Endocrine DOI 10.1007/s12020-014-0286-y
ORIGINAL ARTICLE
Chemerin plays a protective role by regulating human umbilical vein endothelial cell-induced nitric oxide signaling in preeclampsia Liqiong Wang • Tianli Yang • Yiling Ding Yan Zhong • Ling Yu • Mei Peng
•
Received: 31 December 2013 / Accepted: 3 May 2014 Ó Springer Science+Business Media New York 2014
Abstract The aim of this study was to determine chemerin levels in preeclampsia and to assess the effects of this anti-inflammatory factor on endothelial nitric oxide synthase (eNOS), nuclear factor (NF)-jB, and vascular cell adhesion molecule (VCAM) expression in human umbilical vein endothelial cells (HUVECs). Serum chemerin and eNOS levels were measured by enzyme-linked immunosorbent assays, while chemerin mRNA and protein levels were measured by fluorescent quantitative polymerase chain reaction and Western blotting, respectively. Nitric oxide (NO) concentrations were determined with a colorimetric method. Akt and eNOS phosphorylation were assessed by Western blotting. We also tested the effects of the phosphoinositide 3-kinase inhibitor LY294002 and the eNOS inhibitor L-NAME. NF-jB p65 and VCAM-1 phosphorylation were assessed by Western blotting to investigate the role of chemerin in tumor necrosis factor (TNF)-a-induced HUVEC injury. Serum chemerin levels were increased in preeclampsia, while eNOS was decreased. Chemerin mRNA and protein were both increased in placentae from patients with preeclampsia. Furthermore, chemerin serum level positively correlated with blood pressure, body mass index, and serum insulin and was negatively correlated with serum eNOS. Chemerin dose-dependently increased NO concentrations in
L. Wang Department of Gynaecology and Obstetrics, The University of Hong Kong-Shenzhen Hospital, Shenzhen 518053, China T. Yang Y. Ding (&) Y. Zhong L. Yu M. Peng Department of Obstetrics and Gynaecology, The Second XiangYa Hospital of Central South University, 139 Ren Min Zhong Lu, Changsha, Hunan 410011, China e-mail: [email protected]
supernatants. Chemerin can increase eNOS and Akt levels in HUVECs, and these results could be partly blocked by LY294002 and L-NAME. Chemerin significantly decreased TNF-a-induced NF-jB and VCAM-1 in HUVECs, and these changes were partly inhibited by LY294002 and L-NAME. Chemerin may play a protective role by regulating NO signaling. Future studies should assess the role of chemerin in preeclampsia and other vascular diseases. Keywords Chemerin Adipokine Preeclampsia Nitric oxide Human umbilical vein endothelial cells
Introduction Preeclampsia is a pregnancy-specific syndrome that can affect almost every organ. It is characterized by systemic small artery spasms induced by diffuse endothelial cell injury and clinical features of newly diagnosed hypertension and proteinuria [1]. Risk factors for preeclampsia include obesity, abnormal lipid metabolism, endothelial injury, and inflammation, which are similar to the risk factors for hypertension, diabetes mellitus, atherosclerosis, and metabolic syndrome. Moreover, the future risk of vascular and metabolic disease is significantly increased after a preeclamptic pregnancy [2]. However, the pathogenesis of this life-threatening condition remains unclear. The placenta is thought to be a major source of endogenous nitric oxide (NO) during pregnancy. Endothelial NO, which is synthesized by endothelial NO synthase (eNOS), is an important regulator of blood flow and vasomotor tone via its inhibition of smooth muscle contraction. Thus, it is hypothesized that NO–eNOS system abnormalities are associated with the onset of preeclampsia [3] [4].
123
Endocrine
Chemerin is a novel adipocytokine that is mainly expressed in adipocytes, liver, placenta, and ovary [5]. A G protein-coupled receptor, chemokine-like receptor 1 (CMKLR1) is a known receptor for chemerin and is expressed both in the placenta and vascular endothelial cells [6]. Recent study reveals that chemerin acts as a chemoattractant for immune cells during early inflammatory reactions [5, 7], and it exerts anti-inflammatory effects by secreting anti-inflammatory substances and accelerating the generation of anti-inflammatory macrophages when inflammation resolves [8, 9]. Chemerin can also promote adipocyte differentiation and fat tissue decomposition [10, 11]; chemerin can induce insulin resistance in skeletal muscle [12]. It was also demonstrated that increased chemerin level is associated with hypertension, coronary disease [13], diabetes mellitus [14, 15], atherosclerosis [16], obesity, and metabolic syndrome [17]. Furthermore, the implementation of a 6-month combined strength and endurance training program significantly reduced circulating chemerin levels in overweight or obese individuals [18]. Although its specific biological functions are controversial, chemerin may play a role in the pathogenesis in preeclampsia. Because of its pleiotropic function, we hypothesized that chemerin may be involved in the pathogenesis of preeclampsia. Two studies reported that maternal chemerin serum concentrations are significantly increased in preeclampsia [19] [20]. However, limited data are available regarding placental mRNA and protein levels of chemerin among pregnancies complicated by preeclampsia. In the present study, we assessed the relationship between chemerin and preeclampsia and tested the hypothesis that chemerin induces NO secretion in human umbilical vein endothelial cells (HUVECs).
group. The exclusion criteria were as follows: (1) pregnancy complicated with nephropathy, infection, endocrine, hepatic, or cardiovascular diseases; (2) multiple pregnancy; (3) assisted reproduction; or (4) previous drug treatment. Serum chemerin and eNOS Venous blood sample was obtained after an overnight fast and 24 h before delivery. Immediately after sampling, serum was separated by centrifugation at 2,500 rpm for 10 min and frozen at -70 °C. Chemerin and eNOS serum concentrations were determined with commercially available enzyme-linked immunosorbent assays (ELISA; Uscn Life Science, Wuhan, China) according to the manufacturer’s instructions. The sensitivities of the chemerin and eNOS ELISA assays were 0.156–10 ng/ml and 15.6–1,000 pg/ml, respectively. The interassay coefficients of variation were \10 %, and the within-assay coefficients of variation were \5 %. We also measured fasting glucose (FG), fasting insulin (FINS), total cholesterol (TCH), triglycerides (TG), prothrombin time (PT), fibrinogen (FIB), activated partial thromboplastin time (APTT), blood urea nitrogen (BUN), creatinine (CRE), alanine aminotransferase (ALT), and platelets (PLT). Placenta sample acquisition Within 30 min of delivery of the placenta, samples were obtained from center of the maternal surface, and areas of necrosis and calcification were excluded under aseptic conditions. The specimens were rinsed with normal saline and divided into two portions. After removal of visible blood vessels, both portions were frozen immediately in liquid nitrogen and stored at -70 °C for fluorescent quantitative polymerase chain reaction (FQ-PCR) and Western blot.
Research design and methods Chemerin mRNA in placenta and FQ-PCR Study population Women with preeclampsia (moderate preeclampsia, MPE, n = 30; severe preeclampsia, SPE, n = 30) and control patients (n = 28) were recruited from the Department of Obstetrics at the Second Xiangya Hospital of Central South University between September 2012 and September 2013. Preeclampsia patients met the following criteria: increased gestational blood pressure [140 mmHg systolic or [90 mmHg diastolic accompanied by proteinuria in patients who were normotensive before 20 weeks of gestation. Primiparas with single fetuses who underwent cesarean sections because of intrauterine fetal distress, breech presentation, cephalopelvic disproportion, umbilical cord factors, or other factors were recruited as a control
123
Total RNA was extracted from placenta samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The concentration and purity of isolated RNA were assessed by measuring the optical density at 260 nm (OD260) and 280 nm (OD280), and the integrity of RNA was also determined by visualization of 18S and 28S ribosomal bands. A total of 2 lg RNA from each sample was reverse transcribed using oligo (dT) and M-MLV Reverse Transcriptase (Promega, Madison, WI, USA), according to the manufacturer’s instructions. An 2-ll aliquot of the resulting cDNA was used for FQ-PCR, which was carried out in a volume of 20 ll containing 10 ll SYBRÒ Premix Ex TaqTM, 10 lM forward primer, 10 lM reverse primer, and ddH20. The primers used for amplification are shown in
Endocrine Table 1 Primers for RT-PCR reaction Gene title
Primer sequence
Product (bp)
Chemerin
F:TTCCCAGCTGGAATATTTGTG
149
R:TTGTCCTCAGAGCCCAGTTT b-actin
F:AATCGTGCGTGACATTAAGGAG
275
a humidified incubator at 37 °C under 5 % CO2. Cells at passage 3–4 were used for experiments. HUVECs were identified by immunofluorescence staining of HUVECspecific antibody human factor VIII-related antigen (Santa Cruz Biotechnology, Santa Cruz, CA, USA) according to the manufacturer’s instructions.
R:ACTGTGTTGGCGTACAGGTCTT
NO production and Griess assay Table 1. Apart from the optimal annealing temperature and number of amplification cycles, other conditions were the same in all PCR reactions: 10 s for an initial denaturation at 95 °C, followed by 40 cycles (10 s for denaturation at 95 °C, 30 s for annealing, and extension at 60 °C). Chemerin in placenta and Western blot
HUVECs were further cultured at 37 °C for the indicated time (12, 24, or 48 h), in the absence (control) or presence of 10, 100, 500, or 1,000 ng/ml chemerin (PeproTech Inc., Rocky Hill, NJ, USA). Culture supernatants were harvested to determine the production of NO by the Griess assay. This assay determines nitrite concentrations to reflect the total level of NO, and the absorbance was spectrophotometrically measured at 540 nm. The Griess kit was purchased from BioVision Inc. (Milpitas, CA, USA), and the measurements were performed according to the manufacturer’s instructions. All the experiments were performed at least in triplicate.
Placenta samples (50 mg) were mixed with radioimmunoprecipitation analysis (RIPA) lysis buffer, and the supernatant was separated by centrifugation at 12,000 rpm for 3 min at 4 °C. The protein concentration was determined with a bicinchoninic acid (BCA) protein assay kit (Pierce Rockford, IL). Protein samples were mixed with sample buffer and subjected to 12 % sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) before transfer to polyvinylidene fluoride (PVDF) membranes. Primary antibodies for chemerin (1:200 dilution mouse chemerin antibody, Abcam, Cambridge, UK) were incubated overnight with the membranes in phosphatebuffered saline with Tween 20 (PBST) with 5 % skimmed milk at 4 °C. Membranes were subsequently washed with PBST and incubated with a secondary antibody (1:1,000 dilution, donkey anti-Mouse IgG (H ? L), LI-COR Biosciences, Lincoln, NE, USA) for 1 h at room temperature. Relative levels of chemerin secretion were normalized to b-actin in the corresponding samples. Protein expression was quantified by scanning of the Odyssey infrared imaging system (LI-COR Biosciences).
