Appl Biochem Biotechnol (2015) 175:243–252 DOI 10.1007/s12010-014-1263-x
Characterization of Tryptophanase from Vibrio cholerae Taiyeebah Nuidate & Natta Tansila & Piraporn Chomchuen & Phattiphong Phattaranit & Supachok Eangchuan & Varaporn Vuddhakul
Received: 19 April 2014 / Accepted: 15 September 2014 / Published online: 25 September 2014 # Springer Science+Business Media New York 2014
Abstract Tryptophanase (Trpase) is a pyridoxal phosphate (PLP)-dependent enzyme responsible for the production of indole, an important intra- and interspecies signaling molecule in bacteria. In this study, the tnaA gene of Vibrio cholerae coding for VcTrpase was cloned into the pET-20b(+) vector and expressed in Escherichia coli BL21(DE3) tn5:tnaA. Using Ni2+nitrilotriacetic acid (NTA) chromatography, VcTrpase was purified, and it possessed a molecular mass of ∼49 kDa with specific absorption peaks at 330 and 435 nm and a specific activity of 3 U/mg protein. The VcTrpase had an 80 % homology to the Trpase of Haemophilus influenzae and E. coli, but only around 50 % identity to the Trpase of Proteus vulgaris and Porphyromonas gingivalis. The optimum conditions for the enzyme were at pH 9.0 and 45 °C. Recombinant VcTrpase exhibited analogous kinetic reactivity to the EcTrpase with Km and kcat values of 0.612×10−3 M and 5.252 s−1, respectively. The enzyme catalyzed S-methyl-Lcysteine and S-benzyl-L-cysteine degradation, but not L-phenylalanine and L-serine. Using a site-directed mutagenesis technique, eight residues (Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, Lys270, and His463) were conserved for maintaining enzyme catalysis. All amino acid substitutions at these sites either eliminated or remarkably diminished Trpase activity. These sites are thus potential targets for the design of drugs to control the V. cholerae Trpase and to further investigate its functions. Keywords Tryptophanase . Vibrio cholerae . Indole . Biofilm
Introduction Tryptophanase (Trpase, tryptophan indole-lyase, EC 4.1.99.1) is found in prokaryotes and is responsible for the production of indole, pyruvate, and ammonium through an α,β-elimination reaction with L-tryptophan as its natural substrate [1]. Pyridoxal phosphate (PLP) and N. Tansila (*) : P. Chomchuen : P. Phattaranit : S. Eangchuan Faculty of Medical Technology, Prince of Songkla University, 15 Karnjanavanich Rd., Hat Yai, Songkhla 90110, Thailand e-mail: [email protected] T. Nuidate : V. Vuddhakul Department of Microbiology, Faculty of Science, Prince of Songkla University, SongkhlaHat Yai, Thailand
244
Appl Biochem Biotechnol (2015) 175:243–252
potassium ions are required for full activity [1–3]. This enzyme has been of increasing interest in biotechnology owing to its reverse α,β-elimination and β-substitution reactions. Thus, it has been utilized as a biocatalyst in the synthesis of L-tryptophan and for the production of amino acid analogs [4–8]. Indole produced by Trpase has been demonstrated to be a potential messenger during growth, survival, and virulence among bacterial communities [9, 10]. Of more interest is that indole has been shown to regulate biofilm formation in many pathogenic bacteria such as Escherichia coli [11, 12], Pseudomonas aeruginosa [13], and Vibrio cholerae [14] for promotion of their survival in obdurate environments as well as for resistance to antibiotic treatment. In particular, the cholera-causing bacterium, V. cholerae, is a natural inhabitant of aquatic systems and produces a biofilm to protect itself from extreme conditions [15]. In addition, the biofilms can serve as biological shelters against acidic pH and administered antibiotics in vivo [15]. Suppression of biofilm formation not only reduces its pathogenicity but also prevents disease transmission. In this study, the tnaA gene of V. cholerae was cloned into E. coli BL21(DE3) tn5:tnaA and the Trpase enzyme obtained was purified and characterized.
Materials and Methods Bacteria, Plasmid, and Culture Conditions V. cholerae PSU966 serogroup O1 (Prince of Songkla University laboratory stock strain) was used as the DNA donor for the tnaA gene. The isolate was identified by biochemical tests and confirmed by PCR targeted to the ompW gene (Table 1) [16]. E. coli BL21(DE3) tn5:tnaA was used as the host cells for expression of a recombinant VcTrpase [17]. The plasmid pET-20b (+) containing a hexa-His tag (Novagen, Germany) was used for cloning and expression of the gene. V. cholerae PSU966 was cultured in Luria-Bertani (LB) broth or agar supplemented with 1 % NaCl at 37 °C. E. coli BL21(DE3) tn5:tnaA host cells were grown at 37 °C in LB broth or agar supplemented with kanamycin (50 μg/mL). Host cells carrying a recombinant plasmid were cultured with additional supplementation of 100 μg/mL ampicillin. Cloning of the tnaA Gene from V. cholerae into the pET-20b(+) Vector and Site-Directed Mutagenesis V. cholerae PSU966 was cultured overnight, then cells were harvested by centrifugation at 12,000×g for 5 min, and the DNA was extracted using the alkaline lysis method [18]. The tnaA gene of V. cholerae was amplified by the tnaA-VC_F and tnaA-VC_R primers (Table 1). Amplification conditions consisted of 35 cycles, denaturation (95 °C for 45 s), annealing (53 °C for 30 s), and extension (72 °C for 2 min). The PCR product was digested with NdeI and SalI enzymes. After purification with the QIAquick Gel Extraction Kit (Qiagen, Germany), the DNA was ligated to the pET-20b(+) vector. The recombinant plasmid pET20b(+)-VcTrpase was then introduced into the E. coli BL21(DE3) tn5:tnaA host cells by CaCl2-mediated DNA transformation. The transformants were screened for indole production, and the presence of the recombinant plasmid was confirmed by PCR and DNA sequencing. For the site-directed mutagenesis experiment, mutagenic primers (Table 1) containing amino acid substitutions of specific residues were employed to amplify the tnaA gene. Then, the template plasmid was digested by DpnI restriction endonuclease and the mutated DNA was
Appl Biochem Biotechnol (2015) 175:243–252
245
Table 1 Primers used in this study Target
Amino acid Primers substitutiona
Sequence (5′→3′)b, c
Reference
ompW gene None
ompW-F ompW-R
CACCAAGAAGGTGACTTTATTGTG GAACTTATAACCACCCGCG
[16]
tnaA gene
None
tnaA-VC_F tnaAVC_R
TACATATGGAAAATTTTAAACA CTTACC AGAACC TTGTCGACGGCTTTTTCTTT TAAGCG
This study
Thr52Ala
T52A_F T52A_R
TTATTGACCTGCTCGCCGACAGCGGCA CTGGC GCCAGTGCCGCTGT CGGCGAGCAGGTCAATAA
This study
Tyr74Ala
Y74A_F Y74A_R
CGTGGTGATGAAGCCGCCAGCGGCAG CC GCAGC GCTGCGGCTGCCGC TGGCGGCTTCATCACCACG
This study
Arg103Ala
R103A_F R103A_R CCGACCCACCAAGGTGCGGGTGCAGA GCAGATT AATCTGCTCTGCAC CCGCACCTTGGTGGGTCGG
This study
Asp137Ala
D137A_F D137A_R CTAACTACTTTTTCGCCACCACTCAAG GCC GGCCTTGAGTGGTGGCGAAAAA GTAGTTAG
This study
Arg230Ala
R230A_F R230A_R CATGGACTCTGCTGCGTTTGCTGAAAAT GCG CGCATTTTCAGCAAACGCAGCA GAGTCCATG
This study
Lys269Ala
K269A_F K269A_R CTCGCGATGTCGGCCGCCAAAGATGCCA This study TGGTG CACCATGGCATCTT TGGCGGCC GACATCGCGAG
Lys270Ala
K270A_F K270A_R GCGATGTCGGCCAAAGCCGATGCCATGG This study TGC GCACCATGGCATCGGCTTTGGC CGACATCGC
His463Ala
H463A_F H463A_R CCACCCGTGCTACGCGCCTTTACGGCTC GCTTA TAAGCGAGCCGTAA AGGCGCGTAGCACGGGTGG
a
This study
