stroma or in an intraepithelial cell cluster that contains mainly NK cells, as we showed previously (29). In CHI3L1-pretreated corneas, CXCL10 was found abundantly in almost the entire epithelium and in some stromal cells, while CXCR3 was only found in the stroma. Hence, CHI3L1 plays a role in corneal innate defense by affecting CXCL10/CXCR3 expression and distribution. Finally, we assessed the therapeutic potential of CHI3L1 by applying the recombinant protein after C. albicans inoculation. Our data indicated that CHI3L1 applied 3 h after C. albicans inoculation was as effective as that applied before inoculation. Flagellin pretreatment induces total protection, with no detectable C. albicans colonization. Treatment with recombinant CHI3L1, on the other hand, results in greatly increased fungal clearance and yet incomplete eradication of invading C. albicans in the cornea at 1 dpi. However, unlike flagellin, which requires a minimum of 6 to 8 h to activate the innate defense apparatus

October 2015 Volume 83 Number 10

before infection occurs in the cornea (19, 51), CHI3L1 applied after C. albicans inoculation is as effective as that applied prior to inoculation in reducing severity of C. albicans keratitis, mostly through inflammation resolution. Hence, compared to flagellin, which may have great clinical application in improving the therapeutic index of cancer radiotherapy and serving as a biological protectant in radiation emergencies (52), CHI3L1 has therapeutic potential for ameliorating infection-associated inflammation in tissues like the cornea. In summary, our data suggest that CHI3L1 plays a regulatory role in corneal innate immunity by influencing the expression of AMPs, anti-inflammatory factors, and chemokines in an IL13R␣2-dependent manner. Since it exhibits protective effects in the cornea and in the lung against infection (23) and augments repair (40), CHI3L1 or its derivative peptide might be developed as an adjunctive therapeutic to antibiotics to treat microbial keratitis and other infectious diseases. REFERENCES 1. Streilein JW. 1999. Immunologic privilege of the eye. Springer Semin Immunopathol 21:95–111. http://dx.doi.org/10.1007/BF00810243. 2. Cursiefen C. 2007. Immune privilege and angiogenic privilege of the cornea. Chem Immunol Allergy 92:50 –57. 3. Kumar A, Yu FS. 2006. Toll-like receptors and corneal innate immunity. Curr Mol Med 6:327–337. http://dx.doi.org/10.2174/156652406776894572. 4. Fleiszig SM, Evans DJ. 2003. Contact lens infections: can they ever be eradicated? Eye Contact Lens 29:S67–S71. 5. Zhang J, Xu K, Ambati B, Yu FS. 2003. Toll-like receptor 5-mediated corneal epithelial inflammatory responses to Pseudomonas aeruginosa flagellin. Invest Ophthalmol Vis Sci 44:4247– 4254. http://dx.doi.org/10 .1167/iovs.03-0219. 6. Niederkorn JY. 2011. Cornea: window to ocular immunology. Curr Immunol Rev 7:328 –335. http://dx.doi.org/10.2174/157339511796196593. 7. Thomas PA. 2003. Fungal infections of the cornea. Eye (Lond) 17:852– 862. http://dx.doi.org/10.1038/sj.eye.6700557. 8. Thomas PA, Geraldine P. 2007. Infectious keratitis. Curr Opin Infect Dis 20:129 –141. http://dx.doi.org/10.1097/QCO.0b013e328017f878. 9. Jackson BE, Wilhelmus KR, Mitchell BM. 2007. Genetically regulated filamentation contributes to Candida albicans virulence during corneal infection. Microb Pathog 42:88 –93. http://dx.doi.org/10.1016/j.micpath .2006.11.005. 10. Galarreta DJ, Tuft SJ, Ramsay A, Dart JK. 2007. Fungal keratitis in London: microbiological and clinical evaluation. Cornea 26:1082–1086. http://dx.doi.org/10.1097/ICO.0b013e318142bff3. 11. Ritterband DC, Seedor JA, Shah MK, Koplin RS, McCormick SA. 2006. Fungal keratitis at the New York Eye and Ear Infirmary. Cornea 25:264 – 267. http://dx.doi.org/10.1097/01.ico.0000177423.77648.8d. 12. Chern KC, Meisler DM, Wilhelmus KR, Jones DB, Stern GA, Lowder CY. 1996. Corneal anesthetic abuse and Candida keratitis. Ophthalmology 103:37– 40. http://dx.doi.org/10.1016/S0161-6420(96)30735-5. 13. Gorscak JJ, Ayres BD, Bhagat N, Hammersmith KM, Rapuano CJ, Cohen EJ, Burday M, Mirani N, Jungkind D, Chu DS. 2007. An outbreak of Fusarium keratitis associated with contact lens use in the northeastern United States. Cornea 26:1187–1194. http://dx.doi.org/10 .1097/ICO.0b013e318142b932. 14. Patel A, Hammersmith K. 2008. Contact lens-related microbial keratitis: recent outbreaks. Curr Opin Ophthalmol 19:302–306. http://dx.doi.org /10.1097/ICU.0b013e3283045e74. 15. FlorCruz NV, Peczon IV, Evans JR. 2012. Medical interventions for fungal keratitis. Cochrane Database Syst Rev 2:CD004241. http://dx.doi .org/10.1002/14651858.CD004241.pub3. 16. Yuan X, Mitchell BM, Wilhelmus KR. 2008. Gene profiling and signaling pathways of Candida albicans keratitis. Mol Vis 14:1792–1798. 17. Oppenheim JJ, Tewary P, de la Rosa G, Yang D. 2007. Alarmins initiate host defense. Adv Exp Med Biol 601:185–194. http://dx.doi.org/10.1007 /978-0-387-72005-0_19. 18. Gao N, Kumar A, Guo H, Wu X, Wheater M, Yu FS. 2011. Topical flagellin-mediated innate defense against Candida albicans keratitis. Invest Ophthalmol Vis Sci 52:3074 –3082. http://dx.doi.org/10.1167/iovs.10-5928.