HUVECs were further cultured at 37 °C for 24 h, in the absence (controls) or presence of 10, 100, 500, or 1,000 ng/ml chemerin (PeproTech Inc.). Protein lysates were obtained by HUVECs with SDS lysis buffer (50 mM Tris, pH 8.1, 1 g/l SDS, 0.5 g/l protease inhibitor, 1 mM PMSF, 1 mM EDTA, sodium pyrophosphate, glycerophosphate). Protein concentration was determined using the BCA method (Pierce). Western blot was performed to determine phosphorylation levels of Akt (p-Akt, Ser473) (1:200 dilution, mouse p-Akt antibody, Abcam) and eNOS (p-eNOS, Ser1177) (1:200 dilution, mouse p-eNOS antibody, Abcam) in HUVECs. The results were analyzed using Gel-Pro Analyzer (Media Cybernetics, Rockville, MD, USA).
Cell culture and identification
Application of PI3K inhibitor LY294002 and NOS inhibitor L-NAME
HUVECs were extracted from the umbilical cords of healthy pregnant women by collagenase digestion of the interior of the umbilical vein. The cell suspension was centrifuged at 1,000 rpm for 5 min, and the cell pellet was resuspended in 4 ml Medium 199 (GIBCO/Invitrogen) supplemented with 20 % fetal calf serum (GIBCO/Invitrogen), 50 lg/ml endothelial cell growth supplements (Becton, Dickinson and Company, Franklin Lakes, NJ, USA), 50 lg/ml heparin sodium, and 2 lmol/l glutamine. The cells were plated into six-well plates and incubated in
We next investigated inhibitors of PI3K/Akt/eNOS signaling pathway and the effect of chemerin induction on p-eNOS and p-Akt levels. HUVECs were divided into four groups and cultured at 37 °C for 24 h in the absence (controls) or presence of 500 ng/ml chemerin, 500 ng/ml chemerin and 5 lmol/ml LY294002 (Beyotime, Haimen, China), 500 ng/ml chemerin, and 0.5 mmol/ml L-NAME (BiYunTian Biotechnology Co., LTD, Shanghai, China). Western blotting was performed to determine p-Akt and p-eNOS levels in HUVECs.
Effect of chemerin on PI3K/Akt/eNOS pathways in HUVECs and Western blot
123
Endocrine
Tumor necrosis factor (TNF)-a-induced HUVECs injury model We established a HUVEC injury model by co-culturing HUVECs with 5 ng/ml TNF-a (PeproTech Inc.) at 37 °C for 6 h [21]. Five groups were included: controls, 5 ng/ml TNF-a 6 h, 24-h pretreatment of chemerin (500 ng/ml) ? TNF-a (5 ng/ml, 6 h), 24-h pretreatment of chemerin (500 ng/ml) and LY294002 (5 lmol/ml) ? TNF-a (5 ng/ml, 6 h), 24-h pretreatment of chemerin and L-NAME (0.5 mmol/ ml) ? TNF-a (5 ng/ml, 6 h). We determined activation of phosphorylation of nuclear factor (NF)-jB p65 (Ser536) and expression of VCAM-1 by Western blot.
Chemerin mRNA and protein expression in placenta Compared with controls, chemerin mRNA and protein expressions in placenta were significantly higher in preeclampsia groups (P \ 0.05), which corresponded with serum chemerin levels (Table 3; Fig. 1). Univariate correlations Serum chemerin levels positively correlated with SBP, DBP, BMI, and serum insulin and negatively correlated with serum eNOS (Table 4). HUVEC culture and identification
Statistical analysis All statistical analyses were performed with SPSS software version 17.0 (SPSS Inc., Chicago, IL, USA). Results are represented as mean ± standard error of mean (SEM). Distributions were tested for normality using one-way analysis of variance (ANOVA), and differences between two groups were assessed by Student–Newman–Keuls (SNK) tests. Repetitive measurements and ANOVAs were performed for NO concentration measurements induced by the indicated concentrations of chemerin for the indicated times. Nonnormally distributed parameters were analyzed with Dunnett’s T3 test. Correlations were performed using Spearman’s rank correlation method. A p-value \0.05 was considered statistically significant unless otherwise indicated.
Results Serum chemerin and eNOS Table 2 summarizes the clinical characteristics and laboratory data of the subgroups studied (Control, MPE, SPE) during pregnancy. Chemerin serum levels were increased in preeclampsia patients compared with controls (220.00 ng/ml); furthermore, chemerin in SPE (493.83 ng/ml) was significantly higher than that in MPE (330.23 ng/ml, P \ 0.05). eNOS serum levels were decreased in subjects with preeclampsia compared with controls (1.46 pg/ml), whereas eNOS in SPE (0.88 pg/ml) was significantly lower than that in MPE (1.12 pg/ml) (P \ 0.05). Age, gestational age at blood sampling, FBG, TCH, PLT, ALT, BUN, CRE, PT, APTT, and FIB were not significantly different among the three groups. Systolic (SBP) and diastolic (DBP) blood pressure, body mass index (BMI), FINS, homeostasis model assessment of insulin resistance (HOMA-IR), TG, and 24-h urine protein (24-h Pro) were significantly increased in patients with preeclampsia compared with controls. BMI, FINS, HOMA-IR, and TG were higher in SPE than in MPE.
123
The cells we cultured were in good condition, monolayer, and flagstone shaped. Immunofluorescence labeling revealed that the cells were positive for factor VIII, confirming that they were HUVECs (Fig. 2). Comparisons of NO concentrations induced by chemerin To explore the effect of chemerin on HUVECs, we pretreated HUVECs with indicated concentrations of chemerin (0, 10, 100, 500, or 1,000 ng/ml) for the indicated times (12, 24, or 48 h), then measured the NO concentration in HUVEC supernatants. Chemerin increased the NO concentrations in a dose-dependent manner in the range of 0–500 ng/ml, with a maximal effect achieved at 1,000 ng/ ml, but there were no significant differences in NO production between 500 ng/ml and 1,000 ng/ml (P [ 0.05). Therefore, we concluded that the optimal concentration and reaction time were 500 ng/ml and 24 h, respectively (Table 5; Fig. 3). Chemerin induces NO production via PI3K/Akt/eNOS pathway activation We next confirmed that chemerin-induced NO production via PI3K/Akt/eNOS signaling. In accordance with NO concentration, chemerin significantly and dose-dependently increased p-Akt and p-eNOS in HUVECs in the range of 0–500 ng/ml (Fig. 4), and this effect was partially inhibited by the PI3K inhibitor LY294002 and the NOS inhibitor L-NAME (Fig. 5). Effect of chemerin on NF-jB and VCAM-1 expression in a TNF-a-induced HUVECs injury model We investigated the anti-inflammatory effect of chemerin in a TNF-a-induced HUVECs injury model. We pretreated HUVECs with 500 ng/ml chemerin for 24 h, stimulated the
Endocrine Table 2 Baseline characteristics and laboratory data of the study population
Controls
MPE
SPE
N
28
30
30
Age (years)
28.2 ± 4.8
27.9 ± 6.5
28.5 ± 5.5
Gestational age at blood sampling (weeks)
39.3 ± 0.9
38.5 ± 1.6
37.4 ± 2.9
SBP (mmHg)
109.25 ± 12.33`´
DBP (mmHg) 2
SBP systolic blood pressure, DBP diastolic blood pressure, BMI body mass index, FG fasting glucose, FINS fasting insulin, HOMA-IR homeostasis model assessment of insulin resistance, TG triglycerides, TCH total cholesterol, PLT platelet, ALT alanine aminotransferase, BUN blood urea nitrogen, CRE creatinine, 24 h Pro 24-h urine protein, PT prothrombin time, APTT activated partial thromboplastin time, FIB fibrinogen, eNOS endothelial NO synthase
P \ 0.05, compared to controls; ` P \ 0.05, compared to MPE; ´ P \ 0.05, compared to SPE
BMI (kg/m )
Controls MPE SPE ´
28 30 30
168.07 ± 22.92`
´
108.30 ± 16.63`
93.83 ± 10.10 27.49 ± 2.68
´
28.65 ± 3.98`
FG (mmol/l)
4.24 ± 0.50
4.51 ± 0.64
4.98 ± 0.90
7.45 ± 1.27`´
8.45 ± 2.55´
11.84 ± 2.55`
HOMA-IR
1.78 ± 0.78`´
2.02 ± 0.60´
2.92 ± 1.05`
`´
´
TG (mmol/l)
2.45 ± 0.53
3.02 ± 0.45
4.23 ± 0.46`
TCH (mmol/l) PLT (109/l)
5.82 ± 0.90 210.20 ± 45.83
5.85 ± 1.08 195.80 ± 52.51
5.83 ± 1.36 204.67 ± 47.80
ALT (U/l)
22.89 ± 10.55
24.60 ± 9.82
25.47 ± 8.01
BUN (mmol/l)
3.98 ± 1.12
4.05 ± 0.95
4.33 ± 1.20
CRE (lmol/l)
74.07 ± 18.20
79.04 ± 13.47
83.05 ± 22.34
24 h Pro (g/24 h)
45.27 ± 30.15`´
658.50 ± 320.24´
2674.87 ± 1150.25`
PT (s)
11.00 ± 1.18
11.44 ± 1.25
12.17 ± 4.23
APTT (s)
23.18 ± 5.50
22.53 ± 4.16
22.98 ± 7.10
FIB (g/l)
3.43 ± 0.73
3.04 ± 0.65
3.07 ± 0.54
eNOS (pg/ml)
1.46 ± 0.31`´
1.12 ± 0.16´ `´
chemerin
Chemerin mRNA
220.00 ± 50.78
-4
-4´
3.04 9 10 ± 0.87 9 10 4.00 9 10-4 ± 1.11 9 10-4` `
0.88 ± 0.23` ´
330.23 ± 56.22
Table 4 Univariate correlations with serum chemerin concentrations, r- and p-values are given
493.83 ± 105.23`
Variances
r
P
SBP
0.690
0.000*
DBP
0.655
0.000*
0.57 ± 0.15`´
BMI
0.724
0.000*
1.20 ± 0.17´ 1.84 ± 0.40`
Serum insulin
0.627
0.000*
Serum eNOS
-0.727
0.000*
Chemerin protein
1.13 9 10-4 ± 0.54 9 10-4`´
P \ 0.05, compared to controls; P \ 0.05, compared to SPE
26.28 ± 3.16
`´
147.27 ± 6.18´
FINS (mU/ml)
Table 3 Chemerin mRNA and protein expression among three groups and variance analysis result N
71.07 ± 5.89
`´
P \ 0.05, compared to MPE;
* A p-value of \0.01 was considered as statistically significant
Discussion
Fig. 1 Chemerin expressions among three groups. Compared with controls, chemerin protein expressions in placenta were significantly higher in preeclampsia groups
cells with 5 ng/ml TNF-a for 6 h, and then measured NFjB and VCAM-1 levels. Chemerin significantly reversed TNF-a-induced expression of NF-jB and VCAM-1. These inhibitory effects of chemerin were partially reversed by the PI3K inhibitor LY294002 or the eNOS inhibitor L-NAME (Fig. 6).