Numbering of amino acid position is based on the primary sequence of VcTrpase
b
Restriction sites of NdeI and SalI enzymes in the forward and reverse primers, respectively, are underlined
c
Mutagenized codons are shown in bold
transformed into host cells as described above. The presence of the correct codon substitution in the tnaA gene was confirmed by DNA sequencing. Purification of VcTrpase Enzyme A single colony of either the wild type or tnaA mutant was inoculated into LB broth supplemented with kanamycin (50 μg/mL) and ampicillin (100 μg/mL) and was incubated at 37 °C to reach an OD600 nm 0.6–0.8. VcTrpase expression was induced by adding isopropyl-β-D-thiogalactopyranoside (IPTG) to the culture at a final concentration of 1 mM and was incubated at 30 °C for 16–18 h. Cells were collected by centrifugation and washed twice with 0.1 M potassium phosphate buffer, pH 7.8, containing 5 mM mercaptoethanol, and 50 μM PLP, and were then suspended in the same buffer. After that, the cells were lysed by
246
Appl Biochem Biotechnol (2015) 175:243–252
ultrasonic disintegration. A crude extract was collected after centrifugation at 20,000×g and 4 °C and loaded onto a column of Ni2+-nitrilotriacetic acid (NTA) agarose (Qiagen, Germany); then, recombinant VcTrpase was eluted by a gradient imidazole (20–400 mM) in the same buffer and was dialyzed overnight at room temperature against 0.1 M potassium phosphate buffer, pH 7.8, containing 5 mM mercaptoethanol, and 50 μM PLP. The protein concentration was determined by the Bradford dye-binding assay [19], purified VcTrpase was quantified using a spectrophotometer with absorbance at 278 nm, and the concentration was calculated via A11 % cm ¼ 9:19 [20]. The purity and molecular size of the VcTrpase were assessed using electrophoresis on a 10 % sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE). The purified protein was stored at 4 °C until further analysis. Characterization of the VcTrpase The UV-Vis spectra of the VcTrpase (10 μM or μg in 0.1 M potassium phosphate buffer, pH 7.8, containing 5 mM mercaptoethanol, and 50 μM PLP) were recorded at room temperature on a Shimadzu UV-1800 (Shimadzu, Japan). The buffer was set as a baseline. Trpase activity was determined using a coupled assay with lactate dehydrogenase (LDH) by monitoring a decrease in NADH absorbance at 340 nm (ε=6220 M−1 cm−1) [21]. In brief, 10– 50 μg of VcTrpase in 0.1 M potassium phosphate buffer, pH 7.8, with 5 mM mercaptoethanol and 50 μM PLP was mixed with an appropriate concentration of L-tryptophan and was then incubated at an optimum temperature for 1–10 min, depending on the substrate tested. The reaction was stopped by boiling at 95 °C for 5 min prior to adding 1 mM NADH and 5 U LDH. A unit of enzyme activity was defined as the amount of enzyme which produces 1 μmol of product per 1 min. To investigate the kinetic activity, five kinds of substrate including Ltryptophan, L-phenylalanine, L-serine, S-benzyl-L-cysteine, and S-methyl-L-cysteine were investigated at various concentrations to obtain the reaction rate that fitted the hyperbolic curve of the Michaelis-Menten equation, and a Lineweaver-Burk plot was obtained for calculating the Km, kcat, and kcat/Km values toward each substrate. Triplicate measurements were performed for each substrate concentration. Influence of the pH and Temperature on the VcTrpase Activity and Its Stability To investigate the optimum temperature and pH of the VcTrpase activity, the enzyme was incubated with L-tryptophan substrate at various temperatures that ranged from 25 to 80 °C or in buffers over a pH range of 5.6–10.0 for 10 min. The catalytic activity was then measured as described above. In addition, the stability of the enzyme against extreme temperature or pH was assessed after continuous incubation of the enzyme for 10 min or overnight, respectively.
Results and Discussion V. cholerae tnaA Gene Sequence and VcTrpase The tnaA gene of V. cholerae PSU966 was amplified, and the PCR product ligated into the pET20b(+) vector and cloned into E. coli BL21(DE3) tn5:tnaA. An ∼1.419-bp PCR product of the V. cholerae tnaA gene obtained from a transformant was sequenced, and the 472 amino acids of VcTrpase obtained were subjected to multiple sequence alignments with various Trpase amino acid sequences of other bacteria (Fig. 1). The amino acid sequence of Trpase from V. cholerae shared 84 and 85 % identity to those of Haemophilus influenzae (HiTrpase)
Appl Biochem Biotechnol (2015) 175:243–252
247
Fig. 1 Comparison of amino acid content of Trpases from various bacteria: Vc = V. cholerae, Ec = E. coli, Pv = P. vulgaris, Hi = H. influenzae, Pg = P. gingivalis. Arrows indicate selected conserved amino acid positions essential for Trpase reactivity: Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, Lys270, and His463. Boxes indicate conserved regions containing greater than or equal to four consecutive amino acids among these Trpases
and E. coli (EcTrpase), respectively; however, only approximately 50 % sequence identity was observed with the Trpase amino acids of Proteus vulgaris (PvTrpase) and Porphyromonas gingivalis (PgTrpase) [22–25]. It was of interest that there were ten conserved regions of the Trpase enzymes each containing greater than or equal to four consecutive amino acids that were identified in these bacteria (Fig. 1, rectangle boxes). With regard to the 3D structures of EcTrpase (PDB entry 2c44), all of these conserved regions were located around the enzyme
248
Appl Biochem Biotechnol (2015) 175:243–252
active site (data not shown), which was formed between two homologous subunits known as the catalytic dimer, and were most likely responsible for building up a chemically and structurally optimal pocket for enzyme catalysis [26]. More importantly, eight catalytically important residues (Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, Lys270, and His463) close to the Trpase active site (Fig. 1, marked by arrows) were absolutely invariant in all the Trpases. Five of them were located in the conserved regions and have been reported to confer a crucial role for binding of the substrate and cofactor to produce the formation of the best intermediate that will lead to substrate degradation [26, 27]. Hence, despite the apparent diversity in the protein sequences, these regions may be essential for enzyme activity to generate indole, which is an important agent for bacterial physiology, ecological balance, and virulence [10, 14]. For characterization of the VcTrpase, recombinant VcTrpase was purified by Ni2+-NTA chromatography. The molecular mass of the recombinant VcTrpase was analyzed by SDSPAGE, and a single protein band of ∼49 kDa was detected (Fig. 2). In this study, the protein purity was greater than 95 %, and the yield was 38.8 mg enzyme/1 L of culture. Using the spectrophotometer, two absorption peaks at 330 and 435 nm were detected in the spectrum of the wild-type VcTrpase at pH 7.0 which corresponded to the enolimine and ketoenamine Fig. 2 An SDS-PAGE gel of VcTrpase after protein purification
kDa 250 150 100 75 50 37 25
15
Appl Biochem Biotechnol (2015) 175:243–252
249