Infection and Immunity

iai.asm.org

4163

Gao and Yu

19. Kumar A, Gao N, Standiford TJ, Gallo RL, Yu FS. 2010. Topical flagellin protects the injured corneas from Pseudomonas aeruginosa infection. Microbes Infect 12:978 –989. http://dx.doi.org/10.1016/j.micinf.2010.06.007. 20. Gao N, Sang Yoon G, Liu X, Mi X, Chen W, Standiford TJ, Yu FS. 2013. Genome-wide transcriptional analysis of differentially expressed genes in flagellin-pretreated mouse corneal epithelial cells in response to Pseudomonas aeruginosa: involvement of S100A8/A9. Mucosal Immunol 6:993–1005. http://dx.doi.org/10.1038/mi.2012.137. 21. Lee CG, Da Silva CA, Dela Cruz CS, Ahangari F, Ma B, Kang MJ, He CH, Takyar S, Elias JA. 2011. Role of chitin and chitinase/chitinase-like proteins in inflammation, tissue remodeling, and injury. Annu Rev Physiol 73:479 – 501. http://dx.doi.org/10.1146/annurev-physiol-012110-142250. 22. Bleau G, Massicotte F, Merlen Y, Boisvert C. 1999. Mammalian chitinase-like proteins. EXS 87:211–221. 23. Dela Cruz CS, Liu W, He CH, Jacoby A, Gornitzky A, Ma B, Flavell R, Lee CG, Elias JA. 2012. Chitinase 3-like-1 promotes Streptococcus pneumoniae killing and augments host tolerance to lung antibacterial responses. Cell Host Microbe 12:34 – 46. http://dx.doi.org/10.1016/j.chom .2012.05.017. 24. Huang C, Huang B, Bi F, Yan LH, Tong J, Huang J, Xia XG, Zhou H. 2014. Profiling the genes affected by pathogenic TDP-43 in astrocytes. J Neurochem 129:932–939. http://dx.doi.org/10.1111/jnc.12660. 25. Erdman LK, Petes C, Lu Z, Dhabangi A, Musoke C, CsertiGazdewich CM, Lee CG, Liles WC, Elias JA, Kain KC. 2014. Chitinase 3-like 1 is induced by Plasmodium falciparum malaria and predicts outcome of cerebral malaria and severe malarial anaemia in a case-control study of African children. Malaria J 13:279. http://dx.doi .org/10.1186/1475-2875-13-279. 26. Lee CG, Hartl D, Lee GR, Koller B, Matsuura H, Da Silva CA, Sohn MH, Cohn L, Homer RJ, Kozhich AA, Humbles A, Kearley J, Coyle A, Chupp G, Reed J, Flavell RA, Elias JA. 2009. Role of breast regression protein 39 (BRP-39)/chitinase 3-like-1 in Th2 and IL-13-induced tissue responses and apoptosis. J Exp Med 206:1149 –1166. http://dx.doi.org/10 .1084/jem.20081271. 