Our results demonstrate that circulating chemerin levels were significantly increased in preeclampsia patients compared with healthy pregnant women. Furthermore, chemerin levels were higher in patients with SPE compared with those with MPE. These findings indicate that differential expressions of chemerin may be responsible for pathological changes in patients with preeclampsia. Biomarkers of metabolism in SPE patients (e.g., BMI, HOMAIR, and TG) were higher than those in women with MPE, which indicates more severe glucose and lipid metabolism dysfunction and abnormal accumulation of body fat in SPE patients. In addition, we demonstrated that serum chemerin levels positively correlated with SBP, DBP, BMI, and serum insulin which is in accordance with the hypothesis
123
Endocrine
Fig. 3 Estimated marginal means of measure. Outline of the figure of NO concentrations in supernatants induced by indicated concentration of chemerin for indicated time
Fig. 2 Identification of human umbilical vein endothelial cells. a Cell growth and form at high magnification microscope (9200 times). b Cell cytoplasm viii factor expression under the fluorescence microscope (9100 times)
Table 5 NO concentrations (lM) in supernatants induced by indicated concentration of chemerin for indicated time Chemerin concentration
Time 12 h
24 h
48 h
0 (controls)
5.875 ± 0.684
6.798 ± 1.660
6.691 ± 0.372
10 ng/ml
9.010 ± 2.893
10.095 ± 1.085
11.180 ± 2.256
100 ng/ml
14.911 ± 2.132
20.283 ± 3.093
19.655 ± 3.554
500 ng/ml
20.256 ± 4.565
30.085 ± 5.660
30.395 ± 5.352
1000 ng/ml
18.132 ± 4.492
31.423 ± 6.312
30.527 ± 5.720
Repetitive measurement and analysis of variance were performed: (1) Ftime = 307.754, P = 0.000, indicated that there were significant differences among NO concentrations induced by chemerin for indicated time in HUVECs; Fconcentration = 18.506, P = 0.000, indicated that there were significant differences among NO concentrations induced by indicated concentration of chemerin (0, 10, 100, 500, 1,000 ng/ml) in HUVECs; Ft*c = 46.196, P = 0.000, indicated that interaction effect existed among these groups. (2) By pairwise comparison, no significant difference existed between 500 and 1,000 ng/ ml group (P [ 0.05); significant differences existed among other groups (P \ 0.05)
123
that preeclampsia risk factors (obesity, abnormal lipid metabolism, endothelial injury, inflammation, etc.) overlap with those for hypertension, diabetes mellitus, atherosclerosis, and metabolic syndrome. This is in accordance with both previous reports [19, 20]. To the best of our knowledge, our results provide the first evidence that chemerin mRNA and protein levels are significantly higher in preeclampsia patients in a severity-dependent manner. Based on these findings, we hypothesized that increased chemerin expression may be responsible for the pathogenesis, development, and severity of clinical features of preeclampsia due to increased binding with its receptor in the placenta. It is well established that NO is related to the pathogenesis of preeclampsia [22]. NO is also regarded as a vasodilatory substance because it activates cyclic guanosine monophosphate (cGMP)-induced potassium efflux and calcium channel inactivation. Because of NO’s short halflife, the rate-limiting enzyme of NO synthesis (eNOS) was determined to reflect the level of circulating NO. We found that eNOS serum levels were decreased in patients with preeclampsia, and eNOS was significantly lower in patients with SPE compared with those with MPE. Moreover, it has been demonstrated that serum chemerin and eNOS levels are negatively correlated. The key pathogenetic mechanism of preeclampsia is the activation and/or injury of diffuse endothelial cells during pregnancy. HUVECs are a useful model system because they are easy to acquire and they
Endocrine
Fig. 4 Effects of chemerin on expression of Akt and eNOS in HUVECs. HUVECs were pretreated with the indicated concentration of chemerin for 24 h. The expression of Akt and eNOS of HUVECs were measured using Western blot analysis. a Representative Western blots of Akt and eNOS for the indicated concentration of chemerin. b Semiquantitative analysis of proteins showed that chemerin increased phosphorylation of Akt and eNOS in HUVECs in a dosedependent manner in range of 0–500 ng/ml. Data are expressed as the mean ± SEM of the independent experiments. DP \ 0 05 versus control; #P \ 0.05 versus 10 ng/ml chemerin, *P \ 0 05 versus 100 ng/ml chemerin
share similar biological characteristics with artery endothelium. Therefore, we next examined the effects of chemerin on HUVECs. We cultured HUVECs for the indicated times (12, 24, or 48 h) in the absence (controls) or presence of 10, 100, 500 and 1000 ng/ml chemerin. Based on previous results of our study, we initially expected that chemerin, which is regarded as a chemoattractant for immune cells, would inhibit NO expression. However, chemerin (10–1,000 ng/ ml) significantly and dose-dependently increased NO concentrations in HUVEC supernatants in a range of 10–500 ng/ml. It is known that low physiological concentration of eNOS-induced NO plays vasodilatory and antiinflammatory roles in the pathogenesis of preeclampsia. Conversely, inducible NOS (iNOS) synthesizes high levels of NO, which has the opposite effect on dilation and inflammation [23, 24]. Although the concentration of NO
Fig. 5 Effects of P13K inhibitor LY294002 and eNOS inhibitor L-NAME on chemerin-induced expression of Akt and eNOS in HUVECs. HUVECs were treated with chemerin (500 ng/ml) for 24 h alone or chemerin ? LY294002 (5 lmol/ml, 24 h) or chemerin ? LNAME (0.5 mmol/ml, 24 h). The expression of Akt and eNOS of HUVECs were measured using Western blot analysis. a Representative Western blot of Akt and eNOS expression with different treatments in HUVECs. b Chemerin increased phosphorylation of Akt and eNOS in HUVECs. This effect was partially inhibited by P13K inhibitor LY294002. The eNOS inhibitor L-NAME could increase of eNOS but did not have effect on Akt. Data are expressed as the mean ± SEM of the independent experiments. DP \ 0.05 versus control; #P \ 0.05 versus chemerin
was not high, we were not sure that it was protective NO generated by eNOS. Thus, in order to determine the source of NO, we performed Western blots for eNOS and Akt to study the possible signaling of chemerin-induced NO. Consistent with NO being increased, chemerin (0–500 ng/ ml) significantly and dose-dependently induced p-Akt and p-eNOS in HUVECs. This effect was partially inhibited by the PI3K and eNOS inhibitors. These findings indicated that chemerin exerted anti-inflammatory effects in HUVECs via the PI3K/Akt/eNOS pathways. Furthermore, we showed that the optimal concentration and reaction time of chemerin were 500 ng/ml and 24 h, respectively, which is partly in accordance with previously reported findings [25].
123
Endocrine
Fig. 6 Effects of chemerin on TNF-a induced NF-jB expression and VCAM-l in HUVECs. HUVECs were treated with TNP-a (5 ng/ml) for 6 h is the absence or presence of chemerin (500 ng/ml pretreatment for 24 h). Expression of NP-jB and VCAM-1 were determined by Western blotting. a Representative Western blots of NP-jB and VCAM-1 for different treatments. b Semiquantitative analysis of proteins showed that chemerin reversed the activation of TNF-ainduced expression of NP-jB phosphorylation and VCAM-1. This inhibitory effects of chemerin can be partially reversed by P13K inhibitor LY294002 or eNOS inhibitor L-NAME. Data are expressed as the mean ? SEM of the independent experiments. DP \ 0.05 versus control; #P \ 0.05 versus TNF-a; *P\0.05 versus 100 ng/ml chemerin? TNF-a
Importantly, the serum chemerin in SPE patients in the present study was 493.83 ± 105.23 ng/ml, so 500 ng/ml is a physiological concentration. It has been widely demonstrated that chemerin functions vary depending on cell type, as mentioned above [5, 7–12] [26]. In the present study, we noticed that although LY294002 and L-NAME could reverse chemerin-stimulated p-Akt and p-eNOS expression, the results were still higher than those in controls, which implies that other unidentified pathways might be involved and further experiments are necessary. There
123
are three main pathways leading to eNOS phosphorylation: (1) intracellular Ca2? increases [27], (2) AMPK phosphorylation of eNOS [28], and (3) PI3K/Akt/eNOS pathway signaling [29]. Therefore, it is assumed that chemerin can increase intracellular Ca2? levels in vascular endothelial cells. We admit that L-NAME is a non-specific eNOS inhibitor. But in current study, Western blot has already performed to determine expression of phosphorylation of eNOS. In addition, LY294002 inhibits PI3Kinase, which is upstream of eNOS, but not iNOS. Because chemerin increased NO expression via PI3K/ Akt/eNOS pathways, it will be interesting to determine whether treatments that target chemerin can be applied to treat inflammatory diseases. Further, we established a HUVEC injury model by co-culturing HUVECs with TNFa and determining chemerin functions. We found that TNF-a significantly stimulated NF-jB and VCAM-1 expression compared with controls, and this could be significantly reversed by chemerin (500 ng/ml, 24 h). Moreover, LY294002 and L-NAME also reversed these inhibitory effects of chemerin. These results reveal that chemerin plays an anti-inflammatory role in the TNF-ainduced HUVECs injury model and implicate that chemerin may be a protective adipocytokine. Herenius et al. [30] demonstrated that anti-TNF therapy can reduce chemerin serum levels in rheumatoid arthritis. Our study is different from Hernius et al. in that we tested the effect of chemerin on TNF-a-induced response in vitro in HUVECs, whereas they studied the effect of blocking TNF-a on serum chemerin levels in patients. In the current study, chemerin (0–500 ng/ml) significantly and dose-dependently induced p-Akt and p-eNOS in HUVECs. This effect was partially inhibited by the PI3K and eNOS inhibitors. These findings indicated that chemerin exerted anti-inflammatory effects in HUVECs via the PI3K/Akt/eNOS pathways. Moreover, chemerin plays an anti-inflammatory role in the TNF-ainduced HUVECs injury model and implicate that chemerin may be a protective adipocytokine. We consider chemerin as the mechanism of compensation within a certain range. It is a protective and responsive compensation. Chemerin is increased in preeclampsia. With the disease improved, e.g., after the administration of TNF-a antagonist, chemerin may be decreased. But this part of experiment on human body has not been performed in this present study. So our experimental results are consistent with the result of Hernius’s. In conclusion, we present evidence that chemerin levels in maternal circulation and placenta positively correlated with preeclampsia severity. Chemerin induces NO secretion by HUVECs via the PI3K/Akt/eNOS pathways. Our results suggest that chemerin plays an anti-inflammatory role in TNF-a-induced endothelial injury by activating PI3K/Akt/eNOS pathways. They suggest that novel
Endocrine
therapies that induce chemerin may be useful in treating preeclampsia. Acknowledgments The authors are grateful to the staff of the Division of Obstetrics and Gynaecology at the Second Xiangya Hospital of Central South University for their assistance and collaboration in data collection. Conflict of interest interests.