tautomeric forms, respectively (Fig. 3). These peaks were also found in the Trpase from E. coli and P. vulgaris [20, 28, 29]. In fact, the spectrum of all the VcTrpase mutants was similar to that of the wild-type enzyme (data not shown). VcTrpase Activity The decrease in NADH absorbance at 340 nm (ε=6220 M−1 cm−1) in the presence of LDH was used to determine Trpase activity after adding L-tryptophan [21]. The activity of Trpase was calculated based on Beer’s law using the double reciprocal curves between substrate concentration and reaction rate. One unit of enzyme represents the amount of enzyme that will catalyze 1 μmol of product per 1 min. In this study, the purified VcTrpase possessed a specific activity of 3.0 U/mg protein. Unlike the Trpase from E. coli, it was not inactivated at 4 °C during storage. This indicated that VcTrpase did not dissociate into inactive dimers or monomers at 4 °C [30, 31]. The eight conserved residues (Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, Lys270, and His463) of VcTrpase were mutagenized to code for alanine in order to determine their influence in catalytic function. SDS-PAGE confirmation revealed that all mutant enzymes were expressed and soluble (data not shown). The enzyme activity of the VcTrpase with a His463-Ala substitution was reduced to 0.126 U/mg protein (∼4 % of the wild-type VcTrpase). This correlates to the studies that had shown that a His463-Phe substitution in EcTrpase and a His458-Ala substitution in PvTrpase also significantly decreased enzyme activity [17, 32, 33]. Thus, the His463 residue made a small contribution to the Trpase activity. However, the other seven VcTrpase mutants exhibited no enzyme activity. Three of them might be involved in the interaction between the enzyme and the PLP cofactor. It has been revealed that the lysine residue at position 270 or 266 of EcTrpase or PvTrpase, respectively, provided covalent links to the PLP cofactor. Hence, replacement of the Lys270 by Ala possibly eliminates this cofactor-protein interaction in VcTrpase. In addition, it has been demonstrated that Arg103 plays an important role in orientation of the PLP [26, 27]. The
1.0
Absorbance
.8
.6
.4
.2
0.0 300
350
400
450
Wavelength (nm) Fig. 3 Adsorption spectra of VcTrpase
500
550
250
Appl Biochem Biotechnol (2015) 175:243–252
rest of the four mutants, at positions Thr52, Tyr74, Asp137, and Arg230, showed no enzyme activity which correlated to previous studies which had demonstrated that Trpase mutants carrying substitutions at positions equivalent to those residues were unable to catalyze any reaction toward a natural substrate [17, 32, 34]. Kinetic Parameters and Substrate Specificity Kinetic studies of VcTrpase were conducted using varied concentrations of L-tryptophan, Lphenylalanine, L-serine, S-benzyl-L-cysteine, and S-methyl-L-cysteine substrates. Using Ltryptophan as a substrate, the Km and kcat values of VcTrpase were 0.612×10−3 M and 5.252 s−1, respectively (Table 2), which were comparable to those of the enzymes from E. coli and P. vulgaris [20, 29]. However, the affinity of VcTrpase to S-benzyl-L-cysteine was 30.145×10−3 M which was ∼150 times higher than that to S-methyl-L-cysteine (0.210× 10−3 M). A similar pattern has been reported for EcTrpase and PvTrpase [29, 35, 36]. In this work, we detected no catalytic activity of VcTrpase toward L-phenylalanine and L-serine. This may be due to a preferential interaction between the enzyme active site and a polar aromatic substrate such as L-tryptophan and S-benzyl-L-cysteine. Previous studies have shown that the substrate affinity of Trpase from many bacteria to these compounds was at the micromolar level [20, 25, 29, 35–38], and indicated that the binding of the enzyme to polar aromatic substrates facilitated catalytic activity [38]. Finally, the kcat and kcat/Km values of VcTrpase to L-tryptophan substrate were much higher than those for S-benzyl-L-cysteine and S-methyl-Lcysteine which confirmed the efficiency of this enzyme (Table 2). Influence of pH and Temperature on Activity and Stability of Trpase L-Tryptophan in potassium phosphate buffer was used to evaluate the effects of pH and temperature on the catalytic activity of VcTrpase [2, 26, 27]. The activity of enzyme was highest at 45 °C and gradually reduced when the temperature was increased to 70 °C where the activity was almost undetectable (Fig. 4a). In a thermal stability study, ∼60 % of the total activity remained at 45 °C and no enzyme activity was observed after 10-min treatment at 60 °C (Fig. 4c). The optimum pH of the VcTrpase activity was pH 9.0 (Fig. 4b), and it remained stable between pH levels 6.5 and 8.0 with residual activity ≥∼80 % (Fig. 4d).
Conclusion and Future Perspective The Trpase enzyme from V. cholerae O1 was successfully expressed, purified, and characterized. Although VcTrpase had a high homology (>80 % identity) to EcTrpase, some differences in biochemical and enzymatic properties were observed. VcTrpase had a lower stability toward Table 2 Steady state kinetic parameters of VcTrpase Substrate
Km (M)
L-Tryptophan
0.612×10−3
S-Methyl-L-cysteine S-Benzyl-L-cysteine
−3
30.15×10
−3
0.210×10
kcat (s−1)
kcat/Km (M−1 s−1)
5.252
8.582×103
0.490
0.016×103
0.346
1.648×103
Values represent a mean value of three experiments. No activity with L-phenylalanine and L-serine was observed
Appl Biochem Biotechnol (2015) 175:243–252
A
100
Relative activity (%)
Relative activity (%)
100
251
80
60
40
60
40
0
0 30
40
50
60
Temperature (oC)
70
80
6
7
8
9
10
pH
C
100
Relative activity (%)
Relative activity (%)
80
20
20
100
B
80
60
40
D
80
60
40
20
20
0 30
40
50
60
Temperature (oC)
70
80
0 6
7
pH
8
9
10
Fig. 4 Optimum temperature (a) and pH (b) for VcTrpase activity and the effect of temperature (c) and pH (d) on VcTrpase activity
treatment with heat and extreme pH. Mutagenesis studies confirmed the conserved residues (Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, and Lys270) required for the catalytic function of the enzyme. These conserved residues could be targets for developing antimicrobial agents based on Trpase competitive inhibitors [39]. The catalytic performance of VcTrpase was slightly lower than that of two other well-known Trpases from E. coli and P. vulgaris. More importantly, VcTrpase clearly exhibited a preference for interactions with polar aromatic substrates such as L-tryptophan and S-benzyl-L-cysteine. Further studies will be required to evaluate the molecular mechanism involved in the regulation of Trpase expression as well as its effects on the growth and virulence of V. cholerae in human and aquatic environments. In addition, engineering of a more efficient enzyme for metabolizing L-tryptophan and other amino acid analogs may be needed. Acknowledgments This work was financially supported by the general research fund from the Prince of Songkla University (contract no. MET530228S). T.N. was grateful for graduate research scholarships, Faculty of Science, Prince of Songkla University (PSU Ph.D. scholarship number 0994/2555 and research assistant grant number 1-2553-02-008). Authors were thankful to Prof. Dr. Robert S. Philips for his kindness in providing indole-negative host cells, E. coli strain BL21(DE3) tn5:tnaA. Thanks also to Dr. Brian Hodgson for his assistance with the English.