27. Agliano A, Martin-Padura I, Marighetti P, Gregato G, Calleri A, Prior C, Redrado M, Calvo A, Bertolini F. 2011. Therapeutic effect of lenalidomide in a novel xenograft mouse model of human blastic NK cell lymphoma/blastic plasmacytoid dendritic cell neoplasm. Clin Cancer Res 17:6163– 6173. http://dx.doi.org/10.1158/1078-0432.CCR-11-0212. 28. Cowell BA, Willcox MD, Hobden JA, Schneider RP, Tout S, Hazlett LD. 1998. An ocular strain of Pseudomonas aeruginosa is inflammatory but not virulent in the scarified mouse model. Exp Eye Res 67:347–356. http: //dx.doi.org/10.1006/exer.1998.0524. 29. Liu X, Gao N, Dong C, Zhou L, Mi QS, Standiford TJ, Yu FS. 2014. Flagellin-induced expression of CXCL10 mediates direct fungal killing and recruitment of NK cells to the cornea in response to Candida albicans infection. Eur J Immunol 44:2667–2679. http://dx.doi.org/10 .1002/eji.201444490. 30. Yoon GS, Dong C, Gao N, Kumar A, Standiford TJ, Yu FS. 2013. Interferon regulatory factor-1 in flagellin-induced reprogramming: potential protective role of CXCL10 in cornea innate defense against Pseudomonas aeruginosa infection. Invest Ophthalmol Vis Sci 54:7510 –7521. http://dx.doi.org/10.1167/iovs.13-12453. 31. Wu TG, Wilhelmus KR, Mitchell BM. 2003. Experimental keratomycosis in a mouse model. Invest Ophthalmol Vis Sci 44:210 –216. http://dx.doi .org/10.1167/iovs.02-0446. 32. Raquil MA, Anceriz N, Rouleau P, Tessier PA. 2008. Blockade of antimicrobial proteins S100A8 and S100A9 inhibits phagocyte migration to the alveoli in streptococcal pneumonia. J Immunol 180:3366 –3374. http: //dx.doi.org/10.4049/jimmunol.180.5.3366. 33. Renkema GH, Boot RG, Au FL, Donker-Koopman WE, Strijland A, Muijsers AO, Hrebicek M, Aerts JM. 1998. Chitotriosidase, a chitinase, and the 39-kDa human cartilage glycoprotein, a chitin-binding lectin, are homologues of family 18 glycosyl hydrolases secreted by human macrophages. Eur J Biochem 251:504 –509. http://dx.doi.org /10.1046/j.1432-1327.1998.2510504.x. 34. He CH, Lee CG, Dela Cruz CS, Lee CM, Zhou Y, Ahangari F, Ma B, Herzog EL, Rosenberg SA, Li Y, Nour AM, Parikh CR, Schmidt I, Modis Y, Cantley L, Elias JA. 2013. Chitinase 3-like 1 regulates cellular and tissue responses via IL-13 receptor alpha2. Cell Rep 4:830 – 841. http: //dx.doi.org/10.1016/j.celrep.2013.07.032. 35. Gorgens SW, Eckardt K, Elsen M, Tennagels N, Eckel J. 2014. Chitinase-

4164

iai.asm.org

36.

37.

38.

39.

40.

41.

42.

43.

44. 45. 46. 47. 48. 49.

50. 51.

52.