We declare that we have no conflicts of
Ethical standard All registries have ethical approval appropriate to their national and local ethics guidelines.
References 1. M.D. Lindheimer, S.J. Taler, F.G. Cunningham, Hypertension in pregnancy. J. Am. Soc. Hypertens. 4, 68–78 (2010) 2. M.M. Hedderson, A. Ferrara, High blood pressure before and during early pregnancy is associated with an increased risk of gestational diabetes mellitus. Diabetes Care 31, 2362–2367 (2008) 3. B. Dai, T. Liu, B. Zhang, X. Zhang, Z. Wang, The polymorphism for endothelial nitric oxide synthase gene, the level of nitric oxide and the risk for pre-eclampsia: a meta-analysis. Gene 519, 187–193 (2013) 4. M. Perlik, A. Seremak-Mrozikiewicz, M. Barlik, G. Kurzawinska, W. Krasnik, K. Drews, Genetic variants of endothelial nitric synthase in gestational hypertension and preeclampsia. Ginekol. Pol. 83, 652–659 (2012) 5. K.B. Goralski, T.C. McCarthy, E.A. Hanniman, B.A. Zabel, E.C. Butcher, S.D. Parlee, S. Muruganandan, C.J. Sinal, Chemerin, a novel adipokine that regulates adipogenesis and adipocyte metabolism. J. Biol. Chem. 282, 28175–28188 (2007) 6. S.J. Allen, B.A. Zabel, J. Kirkpatrick, E.C. Butcher, D. Nietlispach, T.M. Handel, NMR assignment of human chemerin, a novel chemoattractant. Biomol. NMR Assign. 1, 171–173 (2007) 7. V. Wittamer, J.D. Franssen, M. Vulcano, J.F. Mirjolet, E. Le Poul, I. Migeotte, S. Brezillon, R. Tyldesley, C. Blanpain, M. Detheux, A. Mantovani, S. Sozzani, G. Vassart, M. Parmentier, D. Communi, Specific recruitment of antigen-presenting cells by chemerin, a novel processed ligand from human inflammatory fluids. J. Exp. Med. 198, 977–985 (2003) 8. J.L. Cash, R. Hart, A. Russ, J.P. Dixon, W.H. Colledge, J. Doran, A.G. Hendrick, M.B. Carlton, D.R. Greaves, Synthetic chemerinderived peptides suppress inflammation through ChemR23. J. Exp. Med. 205, 767–775 (2008) 9. S. Luangsay, V. Wittamer, B. Bondue, O. De Henau, L. Rouger, M. Brait, J.D. Franssen, P. de Nadai, F. Huaux, M. Parmentier, Mouse ChemR23 is expressed in dendritic cell subsets and macrophages, and mediates an anti-inflammatory activity of chemerin in a lung disease model. J. Immunol. 183, 6489–6499 (2009) 10. S.G. Roh, S.H. Song, K.C. Choi, K. Katoh, V. Wittamer, M. Parmentier, S. Sasaki, Chemerin: a new adipokine that modulates adipogenesis via its own receptor. Biochem. Biophys. Res. Commun. 362, 1013–1018 (2007) 11. M. Takahashi, Y. Takahashi, K. Takahashi, F.N. Zolotaryov, K.S. Hong, R. Kitazawa, K. Iida, Y. Okimura, H. Kaji, S. Kitazawa, M. Kasuga, K. Chihara, Chemerin enhances insulin signaling and potentiates insulin-stimulated glucose uptake in 3T3-L1 adipocytes. FEBS Lett. 582, 573–578 (2008)
12. H. Sell, J. Laurencikiene, A. Taube, K. Eckardt, A. Cramer, A. Horrighs, P. Arner, J. Eckel, Chemerin is a novel adipocytederived factor inducing insulin resistance in primary human skeletal muscle cells. Diabetes 58, 2731–2740 (2009) 13. Q. Yan, Y. Zhang, J. Hong, W. Gu, M. Dai, J. Shi, Y. Zhai, W. Wang, X. Li, G. Ning, The association of serum chemerin level with risk of coronary artery disease in Chinese adults. Endocrine 41, 281–288 (2012) 14. M. Yang, G. Yang, J. Dong, Y. Liu, H. Zong, H. Liu, G. Boden, L. Li, Elevated plasma levels of chemerin in newly diagnosed type 2 diabetes mellitus with hypertension. J. Investig. Med. 58, 883–886 (2010) 15. A.A. Roman, S.D. Parlee, C.J. Sinal, Chemerin: a potential endocrine link between obesity and type 2 diabetes. Endocrine 42, 243–251 (2012) 16. Y.J. Hah, N.K. Kim, M.K. Kim, H.S. Kim, S.H. Hur, H.J. Yoon, Y.N. Kim, K.G. Park, Relationship between chemerin levels and cardiometabolic parameters and degree of coronary stenosis in Korean patients with coronary artery disease. Diabetes Metab. J. 35, 248–254 (2011) 17. C. Ress, A. Tschoner, J. Engl, A. Klaus, H. Tilg, C.F. Ebenbichler, J.R. Patsch, S. Kaser, Effect of bariatric surgery on circulating chemerin levels. Eur. J. Clin. Invest. 40, 277–280 (2010) 18. T. Stefanov, M. Bluher, A. Vekova, I. Bonova, S. Tzvetkov, D. Kurktschiev, T. Temelkova-Kurktschiev, Circulating chemerin decreases in response to a combined strength and endurance training. Endocrine 45(3), 382–391 (2014) 19. D.M. Duan, J.M. Niu, Q. Lei, X.H. Lin, X. Chen, Serum levels of the adipokine chemerin in preeclampsia. J. Perinat. Med. 40, 121–127 (2012) 20. H. Stepan, A. Philipp, I. Roth, S. Kralisch, A. Jank, W. Schaarschmidt, U. Lossner, J. Kratzsch, M. Bluher, M. Stumvoll, M. Fasshauer, Serum levels of the adipokine chemerin are increased in preeclampsia during and 6 months after pregnancy. Regul. Pept. 168, 69–72 (2011) 21. C. Popa, M.G. Netea, P.L. van Riel, J.W. van der Meer, A.F. Stalenhoef, The role of TNF-alpha in chronic inflammatory conditions, intermediary metabolism, and cardiovascular risk. J. Lipid Res. 48, 751–762 (2007) 22. A. Var, Y. Yildirim, E. Onur, N.K. Kuscu, B.S. Uyanik, K. Goktalay, Y. Guvenc, Endothelial dysfunction in preeclampsia: increased homocysteine and decreased nitric oxide levels. Gynecol. Obstet. Invest. 56, 221–224 (2003) 23. C.T. Minson, L.A. Holowatz, B.J. Wong, W.L. Kenney, W.L. Kenney, B.W. Wilkins, Decreased nitric oxide- and axon reflexmediated cutaneous vasodilation with age during local heating. J. Appl. Physiol. 93, 1644–1649 (2002) 24. C.F. Mang, S. Truempler, D. Erbelding, H. Kilbinger, Modulation by NO of acetylcholine release in the ileum of wild-type and NOS gene knockout mice. Am. J. Physiol. Gastrointest. Liver Physiol. 283, G1132–G1138 (2002) 25. H. Yamawaki, S. Kameshima, T. Usui, M. Okada, Y. Hara, A novel adipocytokine, chemerin exerts anti-inflammatory roles in human vascular endothelial cells. Biochem. Biophys. Res. Commun. 423, 152–157 (2012) 26. J. Kaur, R. Adya, B.K. Tan, J. Chen, H.S. Randeva, Identification of chemerin receptor (ChemR23) in human endothelial cells: chemerin-induced endothelial angiogenesis. Biochem. Biophys. Res. Commun. 391, 1762–1768 (2010) 27. C.F. Mang, S. Truempler, D. Erbelding, H. Kilbinger, Modulation by NO of acetylcholine release in the ileum of wild-type and NOS gene knockout mice. Am. J. Physiol. Gastrointest. Liver Physiol. 283, G1132–G1138 (2002) 28. K. Osuka, Y. Watanabe, N. Usuda, K. Atsuzawa, J. Yoshida, M. Takayasu, Modification of endothelial nitric oxide synthase
123
Endocrine through AMPK after experimental subarachnoid hemorrhage. J. Neurotrauma 26, 1157–1165 (2009) 29. C. Stirone, A. Boroujerdi, S.P. Duckles, D.N. Krause, Estrogen receptor activation of phosphoinositide-3 kinase, akt, and nitric oxide signaling in cerebral blood vessels: rapid and long-term effects. Mol. Pharmacol. 67, 105–113 (2005)
123
30. M.M. Herenius, A.S. Oliveira, C.A. Wijbrandts, D.M. Gerlag, P.P. Tak, M.C. Lebre, Anti-TNF therapy reduces serum levels of chemerin in rheumatoid arthritis: a new mechanism by which anti-TNF might reduce inflammation. PLoS One 8, e57802 (2013)
ORIGINAL ARTICLE
Chemerin plays a protective role by regulating human umbilical vein endothelial cell-induced nitric oxide signaling in preeclampsia Liqiong Wang • Tianli Yang • Yiling Ding Yan Zhong • Ling Yu • Mei Peng
•
Received: 31 December 2013 / Accepted: 3 May 2014 Ó Springer Science+Business Media New York 2014
Abstract The aim of this study was to determine chemerin levels in preeclampsia and to assess the effects of this anti-inflammatory factor on endothelial nitric oxide synthase (eNOS), nuclear factor (NF)-jB, and vascular cell adhesion molecule (VCAM) expression in human umbilical vein endothelial cells (HUVECs). Serum chemerin and eNOS levels were measured by enzyme-linked immunosorbent assays, while chemerin mRNA and protein levels were measured by fluorescent quantitative polymerase chain reaction and Western blotting, respectively. Nitric oxide (NO) concentrations were determined with a colorimetric method. Akt and eNOS phosphorylation were assessed by Western blotting. We also tested the effects of the phosphoinositide 3-kinase inhibitor LY294002 and the eNOS inhibitor L-NAME. NF-jB p65 and VCAM-1 phosphorylation were assessed by Western blotting to investigate the role of chemerin in tumor necrosis factor (TNF)-a-induced HUVEC injury. Serum chemerin levels were increased in preeclampsia, while eNOS was decreased. Chemerin mRNA and protein were both increased in placentae from patients with preeclampsia. Furthermore, chemerin serum level positively correlated with blood pressure, body mass index, and serum insulin and was negatively correlated with serum eNOS. Chemerin dose-dependently increased NO concentrations in
L. Wang Department of Gynaecology and Obstetrics, The University of Hong Kong-Shenzhen Hospital, Shenzhen 518053, China T. Yang Y. Ding (&) Y. Zhong L. Yu M. Peng Department of Obstetrics and Gynaecology, The Second XiangYa Hospital of Central South University, 139 Ren Min Zhong Lu, Changsha, Hunan 410011, China e-mail: [email protected]