References 1. Snell, E. E. (1975) Advances in enzymology and related areas of molecular biology. Wiley, pp. 287–333. 2. Happold, F. C., & Struyvenberg, A. (1954). Biochemical Journal, 58, 379–382. 3. Honda, T., & Tokushige, M. (1986). Journal of Biochemistry, 100, 679–685.
252
Appl Biochem Biotechnol (2015) 175:243–252
4. Hara, R., & Kino, K. (2013). AMB Express, 3, 70. 5. Du, J., Duan, J. J., Zhang, Q., Hou, J., Bai, F., Chen, N., & Bai, G. (2012). Prikladnaia Biokhimiia i Mikrobiologiia, 48, 183–190. 6. Shimada, A., Ozaki, H., Saito, T., & Fujii, N. (2011). Journal of Chromatography B, 879, 3289–3295. 7. Shimada, A., Ozaki, H., Saito, T., & Noriko, F. (2009). International Journal of Molecular Sciences, 10, 2578–2590. 8. Zhao, Z.-J., Zou, C., Zhu, Y.-X., Dai, J., Chen, S., Wu, D., Wu, J., & Chen, J. (2011). Journal of Industrial Microbiology & Biotechnology, 38, 1921–1929. 9. Lee, J., Jayaraman, A., & Wood, T. (2007). BMC Microbiology, 7, 42. 10. Lee, J.-H., & Lee, J. (2010). FEMS Microbiology Reviews, 34, 426–444. 11. Wang, D., Ding, X., & Rather, P. N. (2001). Journal of Bacteriology, 183, 4210–4216. 12. Di Martino, P., Fursy, R., Bret, L., Sundararaju, B., & Phillips, R. S. (2003). Canadian Journal of Microbiology, 49, 443–449. 13. Lee, J., Attila, C., Cirillo, S. L., Cirillo, J. D., & Wood, T. K. (2009). Microbial Biotechnology, 2, 75–90. 14. Mueller, R. S., Beyhan, S., Saini, S. G., Yildiz, F. H., & Bartlett, D. H. (2009). Journal of Bacteriology, 191, 3504–3516. 15. Huq, A., Whitehouse, C. A., Grim, C. J., Alam, M., & Colwell, R. R. (2008). Current Opinion in Biotechnology, 19, 244–247. 16. Nandi, B., Nandy, R. K., Mukhopadhyay, S., Nair, G. B., Shimada, T., & Ghose, A. C. (2000). Journal of Clinical Microbiology, 38, 4145–4151. 17. Phillips, R. S., Johnson, N., & Kamath, A. V. (2002). Biochemistry, 41, 4012–4019. 18. Sambrook, J., & Russell, D. W. (2001). Molecular cloning: a laboratory manual (4th ed.). Cold Spring Harbor: Cold Spring Harbor Laboratory Press. 19. Bradford, M. M. (1976). Analytical Biochemistry, 72, 248–254. 20. Phillips, R. S., & Gollnick, P. D. (1989). Journal of Biological Chemistry, 264, 10627–10632. 21. Morino, Y., & Snell, E. E. (1970). Methods in Enzymology, 17, 439–446. 22. Martin, K., Morlin, G., Smith, A., Nordyke, A., Eisenstark, A., & Golomb, M. (1998). Journal of Bacteriology, 180, 107–118. 23. Deeley, M. C., & Yanofsky, C. (1981). Journal of Bacteriology, 147, 787–796. 24. Kamath, A. V., & Yanofsky, C. (1992). Journal of Biological Chemistry, 267, 19978–19985. 25. Yoshida, Y., Sasaki, T., Ito, S., Tamura, H., Kunimatsu, K., & Kato, H. (2009). Microbiology, 155, 968–978. 26. Ku, S. Y., Yip, P., & Howell, P. L. (2006). Acta Crystallographica Section D: Biological Crystallography, 62, 814–823. 27. Isupov, M. N., Antson, A. A., Dodson, E. J., Dodson, G. G., Dementieva, I. S., Zakomirdina, L. N., Wilson, K. S., Dauter, Z., Lebedev, A. A., & Harutyunyan, E. H. (1998). Journal of Molecular Biology, 276, 603–623. 28. June, D. S., Suelter, C. H., & Dye, J. L. (1981). Biochemistry, 20, 2714–2719. 29. Zakomirdina, L. N., Kulikova, V. V., Gogoleva, O. I., Dementieva, I. S., Faleev, N. G., & Demidkina, T. V. (2002). Biochemistry (Moscow), 67, 1189–1196. 30. Erez, T., Gdalevsky, G. Y., Torchinsky, Y. M., Phillips, R. S., & Parola, A. H. (1998). Biochimica et Biophysica Acta, Protein Structure and Molecular Enzymology, 1384, 365–372. 31. Kogan, A., Gdalevsky, G., Cohen-Luria, R., Goldgur, Y., Phillips, R. S., Parola, A., & Almog, O. (2009). BMC Structural Biology, 9, 65. 32. Demidkina, T. V., Zakomirdina, L. N., Kulikova, V. V., Dementieva, I. S., Faleev, N. G., Ronda, L., Mozzarelli, A., Gollnick, P. D., & Phillips, R. S. (2003). Biochemistry, 42, 11161–11169. 33. Phillips, R. S., Kalu, U., & Hay, S. (2012). Biochemistry, 51, 6527–6533. 34. Kulikova, V. V., Zakomirdina, L. N., Bazhulina, N. P., Dementieva, I. S., Faleev, N. G., Gollnick, P. D., & Demidkina, T. V. (2003). Biochemistry (Mosc), 68, 1181–1188. 35. Kiick, D. M., & Phillips, R. S. (1988). Biochemistry, 27, 7339–7344. 36. Phillips, R. S., Richter, I., Gollnick, P., Brzovic, P., & Dunn, M. F. (1991). Journal of Biological Chemistry, 266, 18642–18648. 37. Sasaki-Imamura, T., Yano, A., & Yoshida, Y. (2010). Applied and Environmental Microbiology, 76, 4260–4268. 38. Phillips, R. S., Ghaffari, R., Dinh, P., Lima, S., & Bartlett, D. (2011). Archives of Biochemistry and Biophysics, 506, 35–41. 39. Scherzer, R., Gdalevsky, G. Y., Goldgur, Y., Cohen-Luria, R., Bittner, S., & Parola, A. H. (2009). Journal of Enzyme Inhibition and Medicinal Chemistry, 24, 350–355.