3-like protein 1 protects skeletal muscle from TNFalpha-induced inflammation and insulin resistance. Biochem J 459:479 – 488. http://dx.doi.org /10.1042/BJ20131151. Tran HT, Lee IA, Low D, Kamba A, Mizoguchi A, Shi HN, Lee CG, Elias JA, Mizoguchi E. 2014. Chitinase 3-like 1 synergistically activates IL6mediated STAT3 phosphorylation in intestinal epithelial cells in murine models of infectious colitis. Inflamm Bowel Dis 20:835– 846. http://dx.doi .org/10.1097/MIB.0000000000000033. Eurich K, Segawa M, Toei-Shimizu S, Mizoguchi E. 2009. Potential role of chitinase 3-like-1 in inflammation-associated carcinogenic changes of epithelial cells. W J Gastroenterol 15:5249 –5259. http://dx .doi.org/10.3748/wjg.15.5249. Libreros S, Garcia-Areas R, Iragavarapu-Charyulu V. 2013. CHI3L1 plays a role in cancer through enhanced production of pro-inflammatory/ pro-tumorigenic and angiogenic factors. Immunol Res 57:99 –105. http: //dx.doi.org/10.1007/s12026-013-8459-y. Chen CC, Pekow J, Llado V, Kanneganti M, Lau CW, Mizoguchi A, Mino-Kenudson M, Bissonnette M, Mizoguchi E. 2011. Chitinase 3-like-1 expression in colonic epithelial cells as a potentially novel marker for colitis-associated neoplasia. Am J Pathol 179:1494 –1503. http://dx.doi .org/10.1016/j.ajpath.2011.05.038. Zhou Y, Peng H, Sun H, Peng X, Tang C, Gan Y, Chen X, Mathur A, Hu B, Slade MD, Montgomery RR, Shaw AC, Homer RJ, White ES, Lee CM, Moore MW, Gulati M, Geun Lee C, Elias JA, Herzog EL. 2014. Chitinase 3-like 1 suppresses injury and promotes fibroproliferative responses in mammalian lung fibrosis. Sci Transl Med 6:240ra276. http://dx .doi.org/10.1126/scitranslmed.3007096. Liu C, Li Q, Zhou X, Kolosov VP, Perelman JM. 2013. The chitinase-like protein YKL-40 increases mucin5AC production in human bronchial epithelial cells. Exp Cell Res 319:2866 –2873. http://dx.doi.org/10.1016/j .yexcr.2013.08.009. Moreau T, Baranger K, Dade S, Dallet-Choisy S, Guyot N, Zani ML. 2008. Multifaceted roles of human elafin and secretory leukocyte proteinase inhibitor (SLPI), two serine protease inhibitors of the chelonianin family. Biochimie 90:284 –295. http://dx.doi.org/10.1016/j.biochi.2007.09.007. Tomee JF, Hiemstra PS, Heinzel-Wieland R, Kauffman HF. 1997. Antileukoprotease: an endogenous protein in the innate mucosal defense against fungi. J Infect Dis 176:740 –747. http://dx.doi.org/10 .1086/514098. Dinarello CA. 2013. Overview of the interleukin-1 family of ligands and receptors. Semin Immunol 25:389 –393. http://dx.doi.org/10.1016 /j.smim.2013.10.001. Garlanda C, Dinarello CA, Mantovani A. 2013. The interleukin-1 family: back to the future. Immunity 39:1003–1018. http://dx.doi.org/10.1016/j .immuni.2013.11.010. Stein-Streilein J. 2013. Mechanisms of immune privilege in the posterior eye. Int Rev Immunol 32:42–56. http://dx.doi.org/10.3109/08830185.2012 .740535. Arend WP. 2002. The balance between IL-1 and IL-1Ra in disease. Cytokine Growth Factor Rev 13:323–340. http://dx.doi.org/10.1016 /S1359-6101(02)00020-5. Burger D, Dayer JM, Palmer G, Gabay C. 2006. Is IL-1 a good therapeutic target in the treatment of arthritis? Best Pract Res Clin Rheumatol 20:879 – 896. http://dx.doi.org/10.1016/j.berh.2006.06.004. van Poppel PC, van Asseldonk EJ, Holst JJ, Vilsboll T, Netea MG, Tack CJ. 2014. The interleukin-1 receptor antagonist anakinra improves firstphase insulin secretion and insulinogenic index in subjects with impaired glucose tolerance. Diabetes Obes Metab 16:1269 –1273. http://dx.doi.org /10.1111/dom.12357. Tack CJ, Stienstra R, Joosten LA, Netea MG. 2012. Inflammation links excess fat to insulin resistance: the role of the interleukin-1 family. Immunol Rev 249:239 –252. http://dx.doi.org/10.1111/j.1600-065X.2012.01145.x. Kumar A, Hazlett LD, Yu FS. 2008. Flagellin suppresses the inflammatory response and enhances bacterial clearance in a murine model of Pseudomonas aeruginosa keratitis. Infect Immun 76:89 –96. http://dx.doi.org /10.1128/IAI.01232-07. Burdelya LG, Krivokrysenko VI, Tallant TC, Strom E, Gleiberman AS, Gupta D, Kurnasov OV, Fort FL, Osterman AL, Didonato JA, Feinstein E, Gudkov AV. 2008. An agonist of Toll-like receptor 5 has radioprotective activity in mouse and primate models. Science 320:226 –230. http://dx .doi.org/10.1126/science.1154986.

Infection and Immunity

October 2015 Volume 83 Number 10