supernatants. Chemerin can increase eNOS and Akt levels in HUVECs, and these results could be partly blocked by LY294002 and L-NAME. Chemerin significantly decreased TNF-a-induced NF-jB and VCAM-1 in HUVECs, and these changes were partly inhibited by LY294002 and L-NAME. Chemerin may play a protective role by regulating NO signaling. Future studies should assess the role of chemerin in preeclampsia and other vascular diseases. Keywords Chemerin Adipokine Preeclampsia Nitric oxide Human umbilical vein endothelial cells
Introduction Preeclampsia is a pregnancy-specific syndrome that can affect almost every organ. It is characterized by systemic small artery spasms induced by diffuse endothelial cell injury and clinical features of newly diagnosed hypertension and proteinuria [1]. Risk factors for preeclampsia include obesity, abnormal lipid metabolism, endothelial injury, and inflammation, which are similar to the risk factors for hypertension, diabetes mellitus, atherosclerosis, and metabolic syndrome. Moreover, the future risk of vascular and metabolic disease is significantly increased after a preeclamptic pregnancy [2]. However, the pathogenesis of this life-threatening condition remains unclear. The placenta is thought to be a major source of endogenous nitric oxide (NO) during pregnancy. Endothelial NO, which is synthesized by endothelial NO synthase (eNOS), is an important regulator of blood flow and vasomotor tone via its inhibition of smooth muscle contraction. Thus, it is hypothesized that NO–eNOS system abnormalities are associated with the onset of preeclampsia [3] [4].
123
Endocrine
Chemerin is a novel adipocytokine that is mainly expressed in adipocytes, liver, placenta, and ovary [5]. A G protein-coupled receptor, chemokine-like receptor 1 (CMKLR1) is a known receptor for chemerin and is expressed both in the placenta and vascular endothelial cells [6]. Recent study reveals that chemerin acts as a chemoattractant for immune cells during early inflammatory reactions [5, 7], and it exerts anti-inflammatory effects by secreting anti-inflammatory substances and accelerating the generation of anti-inflammatory macrophages when inflammation resolves [8, 9]. Chemerin can also promote adipocyte differentiation and fat tissue decomposition [10, 11]; chemerin can induce insulin resistance in skeletal muscle [12]. It was also demonstrated that increased chemerin level is associated with hypertension, coronary disease [13], diabetes mellitus [14, 15], atherosclerosis [16], obesity, and metabolic syndrome [17]. Furthermore, the implementation of a 6-month combined strength and endurance training program significantly reduced circulating chemerin levels in overweight or obese individuals [18]. Although its specific biological functions are controversial, chemerin may play a role in the pathogenesis in preeclampsia. Because of its pleiotropic function, we hypothesized that chemerin may be involved in the pathogenesis of preeclampsia. Two studies reported that maternal chemerin serum concentrations are significantly increased in preeclampsia [19] [20]. However, limited data are available regarding placental mRNA and protein levels of chemerin among pregnancies complicated by preeclampsia. In the present study, we assessed the relationship between chemerin and preeclampsia and tested the hypothesis that chemerin induces NO secretion in human umbilical vein endothelial cells (HUVECs).
group. The exclusion criteria were as follows: (1) pregnancy complicated with nephropathy, infection, endocrine, hepatic, or cardiovascular diseases; (2) multiple pregnancy; (3) assisted reproduction; or (4) previous drug treatment. Serum chemerin and eNOS Venous blood sample was obtained after an overnight fast and 24 h before delivery. Immediately after sampling, serum was separated by centrifugation at 2,500 rpm for 10 min and frozen at -70 °C. Chemerin and eNOS serum concentrations were determined with commercially available enzyme-linked immunosorbent assays (ELISA; Uscn Life Science, Wuhan, China) according to the manufacturer’s instructions. The sensitivities of the chemerin and eNOS ELISA assays were 0.156–10 ng/ml and 15.6–1,000 pg/ml, respectively. The interassay coefficients of variation were \10 %, and the within-assay coefficients of variation were \5 %. We also measured fasting glucose (FG), fasting insulin (FINS), total cholesterol (TCH), triglycerides (TG), prothrombin time (PT), fibrinogen (FIB), activated partial thromboplastin time (APTT), blood urea nitrogen (BUN), creatinine (CRE), alanine aminotransferase (ALT), and platelets (PLT). Placenta sample acquisition Within 30 min of delivery of the placenta, samples were obtained from center of the maternal surface, and areas of necrosis and calcification were excluded under aseptic conditions. The specimens were rinsed with normal saline and divided into two portions. After removal of visible blood vessels, both portions were frozen immediately in liquid nitrogen and stored at -70 °C for fluorescent quantitative polymerase chain reaction (FQ-PCR) and Western blot.
Research design and methods Chemerin mRNA in placenta and FQ-PCR Study population Women with preeclampsia (moderate preeclampsia, MPE, n = 30; severe preeclampsia, SPE, n = 30) and control patients (n = 28) were recruited from the Department of Obstetrics at the Second Xiangya Hospital of Central South University between September 2012 and September 2013. Preeclampsia patients met the following criteria: increased gestational blood pressure [140 mmHg systolic or [90 mmHg diastolic accompanied by proteinuria in patients who were normotensive before 20 weeks of gestation. Primiparas with single fetuses who underwent cesarean sections because of intrauterine fetal distress, breech presentation, cephalopelvic disproportion, umbilical cord factors, or other factors were recruited as a control
123
Total RNA was extracted from placenta samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The concentration and purity of isolated RNA were assessed by measuring the optical density at 260 nm (OD260) and 280 nm (OD280), and the integrity of RNA was also determined by visualization of 18S and 28S ribosomal bands. A total of 2 lg RNA from each sample was reverse transcribed using oligo (dT) and M-MLV Reverse Transcriptase (Promega, Madison, WI, USA), according to the manufacturer’s instructions. An 2-ll aliquot of the resulting cDNA was used for FQ-PCR, which was carried out in a volume of 20 ll containing 10 ll SYBRÒ Premix Ex TaqTM, 10 lM forward primer, 10 lM reverse primer, and ddH20. The primers used for amplification are shown in
Endocrine Table 1 Primers for RT-PCR reaction Gene title
Primer sequence
Product (bp)
Chemerin
F:TTCCCAGCTGGAATATTTGTG
149
R:TTGTCCTCAGAGCCCAGTTT b-actin
F:AATCGTGCGTGACATTAAGGAG
275
a humidified incubator at 37 °C under 5 % CO2. Cells at passage 3–4 were used for experiments. HUVECs were identified by immunofluorescence staining of HUVECspecific antibody human factor VIII-related antigen (Santa Cruz Biotechnology, Santa Cruz, CA, USA) according to the manufacturer’s instructions.
R:ACTGTGTTGGCGTACAGGTCTT
NO production and Griess assay Table 1. Apart from the optimal annealing temperature and number of amplification cycles, other conditions were the same in all PCR reactions: 10 s for an initial denaturation at 95 °C, followed by 40 cycles (10 s for denaturation at 95 °C, 30 s for annealing, and extension at 60 °C). Chemerin in placenta and Western blot
HUVECs were further cultured at 37 °C for the indicated time (12, 24, or 48 h), in the absence (control) or presence of 10, 100, 500, or 1,000 ng/ml chemerin (PeproTech Inc., Rocky Hill, NJ, USA). Culture supernatants were harvested to determine the production of NO by the Griess assay. This assay determines nitrite concentrations to reflect the total level of NO, and the absorbance was spectrophotometrically measured at 540 nm. The Griess kit was purchased from BioVision Inc. (Milpitas, CA, USA), and the measurements were performed according to the manufacturer’s instructions. All the experiments were performed at least in triplicate.
Placenta samples (50 mg) were mixed with radioimmunoprecipitation analysis (RIPA) lysis buffer, and the supernatant was separated by centrifugation at 12,000 rpm for 3 min at 4 °C. The protein concentration was determined with a bicinchoninic acid (BCA) protein assay kit (Pierce Rockford, IL). Protein samples were mixed with sample buffer and subjected to 12 % sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) before transfer to polyvinylidene fluoride (PVDF) membranes. Primary antibodies for chemerin (1:200 dilution mouse chemerin antibody, Abcam, Cambridge, UK) were incubated overnight with the membranes in phosphatebuffered saline with Tween 20 (PBST) with 5 % skimmed milk at 4 °C. Membranes were subsequently washed with PBST and incubated with a secondary antibody (1:1,000 dilution, donkey anti-Mouse IgG (H ? L), LI-COR Biosciences, Lincoln, NE, USA) for 1 h at room temperature. Relative levels of chemerin secretion were normalized to b-actin in the corresponding samples. Protein expression was quantified by scanning of the Odyssey infrared imaging system (LI-COR Biosciences).