Characterization of Tryptophanase from Vibrio cholerae Taiyeebah Nuidate & Natta Tansila & Piraporn Chomchuen & Phattiphong Phattaranit & Supachok Eangchuan & Varaporn Vuddhakul
Received: 19 April 2014 / Accepted: 15 September 2014 / Published online: 25 September 2014 # Springer Science+Business Media New York 2014
Abstract Tryptophanase (Trpase) is a pyridoxal phosphate (PLP)-dependent enzyme responsible for the production of indole, an important intra- and interspecies signaling molecule in bacteria. In this study, the tnaA gene of Vibrio cholerae coding for VcTrpase was cloned into the pET-20b(+) vector and expressed in Escherichia coli BL21(DE3) tn5:tnaA. Using Ni2+nitrilotriacetic acid (NTA) chromatography, VcTrpase was purified, and it possessed a molecular mass of ∼49 kDa with specific absorption peaks at 330 and 435 nm and a specific activity of 3 U/mg protein. The VcTrpase had an 80 % homology to the Trpase of Haemophilus influenzae and E. coli, but only around 50 % identity to the Trpase of Proteus vulgaris and Porphyromonas gingivalis. The optimum conditions for the enzyme were at pH 9.0 and 45 °C. Recombinant VcTrpase exhibited analogous kinetic reactivity to the EcTrpase with Km and kcat values of 0.612×10−3 M and 5.252 s−1, respectively. The enzyme catalyzed S-methyl-Lcysteine and S-benzyl-L-cysteine degradation, but not L-phenylalanine and L-serine. Using a site-directed mutagenesis technique, eight residues (Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, Lys270, and His463) were conserved for maintaining enzyme catalysis. All amino acid substitutions at these sites either eliminated or remarkably diminished Trpase activity. These sites are thus potential targets for the design of drugs to control the V. cholerae Trpase and to further investigate its functions. Keywords Tryptophanase . Vibrio cholerae . Indole . Biofilm
Introduction Tryptophanase (Trpase, tryptophan indole-lyase, EC 4.1.99.1) is found in prokaryotes and is responsible for the production of indole, pyruvate, and ammonium through an α,β-elimination reaction with L-tryptophan as its natural substrate [1]. Pyridoxal phosphate (PLP) and N. Tansila (*) : P. Chomchuen : P. Phattaranit : S. Eangchuan Faculty of Medical Technology, Prince of Songkla University, 15 Karnjanavanich Rd., Hat Yai, Songkhla 90110, Thailand e-mail: [email protected] T. Nuidate : V. Vuddhakul Department of Microbiology, Faculty of Science, Prince of Songkla University, SongkhlaHat Yai, Thailand
244
Appl Biochem Biotechnol (2015) 175:243–252
potassium ions are required for full activity [1–3]. This enzyme has been of increasing interest in biotechnology owing to its reverse α,β-elimination and β-substitution reactions. Thus, it has been utilized as a biocatalyst in the synthesis of L-tryptophan and for the production of amino acid analogs [4–8]. Indole produced by Trpase has been demonstrated to be a potential messenger during growth, survival, and virulence among bacterial communities [9, 10]. Of more interest is that indole has been shown to regulate biofilm formation in many pathogenic bacteria such as Escherichia coli [11, 12], Pseudomonas aeruginosa [13], and Vibrio cholerae [14] for promotion of their survival in obdurate environments as well as for resistance to antibiotic treatment. In particular, the cholera-causing bacterium, V. cholerae, is a natural inhabitant of aquatic systems and produces a biofilm to protect itself from extreme conditions [15]. In addition, the biofilms can serve as biological shelters against acidic pH and administered antibiotics in vivo [15]. Suppression of biofilm formation not only reduces its pathogenicity but also prevents disease transmission. In this study, the tnaA gene of V. cholerae was cloned into E. coli BL21(DE3) tn5:tnaA and the Trpase enzyme obtained was purified and characterized.
Materials and Methods Bacteria, Plasmid, and Culture Conditions V. cholerae PSU966 serogroup O1 (Prince of Songkla University laboratory stock strain) was used as the DNA donor for the tnaA gene. The isolate was identified by biochemical tests and confirmed by PCR targeted to the ompW gene (Table 1) [16]. E. coli BL21(DE3) tn5:tnaA was used as the host cells for expression of a recombinant VcTrpase [17]. The plasmid pET-20b (+) containing a hexa-His tag (Novagen, Germany) was used for cloning and expression of the gene. V. cholerae PSU966 was cultured in Luria-Bertani (LB) broth or agar supplemented with 1 % NaCl at 37 °C. E. coli BL21(DE3) tn5:tnaA host cells were grown at 37 °C in LB broth or agar supplemented with kanamycin (50 μg/mL). Host cells carrying a recombinant plasmid were cultured with additional supplementation of 100 μg/mL ampicillin. Cloning of the tnaA Gene from V. cholerae into the pET-20b(+) Vector and Site-Directed Mutagenesis V. cholerae PSU966 was cultured overnight, then cells were harvested by centrifugation at 12,000×g for 5 min, and the DNA was extracted using the alkaline lysis method [18]. The tnaA gene of V. cholerae was amplified by the tnaA-VC_F and tnaA-VC_R primers (Table 1). Amplification conditions consisted of 35 cycles, denaturation (95 °C for 45 s), annealing (53 °C for 30 s), and extension (72 °C for 2 min). The PCR product was digested with NdeI and SalI enzymes. After purification with the QIAquick Gel Extraction Kit (Qiagen, Germany), the DNA was ligated to the pET-20b(+) vector. The recombinant plasmid pET20b(+)-VcTrpase was then introduced into the E. coli BL21(DE3) tn5:tnaA host cells by CaCl2-mediated DNA transformation. The transformants were screened for indole production, and the presence of the recombinant plasmid was confirmed by PCR and DNA sequencing. For the site-directed mutagenesis experiment, mutagenic primers (Table 1) containing amino acid substitutions of specific residues were employed to amplify the tnaA gene. Then, the template plasmid was digested by DpnI restriction endonuclease and the mutated DNA was
Appl Biochem Biotechnol (2015) 175:243–252
245
Table 1 Primers used in this study Target
Amino acid Primers substitutiona
Sequence (5′→3′)b, c
Reference
ompW gene None
ompW-F ompW-R
CACCAAGAAGGTGACTTTATTGTG GAACTTATAACCACCCGCG
[16]
tnaA gene
None
tnaA-VC_F tnaAVC_R
TACATATGGAAAATTTTAAACA CTTACC AGAACC TTGTCGACGGCTTTTTCTTT TAAGCG
This study
Thr52Ala
T52A_F T52A_R
TTATTGACCTGCTCGCCGACAGCGGCA CTGGC GCCAGTGCCGCTGT CGGCGAGCAGGTCAATAA
This study
Tyr74Ala
Y74A_F Y74A_R
CGTGGTGATGAAGCCGCCAGCGGCAG CC GCAGC GCTGCGGCTGCCGC TGGCGGCTTCATCACCACG
This study
Arg103Ala
R103A_F R103A_R CCGACCCACCAAGGTGCGGGTGCAGA GCAGATT AATCTGCTCTGCAC CCGCACCTTGGTGGGTCGG
This study
Asp137Ala
D137A_F D137A_R CTAACTACTTTTTCGCCACCACTCAAG GCC GGCCTTGAGTGGTGGCGAAAAA GTAGTTAG
This study
Arg230Ala
R230A_F R230A_R CATGGACTCTGCTGCGTTTGCTGAAAAT GCG CGCATTTTCAGCAAACGCAGCA GAGTCCATG
This study
Lys269Ala
K269A_F K269A_R CTCGCGATGTCGGCCGCCAAAGATGCCA This study TGGTG CACCATGGCATCTT TGGCGGCC GACATCGCGAG
Lys270Ala
K270A_F K270A_R GCGATGTCGGCCAAAGCCGATGCCATGG This study TGC GCACCATGGCATCGGCTTTGGC CGACATCGC
His463Ala
H463A_F H463A_R CCACCCGTGCTACGCGCCTTTACGGCTC GCTTA TAAGCGAGCCGTAA AGGCGCGTAGCACGGGTGG
a
This study
Numbering of amino acid position is based on the primary sequence of VcTrpase