HUVECs were further cultured at 37 °C for 24 h, in the absence (controls) or presence of 10, 100, 500, or 1,000 ng/ml chemerin (PeproTech Inc.). Protein lysates were obtained by HUVECs with SDS lysis buffer (50 mM Tris, pH 8.1, 1 g/l SDS, 0.5 g/l protease inhibitor, 1 mM PMSF, 1 mM EDTA, sodium pyrophosphate, glycerophosphate). Protein concentration was determined using the BCA method (Pierce). Western blot was performed to determine phosphorylation levels of Akt (p-Akt, Ser473) (1:200 dilution, mouse p-Akt antibody, Abcam) and eNOS (p-eNOS, Ser1177) (1:200 dilution, mouse p-eNOS antibody, Abcam) in HUVECs. The results were analyzed using Gel-Pro Analyzer (Media Cybernetics, Rockville, MD, USA).
Cell culture and identification
Application of PI3K inhibitor LY294002 and NOS inhibitor L-NAME
HUVECs were extracted from the umbilical cords of healthy pregnant women by collagenase digestion of the interior of the umbilical vein. The cell suspension was centrifuged at 1,000 rpm for 5 min, and the cell pellet was resuspended in 4 ml Medium 199 (GIBCO/Invitrogen) supplemented with 20 % fetal calf serum (GIBCO/Invitrogen), 50 lg/ml endothelial cell growth supplements (Becton, Dickinson and Company, Franklin Lakes, NJ, USA), 50 lg/ml heparin sodium, and 2 lmol/l glutamine. The cells were plated into six-well plates and incubated in
We next investigated inhibitors of PI3K/Akt/eNOS signaling pathway and the effect of chemerin induction on p-eNOS and p-Akt levels. HUVECs were divided into four groups and cultured at 37 °C for 24 h in the absence (controls) or presence of 500 ng/ml chemerin, 500 ng/ml chemerin and 5 lmol/ml LY294002 (Beyotime, Haimen, China), 500 ng/ml chemerin, and 0.5 mmol/ml L-NAME (BiYunTian Biotechnology Co., LTD, Shanghai, China). Western blotting was performed to determine p-Akt and p-eNOS levels in HUVECs.
Effect of chemerin on PI3K/Akt/eNOS pathways in HUVECs and Western blot
123
Endocrine
Tumor necrosis factor (TNF)-a-induced HUVECs injury model We established a HUVEC injury model by co-culturing HUVECs with 5 ng/ml TNF-a (PeproTech Inc.) at 37 °C for 6 h [21]. Five groups were included: controls, 5 ng/ml TNF-a 6 h, 24-h pretreatment of chemerin (500 ng/ml) ? TNF-a (5 ng/ml, 6 h), 24-h pretreatment of chemerin (500 ng/ml) and LY294002 (5 lmol/ml) ? TNF-a (5 ng/ml, 6 h), 24-h pretreatment of chemerin and L-NAME (0.5 mmol/ ml) ? TNF-a (5 ng/ml, 6 h). We determined activation of phosphorylation of nuclear factor (NF)-jB p65 (Ser536) and expression of VCAM-1 by Western blot.
Chemerin mRNA and protein expression in placenta Compared with controls, chemerin mRNA and protein expressions in placenta were significantly higher in preeclampsia groups (P \ 0.05), which corresponded with serum chemerin levels (Table 3; Fig. 1). Univariate correlations Serum chemerin levels positively correlated with SBP, DBP, BMI, and serum insulin and negatively correlated with serum eNOS (Table 4). HUVEC culture and identification
Statistical analysis All statistical analyses were performed with SPSS software version 17.0 (SPSS Inc., Chicago, IL, USA). Results are represented as mean ± standard error of mean (SEM). Distributions were tested for normality using one-way analysis of variance (ANOVA), and differences between two groups were assessed by Student–Newman–Keuls (SNK) tests. Repetitive measurements and ANOVAs were performed for NO concentration measurements induced by the indicated concentrations of chemerin for the indicated times. Nonnormally distributed parameters were analyzed with Dunnett’s T3 test. Correlations were performed using Spearman’s rank correlation method. A p-value \0.05 was considered statistically significant unless otherwise indicated.
Results Serum chemerin and eNOS Table 2 summarizes the clinical characteristics and laboratory data of the subgroups studied (Control, MPE, SPE) during pregnancy. Chemerin serum levels were increased in preeclampsia patients compared with controls (220.00 ng/ml); furthermore, chemerin in SPE (493.83 ng/ml) was significantly higher than that in MPE (330.23 ng/ml, P \ 0.05). eNOS serum levels were decreased in subjects with preeclampsia compared with controls (1.46 pg/ml), whereas eNOS in SPE (0.88 pg/ml) was significantly lower than that in MPE (1.12 pg/ml) (P \ 0.05). Age, gestational age at blood sampling, FBG, TCH, PLT, ALT, BUN, CRE, PT, APTT, and FIB were not significantly different among the three groups. Systolic (SBP) and diastolic (DBP) blood pressure, body mass index (BMI), FINS, homeostasis model assessment of insulin resistance (HOMA-IR), TG, and 24-h urine protein (24-h Pro) were significantly increased in patients with preeclampsia compared with controls. BMI, FINS, HOMA-IR, and TG were higher in SPE than in MPE.
123
The cells we cultured were in good condition, monolayer, and flagstone shaped. Immunofluorescence labeling revealed that the cells were positive for factor VIII, confirming that they were HUVECs (Fig. 2). Comparisons of NO concentrations induced by chemerin To explore the effect of chemerin on HUVECs, we pretreated HUVECs with indicated concentrations of chemerin (0, 10, 100, 500, or 1,000 ng/ml) for the indicated times (12, 24, or 48 h), then measured the NO concentration in HUVEC supernatants. Chemerin increased the NO concentrations in a dose-dependent manner in the range of 0–500 ng/ml, with a maximal effect achieved at 1,000 ng/ ml, but there were no significant differences in NO production between 500 ng/ml and 1,000 ng/ml (P [ 0.05). Therefore, we concluded that the optimal concentration and reaction time were 500 ng/ml and 24 h, respectively (Table 5; Fig. 3). Chemerin induces NO production via PI3K/Akt/eNOS pathway activation We next confirmed that chemerin-induced NO production via PI3K/Akt/eNOS signaling. In accordance with NO concentration, chemerin significantly and dose-dependently increased p-Akt and p-eNOS in HUVECs in the range of 0–500 ng/ml (Fig. 4), and this effect was partially inhibited by the PI3K inhibitor LY294002 and the NOS inhibitor L-NAME (Fig. 5). Effect of chemerin on NF-jB and VCAM-1 expression in a TNF-a-induced HUVECs injury model We investigated the anti-inflammatory effect of chemerin in a TNF-a-induced HUVECs injury model. We pretreated HUVECs with 500 ng/ml chemerin for 24 h, stimulated the
Endocrine Table 2 Baseline characteristics and laboratory data of the study population
Controls
MPE
SPE
N
28
30
30
Age (years)
28.2 ± 4.8
27.9 ± 6.5
28.5 ± 5.5
Gestational age at blood sampling (weeks)
39.3 ± 0.9
38.5 ± 1.6
37.4 ± 2.9
SBP (mmHg)
109.25 ± 12.33`´
DBP (mmHg) 2
SBP systolic blood pressure, DBP diastolic blood pressure, BMI body mass index, FG fasting glucose, FINS fasting insulin, HOMA-IR homeostasis model assessment of insulin resistance, TG triglycerides, TCH total cholesterol, PLT platelet, ALT alanine aminotransferase, BUN blood urea nitrogen, CRE creatinine, 24 h Pro 24-h urine protein, PT prothrombin time, APTT activated partial thromboplastin time, FIB fibrinogen, eNOS endothelial NO synthase
P \ 0.05, compared to controls; ` P \ 0.05, compared to MPE; ´ P \ 0.05, compared to SPE
BMI (kg/m )
Controls MPE SPE ´
28 30 30
168.07 ± 22.92`
´
108.30 ± 16.63`
93.83 ± 10.10 27.49 ± 2.68
´
28.65 ± 3.98`
FG (mmol/l)
4.24 ± 0.50
4.51 ± 0.64
4.98 ± 0.90
7.45 ± 1.27`´
8.45 ± 2.55´
11.84 ± 2.55`
HOMA-IR
1.78 ± 0.78`´
2.02 ± 0.60´
2.92 ± 1.05`
`´
´
TG (mmol/l)
2.45 ± 0.53
3.02 ± 0.45
4.23 ± 0.46`
TCH (mmol/l) PLT (109/l)
5.82 ± 0.90 210.20 ± 45.83
5.85 ± 1.08 195.80 ± 52.51
5.83 ± 1.36 204.67 ± 47.80
ALT (U/l)
22.89 ± 10.55
24.60 ± 9.82
25.47 ± 8.01
BUN (mmol/l)
3.98 ± 1.12
4.05 ± 0.95
4.33 ± 1.20
CRE (lmol/l)
74.07 ± 18.20
79.04 ± 13.47
83.05 ± 22.34
24 h Pro (g/24 h)
45.27 ± 30.15`´
658.50 ± 320.24´
2674.87 ± 1150.25`
PT (s)
11.00 ± 1.18
11.44 ± 1.25
12.17 ± 4.23
APTT (s)
23.18 ± 5.50
22.53 ± 4.16
22.98 ± 7.10
FIB (g/l)
3.43 ± 0.73
3.04 ± 0.65
3.07 ± 0.54
eNOS (pg/ml)
1.46 ± 0.31`´
1.12 ± 0.16´ `´
chemerin
Chemerin mRNA
220.00 ± 50.78
-4
-4´
3.04 9 10 ± 0.87 9 10 4.00 9 10-4 ± 1.11 9 10-4` `
0.88 ± 0.23` ´
330.23 ± 56.22
Table 4 Univariate correlations with serum chemerin concentrations, r- and p-values are given
493.83 ± 105.23`
Variances
r
P
SBP
0.690
0.000*
DBP
0.655
0.000*
0.57 ± 0.15`´
BMI
0.724
0.000*
1.20 ± 0.17´ 1.84 ± 0.40`
Serum insulin
0.627
0.000*
Serum eNOS
-0.727
0.000*
Chemerin protein
1.13 9 10-4 ± 0.54 9 10-4`´
P \ 0.05, compared to controls; P \ 0.05, compared to SPE
26.28 ± 3.16
`´
147.27 ± 6.18´
FINS (mU/ml)
Table 3 Chemerin mRNA and protein expression among three groups and variance analysis result N
71.07 ± 5.89
`´
P \ 0.05, compared to MPE;
* A p-value of \0.01 was considered as statistically significant
Discussion
Fig. 1 Chemerin expressions among three groups. Compared with controls, chemerin protein expressions in placenta were significantly higher in preeclampsia groups
cells with 5 ng/ml TNF-a for 6 h, and then measured NFjB and VCAM-1 levels. Chemerin significantly reversed TNF-a-induced expression of NF-jB and VCAM-1. These inhibitory effects of chemerin were partially reversed by the PI3K inhibitor LY294002 or the eNOS inhibitor L-NAME (Fig. 6).