b
Restriction sites of NdeI and SalI enzymes in the forward and reverse primers, respectively, are underlined
c
Mutagenized codons are shown in bold
transformed into host cells as described above. The presence of the correct codon substitution in the tnaA gene was confirmed by DNA sequencing. Purification of VcTrpase Enzyme A single colony of either the wild type or tnaA mutant was inoculated into LB broth supplemented with kanamycin (50 μg/mL) and ampicillin (100 μg/mL) and was incubated at 37 °C to reach an OD600 nm 0.6–0.8. VcTrpase expression was induced by adding isopropyl-β-D-thiogalactopyranoside (IPTG) to the culture at a final concentration of 1 mM and was incubated at 30 °C for 16–18 h. Cells were collected by centrifugation and washed twice with 0.1 M potassium phosphate buffer, pH 7.8, containing 5 mM mercaptoethanol, and 50 μM PLP, and were then suspended in the same buffer. After that, the cells were lysed by
246
Appl Biochem Biotechnol (2015) 175:243–252
ultrasonic disintegration. A crude extract was collected after centrifugation at 20,000×g and 4 °C and loaded onto a column of Ni2+-nitrilotriacetic acid (NTA) agarose (Qiagen, Germany); then, recombinant VcTrpase was eluted by a gradient imidazole (20–400 mM) in the same buffer and was dialyzed overnight at room temperature against 0.1 M potassium phosphate buffer, pH 7.8, containing 5 mM mercaptoethanol, and 50 μM PLP. The protein concentration was determined by the Bradford dye-binding assay [19], purified VcTrpase was quantified using a spectrophotometer with absorbance at 278 nm, and the concentration was calculated via A11 % cm ¼ 9:19 [20]. The purity and molecular size of the VcTrpase were assessed using electrophoresis on a 10 % sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE). The purified protein was stored at 4 °C until further analysis. Characterization of the VcTrpase The UV-Vis spectra of the VcTrpase (10 μM or μg in 0.1 M potassium phosphate buffer, pH 7.8, containing 5 mM mercaptoethanol, and 50 μM PLP) were recorded at room temperature on a Shimadzu UV-1800 (Shimadzu, Japan). The buffer was set as a baseline. Trpase activity was determined using a coupled assay with lactate dehydrogenase (LDH) by monitoring a decrease in NADH absorbance at 340 nm (ε=6220 M−1 cm−1) [21]. In brief, 10– 50 μg of VcTrpase in 0.1 M potassium phosphate buffer, pH 7.8, with 5 mM mercaptoethanol and 50 μM PLP was mixed with an appropriate concentration of L-tryptophan and was then incubated at an optimum temperature for 1–10 min, depending on the substrate tested. The reaction was stopped by boiling at 95 °C for 5 min prior to adding 1 mM NADH and 5 U LDH. A unit of enzyme activity was defined as the amount of enzyme which produces 1 μmol of product per 1 min. To investigate the kinetic activity, five kinds of substrate including Ltryptophan, L-phenylalanine, L-serine, S-benzyl-L-cysteine, and S-methyl-L-cysteine were investigated at various concentrations to obtain the reaction rate that fitted the hyperbolic curve of the Michaelis-Menten equation, and a Lineweaver-Burk plot was obtained for calculating the Km, kcat, and kcat/Km values toward each substrate. Triplicate measurements were performed for each substrate concentration. Influence of the pH and Temperature on the VcTrpase Activity and Its Stability To investigate the optimum temperature and pH of the VcTrpase activity, the enzyme was incubated with L-tryptophan substrate at various temperatures that ranged from 25 to 80 °C or in buffers over a pH range of 5.6–10.0 for 10 min. The catalytic activity was then measured as described above. In addition, the stability of the enzyme against extreme temperature or pH was assessed after continuous incubation of the enzyme for 10 min or overnight, respectively.
Results and Discussion V. cholerae tnaA Gene Sequence and VcTrpase The tnaA gene of V. cholerae PSU966 was amplified, and the PCR product ligated into the pET20b(+) vector and cloned into E. coli BL21(DE3) tn5:tnaA. An ∼1.419-bp PCR product of the V. cholerae tnaA gene obtained from a transformant was sequenced, and the 472 amino acids of VcTrpase obtained were subjected to multiple sequence alignments with various Trpase amino acid sequences of other bacteria (Fig. 1). The amino acid sequence of Trpase from V. cholerae shared 84 and 85 % identity to those of Haemophilus influenzae (HiTrpase)
Appl Biochem Biotechnol (2015) 175:243–252
247
Fig. 1 Comparison of amino acid content of Trpases from various bacteria: Vc = V. cholerae, Ec = E. coli, Pv = P. vulgaris, Hi = H. influenzae, Pg = P. gingivalis. Arrows indicate selected conserved amino acid positions essential for Trpase reactivity: Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, Lys270, and His463. Boxes indicate conserved regions containing greater than or equal to four consecutive amino acids among these Trpases
and E. coli (EcTrpase), respectively; however, only approximately 50 % sequence identity was observed with the Trpase amino acids of Proteus vulgaris (PvTrpase) and Porphyromonas gingivalis (PgTrpase) [22–25]. It was of interest that there were ten conserved regions of the Trpase enzymes each containing greater than or equal to four consecutive amino acids that were identified in these bacteria (Fig. 1, rectangle boxes). With regard to the 3D structures of EcTrpase (PDB entry 2c44), all of these conserved regions were located around the enzyme
248
Appl Biochem Biotechnol (2015) 175:243–252
active site (data not shown), which was formed between two homologous subunits known as the catalytic dimer, and were most likely responsible for building up a chemically and structurally optimal pocket for enzyme catalysis [26]. More importantly, eight catalytically important residues (Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, Lys270, and His463) close to the Trpase active site (Fig. 1, marked by arrows) were absolutely invariant in all the Trpases. Five of them were located in the conserved regions and have been reported to confer a crucial role for binding of the substrate and cofactor to produce the formation of the best intermediate that will lead to substrate degradation [26, 27]. Hence, despite the apparent diversity in the protein sequences, these regions may be essential for enzyme activity to generate indole, which is an important agent for bacterial physiology, ecological balance, and virulence [10, 14]. For characterization of the VcTrpase, recombinant VcTrpase was purified by Ni2+-NTA chromatography. The molecular mass of the recombinant VcTrpase was analyzed by SDSPAGE, and a single protein band of ∼49 kDa was detected (Fig. 2). In this study, the protein purity was greater than 95 %, and the yield was 38.8 mg enzyme/1 L of culture. Using the spectrophotometer, two absorption peaks at 330 and 435 nm were detected in the spectrum of the wild-type VcTrpase at pH 7.0 which corresponded to the enolimine and ketoenamine Fig. 2 An SDS-PAGE gel of VcTrpase after protein purification
kDa 250 150 100 75 50 37 25
15
Appl Biochem Biotechnol (2015) 175:243–252
249