Our results demonstrate that circulating chemerin levels were significantly increased in preeclampsia patients compared with healthy pregnant women. Furthermore, chemerin levels were higher in patients with SPE compared with those with MPE. These findings indicate that differential expressions of chemerin may be responsible for pathological changes in patients with preeclampsia. Biomarkers of metabolism in SPE patients (e.g., BMI, HOMAIR, and TG) were higher than those in women with MPE, which indicates more severe glucose and lipid metabolism dysfunction and abnormal accumulation of body fat in SPE patients. In addition, we demonstrated that serum chemerin levels positively correlated with SBP, DBP, BMI, and serum insulin which is in accordance with the hypothesis
123
Endocrine
Fig. 3 Estimated marginal means of measure. Outline of the figure of NO concentrations in supernatants induced by indicated concentration of chemerin for indicated time
Fig. 2 Identification of human umbilical vein endothelial cells. a Cell growth and form at high magnification microscope (9200 times). b Cell cytoplasm viii factor expression under the fluorescence microscope (9100 times)
Table 5 NO concentrations (lM) in supernatants induced by indicated concentration of chemerin for indicated time Chemerin concentration
Time 12 h
24 h
48 h
0 (controls)
5.875 ± 0.684
6.798 ± 1.660
6.691 ± 0.372
10 ng/ml
9.010 ± 2.893
10.095 ± 1.085
11.180 ± 2.256
100 ng/ml
14.911 ± 2.132
20.283 ± 3.093
19.655 ± 3.554
500 ng/ml
20.256 ± 4.565
30.085 ± 5.660
30.395 ± 5.352
1000 ng/ml
18.132 ± 4.492
31.423 ± 6.312
30.527 ± 5.720
Repetitive measurement and analysis of variance were performed: (1) Ftime = 307.754, P = 0.000, indicated that there were significant differences among NO concentrations induced by chemerin for indicated time in HUVECs; Fconcentration = 18.506, P = 0.000, indicated that there were significant differences among NO concentrations induced by indicated concentration of chemerin (0, 10, 100, 500, 1,000 ng/ml) in HUVECs; Ft*c = 46.196, P = 0.000, indicated that interaction effect existed among these groups. (2) By pairwise comparison, no significant difference existed between 500 and 1,000 ng/ ml group (P [ 0.05); significant differences existed among other groups (P \ 0.05)
123
that preeclampsia risk factors (obesity, abnormal lipid metabolism, endothelial injury, inflammation, etc.) overlap with those for hypertension, diabetes mellitus, atherosclerosis, and metabolic syndrome. This is in accordance with both previous reports [19, 20]. To the best of our knowledge, our results provide the first evidence that chemerin mRNA and protein levels are significantly higher in preeclampsia patients in a severity-dependent manner. Based on these findings, we hypothesized that increased chemerin expression may be responsible for the pathogenesis, development, and severity of clinical features of preeclampsia due to increased binding with its receptor in the placenta. It is well established that NO is related to the pathogenesis of preeclampsia [22]. NO is also regarded as a vasodilatory substance because it activates cyclic guanosine monophosphate (cGMP)-induced potassium efflux and calcium channel inactivation. Because of NO’s short halflife, the rate-limiting enzyme of NO synthesis (eNOS) was determined to reflect the level of circulating NO. We found that eNOS serum levels were decreased in patients with preeclampsia, and eNOS was significantly lower in patients with SPE compared with those with MPE. Moreover, it has been demonstrated that serum chemerin and eNOS levels are negatively correlated. The key pathogenetic mechanism of preeclampsia is the activation and/or injury of diffuse endothelial cells during pregnancy. HUVECs are a useful model system because they are easy to acquire and they
Endocrine
Fig. 4 Effects of chemerin on expression of Akt and eNOS in HUVECs. HUVECs were pretreated with the indicated concentration of chemerin for 24 h. The expression of Akt and eNOS of HUVECs were measured using Western blot analysis. a Representative Western blots of Akt and eNOS for the indicated concentration of chemerin. b Semiquantitative analysis of proteins showed that chemerin increased phosphorylation of Akt and eNOS in HUVECs in a dosedependent manner in range of 0–500 ng/ml. Data are expressed as the mean ± SEM of the independent experiments. DP \ 0 05 versus control; #P \ 0.05 versus 10 ng/ml chemerin, *P \ 0 05 versus 100 ng/ml chemerin
share similar biological characteristics with artery endothelium. Therefore, we next examined the effects of chemerin on HUVECs. We cultured HUVECs for the indicated times (12, 24, or 48 h) in the absence (controls) or presence of 10, 100, 500 and 1000 ng/ml chemerin. Based on previous results of our study, we initially expected that chemerin, which is regarded as a chemoattractant for immune cells, would inhibit NO expression. However, chemerin (10–1,000 ng/ ml) significantly and dose-dependently increased NO concentrations in HUVEC supernatants in a range of 10–500 ng/ml. It is known that low physiological concentration of eNOS-induced NO plays vasodilatory and antiinflammatory roles in the pathogenesis of preeclampsia. Conversely, inducible NOS (iNOS) synthesizes high levels of NO, which has the opposite effect on dilation and inflammation [23, 24]. Although the concentration of NO
Fig. 5 Effects of P13K inhibitor LY294002 and eNOS inhibitor L-NAME on chemerin-induced expression of Akt and eNOS in HUVECs. HUVECs were treated with chemerin (500 ng/ml) for 24 h alone or chemerin ? LY294002 (5 lmol/ml, 24 h) or chemerin ? LNAME (0.5 mmol/ml, 24 h). The expression of Akt and eNOS of HUVECs were measured using Western blot analysis. a Representative Western blot of Akt and eNOS expression with different treatments in HUVECs. b Chemerin increased phosphorylation of Akt and eNOS in HUVECs. This effect was partially inhibited by P13K inhibitor LY294002. The eNOS inhibitor L-NAME could increase of eNOS but did not have effect on Akt. Data are expressed as the mean ± SEM of the independent experiments. DP \ 0.05 versus control; #P \ 0.05 versus chemerin
was not high, we were not sure that it was protective NO generated by eNOS. Thus, in order to determine the source of NO, we performed Western blots for eNOS and Akt to study the possible signaling of chemerin-induced NO. Consistent with NO being increased, chemerin (0–500 ng/ ml) significantly and dose-dependently induced p-Akt and p-eNOS in HUVECs. This effect was partially inhibited by the PI3K and eNOS inhibitors. These findings indicated that chemerin exerted anti-inflammatory effects in HUVECs via the PI3K/Akt/eNOS pathways. Furthermore, we showed that the optimal concentration and reaction time of chemerin were 500 ng/ml and 24 h, respectively, which is partly in accordance with previously reported findings [25].
123
Endocrine
Fig. 6 Effects of chemerin on TNF-a induced NF-jB expression and VCAM-l in HUVECs. HUVECs were treated with TNP-a (5 ng/ml) for 6 h is the absence or presence of chemerin (500 ng/ml pretreatment for 24 h). Expression of NP-jB and VCAM-1 were determined by Western blotting. a Representative Western blots of NP-jB and VCAM-1 for different treatments. b Semiquantitative analysis of proteins showed that chemerin reversed the activation of TNF-ainduced expression of NP-jB phosphorylation and VCAM-1. This inhibitory effects of chemerin can be partially reversed by P13K inhibitor LY294002 or eNOS inhibitor L-NAME. Data are expressed as the mean ? SEM of the independent experiments. DP \ 0.05 versus control; #P \ 0.05 versus TNF-a; *P\0.05 versus 100 ng/ml chemerin? TNF-a
Importantly, the serum chemerin in SPE patients in the present study was 493.83 ± 105.23 ng/ml, so 500 ng/ml is a physiological concentration. It has been widely demonstrated that chemerin functions vary depending on cell type, as mentioned above [5, 7–12] [26]. In the present study, we noticed that although LY294002 and L-NAME could reverse chemerin-stimulated p-Akt and p-eNOS expression, the results were still higher than those in controls, which implies that other unidentified pathways might be involved and further experiments are necessary. There
123
are three main pathways leading to eNOS phosphorylation: (1) intracellular Ca2? increases [27], (2) AMPK phosphorylation of eNOS [28], and (3) PI3K/Akt/eNOS pathway signaling [29]. Therefore, it is assumed that chemerin can increase intracellular Ca2? levels in vascular endothelial cells. We admit that L-NAME is a non-specific eNOS inhibitor. But in current study, Western blot has already performed to determine expression of phosphorylation of eNOS. In addition, LY294002 inhibits PI3Kinase, which is upstream of eNOS, but not iNOS. Because chemerin increased NO expression via PI3K/ Akt/eNOS pathways, it will be interesting to determine whether treatments that target chemerin can be applied to treat inflammatory diseases. Further, we established a HUVEC injury model by co-culturing HUVECs with TNFa and determining chemerin functions. We found that TNF-a significantly stimulated NF-jB and VCAM-1 expression compared with controls, and this could be significantly reversed by chemerin (500 ng/ml, 24 h). Moreover, LY294002 and L-NAME also reversed these inhibitory effects of chemerin. These results reveal that chemerin plays an anti-inflammatory role in the TNF-ainduced HUVECs injury model and implicate that chemerin may be a protective adipocytokine. Herenius et al. [30] demonstrated that anti-TNF therapy can reduce chemerin serum levels in rheumatoid arthritis. Our study is different from Hernius et al. in that we tested the effect of chemerin on TNF-a-induced response in vitro in HUVECs, whereas they studied the effect of blocking TNF-a on serum chemerin levels in patients. In the current study, chemerin (0–500 ng/ml) significantly and dose-dependently induced p-Akt and p-eNOS in HUVECs. This effect was partially inhibited by the PI3K and eNOS inhibitors. These findings indicated that chemerin exerted anti-inflammatory effects in HUVECs via the PI3K/Akt/eNOS pathways. Moreover, chemerin plays an anti-inflammatory role in the TNF-ainduced HUVECs injury model and implicate that chemerin may be a protective adipocytokine. We consider chemerin as the mechanism of compensation within a certain range. It is a protective and responsive compensation. Chemerin is increased in preeclampsia. With the disease improved, e.g., after the administration of TNF-a antagonist, chemerin may be decreased. But this part of experiment on human body has not been performed in this present study. So our experimental results are consistent with the result of Hernius’s. In conclusion, we present evidence that chemerin levels in maternal circulation and placenta positively correlated with preeclampsia severity. Chemerin induces NO secretion by HUVECs via the PI3K/Akt/eNOS pathways. Our results suggest that chemerin plays an anti-inflammatory role in TNF-a-induced endothelial injury by activating PI3K/Akt/eNOS pathways. They suggest that novel
Endocrine
therapies that induce chemerin may be useful in treating preeclampsia. Acknowledgments The authors are grateful to the staff of the Division of Obstetrics and Gynaecology at the Second Xiangya Hospital of Central South University for their assistance and collaboration in data collection. Conflict of interest interests.