tautomeric forms, respectively (Fig. 3). These peaks were also found in the Trpase from E. coli and P. vulgaris [20, 28, 29]. In fact, the spectrum of all the VcTrpase mutants was similar to that of the wild-type enzyme (data not shown). VcTrpase Activity The decrease in NADH absorbance at 340 nm (ε=6220 M−1 cm−1) in the presence of LDH was used to determine Trpase activity after adding L-tryptophan [21]. The activity of Trpase was calculated based on Beer’s law using the double reciprocal curves between substrate concentration and reaction rate. One unit of enzyme represents the amount of enzyme that will catalyze 1 μmol of product per 1 min. In this study, the purified VcTrpase possessed a specific activity of 3.0 U/mg protein. Unlike the Trpase from E. coli, it was not inactivated at 4 °C during storage. This indicated that VcTrpase did not dissociate into inactive dimers or monomers at 4 °C [30, 31]. The eight conserved residues (Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, Lys270, and His463) of VcTrpase were mutagenized to code for alanine in order to determine their influence in catalytic function. SDS-PAGE confirmation revealed that all mutant enzymes were expressed and soluble (data not shown). The enzyme activity of the VcTrpase with a His463-Ala substitution was reduced to 0.126 U/mg protein (∼4 % of the wild-type VcTrpase). This correlates to the studies that had shown that a His463-Phe substitution in EcTrpase and a His458-Ala substitution in PvTrpase also significantly decreased enzyme activity [17, 32, 33]. Thus, the His463 residue made a small contribution to the Trpase activity. However, the other seven VcTrpase mutants exhibited no enzyme activity. Three of them might be involved in the interaction between the enzyme and the PLP cofactor. It has been revealed that the lysine residue at position 270 or 266 of EcTrpase or PvTrpase, respectively, provided covalent links to the PLP cofactor. Hence, replacement of the Lys270 by Ala possibly eliminates this cofactor-protein interaction in VcTrpase. In addition, it has been demonstrated that Arg103 plays an important role in orientation of the PLP [26, 27]. The
1.0
Absorbance
.8
.6
.4
.2
0.0 300
350
400
450
Wavelength (nm) Fig. 3 Adsorption spectra of VcTrpase
500
550
250
Appl Biochem Biotechnol (2015) 175:243–252
rest of the four mutants, at positions Thr52, Tyr74, Asp137, and Arg230, showed no enzyme activity which correlated to previous studies which had demonstrated that Trpase mutants carrying substitutions at positions equivalent to those residues were unable to catalyze any reaction toward a natural substrate [17, 32, 34]. Kinetic Parameters and Substrate Specificity Kinetic studies of VcTrpase were conducted using varied concentrations of L-tryptophan, Lphenylalanine, L-serine, S-benzyl-L-cysteine, and S-methyl-L-cysteine substrates. Using Ltryptophan as a substrate, the Km and kcat values of VcTrpase were 0.612×10−3 M and 5.252 s−1, respectively (Table 2), which were comparable to those of the enzymes from E. coli and P. vulgaris [20, 29]. However, the affinity of VcTrpase to S-benzyl-L-cysteine was 30.145×10−3 M which was ∼150 times higher than that to S-methyl-L-cysteine (0.210× 10−3 M). A similar pattern has been reported for EcTrpase and PvTrpase [29, 35, 36]. In this work, we detected no catalytic activity of VcTrpase toward L-phenylalanine and L-serine. This may be due to a preferential interaction between the enzyme active site and a polar aromatic substrate such as L-tryptophan and S-benzyl-L-cysteine. Previous studies have shown that the substrate affinity of Trpase from many bacteria to these compounds was at the micromolar level [20, 25, 29, 35–38], and indicated that the binding of the enzyme to polar aromatic substrates facilitated catalytic activity [38]. Finally, the kcat and kcat/Km values of VcTrpase to L-tryptophan substrate were much higher than those for S-benzyl-L-cysteine and S-methyl-Lcysteine which confirmed the efficiency of this enzyme (Table 2). Influence of pH and Temperature on Activity and Stability of Trpase L-Tryptophan in potassium phosphate buffer was used to evaluate the effects of pH and temperature on the catalytic activity of VcTrpase [2, 26, 27]. The activity of enzyme was highest at 45 °C and gradually reduced when the temperature was increased to 70 °C where the activity was almost undetectable (Fig. 4a). In a thermal stability study, ∼60 % of the total activity remained at 45 °C and no enzyme activity was observed after 10-min treatment at 60 °C (Fig. 4c). The optimum pH of the VcTrpase activity was pH 9.0 (Fig. 4b), and it remained stable between pH levels 6.5 and 8.0 with residual activity ≥∼80 % (Fig. 4d).
Conclusion and Future Perspective The Trpase enzyme from V. cholerae O1 was successfully expressed, purified, and characterized. Although VcTrpase had a high homology (>80 % identity) to EcTrpase, some differences in biochemical and enzymatic properties were observed. VcTrpase had a lower stability toward Table 2 Steady state kinetic parameters of VcTrpase Substrate
Km (M)
L-Tryptophan
0.612×10−3
S-Methyl-L-cysteine S-Benzyl-L-cysteine
−3
30.15×10
−3
0.210×10
kcat (s−1)
kcat/Km (M−1 s−1)
5.252
8.582×103
0.490
0.016×103
0.346
1.648×103
Values represent a mean value of three experiments. No activity with L-phenylalanine and L-serine was observed
Appl Biochem Biotechnol (2015) 175:243–252
A
100
Relative activity (%)
Relative activity (%)
100
251
80
60
40
60
40
0
0 30
40
50
60
Temperature (oC)
70
80
6
7
8
9
10
pH
C
100
Relative activity (%)
Relative activity (%)
80
20
20
100
B
80
60
40
D
80
60
40
20
20
0 30
40
50
60
Temperature (oC)
70
80
0 6
7
pH
8
9
10
Fig. 4 Optimum temperature (a) and pH (b) for VcTrpase activity and the effect of temperature (c) and pH (d) on VcTrpase activity
treatment with heat and extreme pH. Mutagenesis studies confirmed the conserved residues (Thr52, Tyr74, Arg103, Asp137, Arg230, Lys269, and Lys270) required for the catalytic function of the enzyme. These conserved residues could be targets for developing antimicrobial agents based on Trpase competitive inhibitors [39]. The catalytic performance of VcTrpase was slightly lower than that of two other well-known Trpases from E. coli and P. vulgaris. More importantly, VcTrpase clearly exhibited a preference for interactions with polar aromatic substrates such as L-tryptophan and S-benzyl-L-cysteine. Further studies will be required to evaluate the molecular mechanism involved in the regulation of Trpase expression as well as its effects on the growth and virulence of V. cholerae in human and aquatic environments. In addition, engineering of a more efficient enzyme for metabolizing L-tryptophan and other amino acid analogs may be needed. Acknowledgments This work was financially supported by the general research fund from the Prince of Songkla University (contract no. MET530228S). T.N. was grateful for graduate research scholarships, Faculty of Science, Prince of Songkla University (PSU Ph.D. scholarship number 0994/2555 and research assistant grant number 1-2553-02-008). Authors were thankful to Prof. Dr. Robert S. Philips for his kindness in providing indole-negative host cells, E. coli strain BL21(DE3) tn5:tnaA. Thanks also to Dr. Brian Hodgson for his assistance with the English.
References 1. Snell, E. E. (1975) Advances in enzymology and related areas of molecular biology. Wiley, pp. 287–333. 2. Happold, F. C., & Struyvenberg, A. (1954). Biochemical Journal, 58, 379–382. 3. Honda, T., & Tokushige, M. (1986). Journal of Biochemistry, 100, 679–685.
252
Appl Biochem Biotechnol (2015) 175:243–252
4. Hara, R., & Kino, K. (2013). AMB Express, 3, 70. 5. Du, J., Duan, J. J., Zhang, Q., Hou, J., Bai, F., Chen, N., & Bai, G. (2012). Prikladnaia Biokhimiia i Mikrobiologiia, 48, 183–190. 6. Shimada, A., Ozaki, H., Saito, T., & Fujii, N. (2011). Journal of Chromatography B, 879, 3289–3295. 7. Shimada, A., Ozaki, H., Saito, T., & Noriko, F. (2009). International Journal of Molecular Sciences, 10, 2578–2590. 8. Zhao, Z.-J., Zou, C., Zhu, Y.-X., Dai, J., Chen, S., Wu, D., Wu, J., & Chen, J. (2011). Journal of Industrial Microbiology & Biotechnology, 38, 1921–1929. 9. Lee, J., Jayaraman, A., & Wood, T. (2007). BMC Microbiology, 7, 42. 10. Lee, J.-H., & Lee, J. (2010). FEMS Microbiology Reviews, 34, 426–444. 11. Wang, D., Ding, X., & Rather, P. N. (2001). Journal of Bacteriology, 183, 4210–4216. 12. Di Martino, P., Fursy, R., Bret, L., Sundararaju, B., & Phillips, R. S. (2003). Canadian Journal of Microbiology, 49, 443–449. 13. Lee, J., Attila, C., Cirillo, S. L., Cirillo, J. D., & Wood, T. K. (2009). Microbial Biotechnology, 2, 75–90. 14. Mueller, R. S., Beyhan, S., Saini, S. G., Yildiz, F. H., & Bartlett, D. H. (2009). Journal of Bacteriology, 191, 3504–3516. 15. Huq, A., Whitehouse, C. A., Grim, C. J., Alam, M., & Colwell, R. R. (2008). Current Opinion in Biotechnology, 19, 244–247. 16. Nandi, B., Nandy, R. K., Mukhopadhyay, S., Nair, G. B., Shimada, T., & Ghose, A. C. (2000). Journal of Clinical Microbiology, 38, 4145–4151. 17. Phillips, R. S., Johnson, N., & Kamath, A. V. (2002). Biochemistry, 41, 4012–4019. 18. Sambrook, J., & Russell, D. W. (2001). Molecular cloning: a laboratory manual (4th ed.). Cold Spring Harbor: Cold Spring Harbor Laboratory Press. 19. Bradford, M. M. (1976). Analytical Biochemistry, 72, 248–254. 20. Phillips, R. S., & Gollnick, P. D. (1989). Journal of Biological Chemistry, 264, 10627–10632. 21. Morino, Y., & Snell, E. E. (1970). Methods in Enzymology, 17, 439–446. 22. Martin, K., Morlin, G., Smith, A., Nordyke, A., Eisenstark, A., & Golomb, M. (1998). Journal of Bacteriology, 180, 107–118. 23. Deeley, M. C., & Yanofsky, C. (1981). Journal of Bacteriology, 147, 787–796. 24. Kamath, A. V., & Yanofsky, C. (1992). Journal of Biological Chemistry, 267, 19978–19985. 25. Yoshida, Y., Sasaki, T., Ito, S., Tamura, H., Kunimatsu, K., & Kato, H. (2009). Microbiology, 155, 968–978. 26. Ku, S. Y., Yip, P., & Howell, P. L. (2006). Acta Crystallographica Section D: Biological Crystallography, 62, 814–823. 27. Isupov, M. N., Antson, A. A., Dodson, E. J., Dodson, G. G., Dementieva, I. S., Zakomirdina, L. N., Wilson, K. S., Dauter, Z., Lebedev, A. A., & Harutyunyan, E. H. (1998). Journal of Molecular Biology, 276, 603–623. 28. June, D. S., Suelter, C. H., & Dye, J. L. (1981). Biochemistry, 20, 2714–2719. 29. Zakomirdina, L. N., Kulikova, V. V., Gogoleva, O. I., Dementieva, I. S., Faleev, N. G., & Demidkina, T. V. (2002). Biochemistry (Moscow), 67, 1189–1196. 30. Erez, T., Gdalevsky, G. Y., Torchinsky, Y. M., Phillips, R. S., & Parola, A. H. (1998). Biochimica et Biophysica Acta, Protein Structure and Molecular Enzymology, 1384, 365–372. 31. Kogan, A., Gdalevsky, G., Cohen-Luria, R., Goldgur, Y., Phillips, R. S., Parola, A., & Almog, O. (2009). BMC Structural Biology, 9, 65. 32. Demidkina, T. V., Zakomirdina, L. N., Kulikova, V. V., Dementieva, I. S., Faleev, N. G., Ronda, L., Mozzarelli, A., Gollnick, P. D., & Phillips, R. S. (2003). Biochemistry, 42, 11161–11169. 33. Phillips, R. S., Kalu, U., & Hay, S. (2012). Biochemistry, 51, 6527–6533. 34. Kulikova, V. V., Zakomirdina, L. N., Bazhulina, N. P., Dementieva, I. S., Faleev, N. G., Gollnick, P. D., & Demidkina, T. V. (2003). Biochemistry (Mosc), 68, 1181–1188. 35. Kiick, D. M., & Phillips, R. S. (1988). Biochemistry, 27, 7339–7344. 36. Phillips, R. S., Richter, I., Gollnick, P., Brzovic, P., & Dunn, M. F. (1991). Journal of Biological Chemistry, 266, 18642–18648. 37. Sasaki-Imamura, T., Yano, A., & Yoshida, Y. (2010). Applied and Environmental Microbiology, 76, 4260–4268. 38. Phillips, R. S., Ghaffari, R., Dinh, P., Lima, S., & Bartlett, D. (2011). Archives of Biochemistry and Biophysics, 506, 35–41. 39. Scherzer, R., Gdalevsky, G. Y., Goldgur, Y., Cohen-Luria, R., Bittner, S., & Parola, A. H. (2009). Journal of Enzyme Inhibition and Medicinal Chemistry, 24, 350–355.