We declare that we have no conflicts of
Ethical standard All registries have ethical approval appropriate to their national and local ethics guidelines.
References 1. M.D. Lindheimer, S.J. Taler, F.G. Cunningham, Hypertension in pregnancy. J. Am. Soc. Hypertens. 4, 68–78 (2010) 2. M.M. Hedderson, A. Ferrara, High blood pressure before and during early pregnancy is associated with an increased risk of gestational diabetes mellitus. Diabetes Care 31, 2362–2367 (2008) 3. B. Dai, T. Liu, B. Zhang, X. Zhang, Z. Wang, The polymorphism for endothelial nitric oxide synthase gene, the level of nitric oxide and the risk for pre-eclampsia: a meta-analysis. Gene 519, 187–193 (2013) 4. M. Perlik, A. Seremak-Mrozikiewicz, M. Barlik, G. Kurzawinska, W. Krasnik, K. Drews, Genetic variants of endothelial nitric synthase in gestational hypertension and preeclampsia. Ginekol. Pol. 83, 652–659 (2012) 5. K.B. Goralski, T.C. McCarthy, E.A. Hanniman, B.A. Zabel, E.C. Butcher, S.D. Parlee, S. Muruganandan, C.J. Sinal, Chemerin, a novel adipokine that regulates adipogenesis and adipocyte metabolism. J. Biol. Chem. 282, 28175–28188 (2007) 6. S.J. Allen, B.A. Zabel, J. Kirkpatrick, E.C. Butcher, D. Nietlispach, T.M. Handel, NMR assignment of human chemerin, a novel chemoattractant. Biomol. NMR Assign. 1, 171–173 (2007) 7. V. Wittamer, J.D. Franssen, M. Vulcano, J.F. Mirjolet, E. Le Poul, I. Migeotte, S. Brezillon, R. Tyldesley, C. Blanpain, M. Detheux, A. Mantovani, S. Sozzani, G. Vassart, M. Parmentier, D. Communi, Specific recruitment of antigen-presenting cells by chemerin, a novel processed ligand from human inflammatory fluids. J. Exp. Med. 198, 977–985 (2003) 8. J.L. Cash, R. Hart, A. Russ, J.P. Dixon, W.H. Colledge, J. Doran, A.G. Hendrick, M.B. Carlton, D.R. Greaves, Synthetic chemerinderived peptides suppress inflammation through ChemR23. J. Exp. Med. 205, 767–775 (2008) 9. S. Luangsay, V. Wittamer, B. Bondue, O. De Henau, L. Rouger, M. Brait, J.D. Franssen, P. de Nadai, F. Huaux, M. Parmentier, Mouse ChemR23 is expressed in dendritic cell subsets and macrophages, and mediates an anti-inflammatory activity of chemerin in a lung disease model. J. Immunol. 183, 6489–6499 (2009) 10. S.G. Roh, S.H. Song, K.C. Choi, K. Katoh, V. Wittamer, M. Parmentier, S. Sasaki, Chemerin: a new adipokine that modulates adipogenesis via its own receptor. Biochem. Biophys. Res. Commun. 362, 1013–1018 (2007) 11. M. Takahashi, Y. Takahashi, K. Takahashi, F.N. Zolotaryov, K.S. Hong, R. Kitazawa, K. Iida, Y. Okimura, H. Kaji, S. Kitazawa, M. Kasuga, K. Chihara, Chemerin enhances insulin signaling and potentiates insulin-stimulated glucose uptake in 3T3-L1 adipocytes. FEBS Lett. 582, 573–578 (2008)
12. H. Sell, J. Laurencikiene, A. Taube, K. Eckardt, A. Cramer, A. Horrighs, P. Arner, J. Eckel, Chemerin is a novel adipocytederived factor inducing insulin resistance in primary human skeletal muscle cells. Diabetes 58, 2731–2740 (2009) 13. Q. Yan, Y. Zhang, J. Hong, W. Gu, M. Dai, J. Shi, Y. Zhai, W. Wang, X. Li, G. Ning, The association of serum chemerin level with risk of coronary artery disease in Chinese adults. Endocrine 41, 281–288 (2012) 14. M. Yang, G. Yang, J. Dong, Y. Liu, H. Zong, H. Liu, G. Boden, L. Li, Elevated plasma levels of chemerin in newly diagnosed type 2 diabetes mellitus with hypertension. J. Investig. Med. 58, 883–886 (2010) 15. A.A. Roman, S.D. Parlee, C.J. Sinal, Chemerin: a potential endocrine link between obesity and type 2 diabetes. Endocrine 42, 243–251 (2012) 16. Y.J. Hah, N.K. Kim, M.K. Kim, H.S. Kim, S.H. Hur, H.J. Yoon, Y.N. Kim, K.G. Park, Relationship between chemerin levels and cardiometabolic parameters and degree of coronary stenosis in Korean patients with coronary artery disease. Diabetes Metab. J. 35, 248–254 (2011) 17. C. Ress, A. Tschoner, J. Engl, A. Klaus, H. Tilg, C.F. Ebenbichler, J.R. Patsch, S. Kaser, Effect of bariatric surgery on circulating chemerin levels. Eur. J. Clin. Invest. 40, 277–280 (2010) 18. T. Stefanov, M. Bluher, A. Vekova, I. Bonova, S. Tzvetkov, D. Kurktschiev, T. Temelkova-Kurktschiev, Circulating chemerin decreases in response to a combined strength and endurance training. Endocrine 45(3), 382–391 (2014) 19. D.M. Duan, J.M. Niu, Q. Lei, X.H. Lin, X. Chen, Serum levels of the adipokine chemerin in preeclampsia. J. Perinat. Med. 40, 121–127 (2012) 20. H. Stepan, A. Philipp, I. Roth, S. Kralisch, A. Jank, W. Schaarschmidt, U. Lossner, J. Kratzsch, M. Bluher, M. Stumvoll, M. Fasshauer, Serum levels of the adipokine chemerin are increased in preeclampsia during and 6 months after pregnancy. Regul. Pept. 168, 69–72 (2011) 21. C. Popa, M.G. Netea, P.L. van Riel, J.W. van der Meer, A.F. Stalenhoef, The role of TNF-alpha in chronic inflammatory conditions, intermediary metabolism, and cardiovascular risk. J. Lipid Res. 48, 751–762 (2007) 22. A. Var, Y. Yildirim, E. Onur, N.K. Kuscu, B.S. Uyanik, K. Goktalay, Y. Guvenc, Endothelial dysfunction in preeclampsia: increased homocysteine and decreased nitric oxide levels. Gynecol. Obstet. Invest. 56, 221–224 (2003) 23. C.T. Minson, L.A. Holowatz, B.J. Wong, W.L. Kenney, W.L. Kenney, B.W. Wilkins, Decreased nitric oxide- and axon reflexmediated cutaneous vasodilation with age during local heating. J. Appl. Physiol. 93, 1644–1649 (2002) 24. C.F. Mang, S. Truempler, D. Erbelding, H. Kilbinger, Modulation by NO of acetylcholine release in the ileum of wild-type and NOS gene knockout mice. Am. J. Physiol. Gastrointest. Liver Physiol. 283, G1132–G1138 (2002) 25. H. Yamawaki, S. Kameshima, T. Usui, M. Okada, Y. Hara, A novel adipocytokine, chemerin exerts anti-inflammatory roles in human vascular endothelial cells. Biochem. Biophys. Res. Commun. 423, 152–157 (2012) 26. J. Kaur, R. Adya, B.K. Tan, J. Chen, H.S. Randeva, Identification of chemerin receptor (ChemR23) in human endothelial cells: chemerin-induced endothelial angiogenesis. Biochem. Biophys. Res. Commun. 391, 1762–1768 (2010) 27. C.F. Mang, S. Truempler, D. Erbelding, H. Kilbinger, Modulation by NO of acetylcholine release in the ileum of wild-type and NOS gene knockout mice. Am. J. Physiol. Gastrointest. Liver Physiol. 283, G1132–G1138 (2002) 28. K. Osuka, Y. Watanabe, N. Usuda, K. Atsuzawa, J. Yoshida, M. Takayasu, Modification of endothelial nitric oxide synthase
123
Endocrine through AMPK after experimental subarachnoid hemorrhage. J. Neurotrauma 26, 1157–1165 (2009) 29. C. Stirone, A. Boroujerdi, S.P. Duckles, D.N. Krause, Estrogen receptor activation of phosphoinositide-3 kinase, akt, and nitric oxide signaling in cerebral blood vessels: rapid and long-term effects. Mol. Pharmacol. 67, 105–113 (2005)
123
30. M.M. Herenius, A.S. Oliveira, C.A. Wijbrandts, D.M. Gerlag, P.P. Tak, M.C. Lebre, Anti-TNF therapy reduces serum levels of chemerin in rheumatoid arthritis: a new mechanism by which anti-TNF might reduce inflammation. PLoS One 8, e57802 (2013)
