Characterization of the Promoter of the Human Gi2 a-Subunit Gene
Lee S. Weinstein, Inna Kats, Allen M. Spiegel, and Anthony D. Carter* Molecular Pathophysiology Branch National Institute of Diabetes, Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892
are regulated may be determined. This paper reports the first characterization of a G a-subunit gene promoter. Gi2 is a G protein that appears to be expressed in all tissues and cell types examined (5, 6). It has a particularly high level of expression in cells of myeloid origin (7), and its expression is increased when myelomonocytic cells are induced to differentiate (8). Gi2, moreover, shows differential expression in melanoma cell subclones with high vs. low metastatic potential (9). The function(s) of Gi2 is not clearly defined, but recent work indicates that Gi2 mediates «2-adrenergic inhibition of adenylyl cyclase in platelets (10). We have previously isolated genomic clones encompassing the whole human Gi2a gene (11) and showing it to be a complex gene consisting of 9 exons spanning 23.5 kilobases (kb) on chromosome 3 (3). Examination of the 5' flanking region shows it to be highly G+C rich, with multiple GC boxes (potential Sp1-binding sites) (12), but no TATA box (13, 14), similar to ras and cellular housekeeping genes (15-20). A CAAT box (13, 14) 135 basepairs (bp) upstream of the major transcriptional start site is noted. By S1 nuclease and primer extension analysis, there appears to be one major transcriptional start site 133 bp upstream of the translational cap site in two different human cell lines with several probable minor start sites (11). Knowing this gene is ubiquitously expressed we chose to study its promoter in the CV1 green monkey kidney cell line. By cloning the 5' flanking region upstream of the CAT gene and measuring CAT expression in multiple 5' deletion mutants, we were able to confirm that this region is a promoter and have identified two regions whose 5' borders are - 8 5 and - 4 6 (relative to the major transcriptional start site) as crucial for full promoter activity. The results of primer extension using a CAT-specific primer as well as analysis of 3' deletion mutants confirm the functional importance of the previously determined major transcriptional initiation site.
The promoter of the human gene for the a-subunit of Gi2, a GTP-binding signal transduction protein, was analyzed by cloning the 5' flanking region of the gene upstream of the bacterial chloramphenicol acetyltransferase (CAT) gene and measuring the level of CAT expression after transfection in CV-1 green monkey kidney cells. Analysis of multiple 5' deletion mutants reveals that a minimum of 85 bases upstream of the major transcriptional initiation site are required for full basal promoter activity. Deleting 11 bases to position - 7 4 causes a 4-fold decrease in promoter activity. Another major decrement in activity is seen when a GC box between - 4 6 and - 3 3 is deleted, consistent with this region being a functionally active Sp1 factor-binding site. Primer extension of a CAT-specific primer hybridized to RNA from cells transfected with a Gi2a promoterCAT construct confirms approximately the same transcriptional start site as the endogenous Gi2a gene. The 3' deletion mutants that either approach or delete the transcriptional start site have markedly diminished activity. (Molecular Endocrinology 4: 958-964, 1990)
INTRODUCTION
G proteins are an expanding family of heterotrimeric GTP-binding proteins that convey signals from cell surface receptors to intracellular enzymes and ion channels (1, 2). They are important in the transduction of diverse extracellular signals, including those of peptide and glycoprotein hormones, monoamine neurotransmitters, and physical agents such as light. G proteins consist of a-, j8-, and 7-subunits. The a-subunits, each the product of a separate gene (3), are unique for each G protein and may confer specificity to receptor and effector coupling. One mechanism by which a cell may alter its responsiveness to external signals is by altering the expression of a particular G« (4). By studying the Ga gene promoters, the mechanisms by which these genes
RESULTS Analysis of 5' Deletion Mutants in Transient Expression Experiments
0888-8809/90/0958-0964$02.00/0 Molecular Endocrinology Copyright © 1990 by The Endocrine Society
The 5' flanking region of the human Gi2 a-subunit gene was cloned upstream of the coding sequence for bac958
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 07 October 2015. at 23:23 For personal use only. No other uses without permission. . All rights reserved.
Human Gnu Gene Promoter
959
terial CAT. The parent clone spanned positions -1214 to +115 relative to the transcriptional start site of the endogenous gene, as determined previously by primer extension and S1 nuclease analysis (11). Deletion mutants were then created by either digestion and religation at convenient restriction sites or by exonuclease III digestion (Fig. 1). Transient CAT expression was determined in CV-1 green monkey kidney cells after transfection by calcium phosphate precipitation. Transfection efficiency was controlled by cotransfection with pCH110 (22), a plasmid containing the /3-galactosidase gene downstream of an SV40 early promoter. Under our conditions there did not appear to be competition between a test plasmid and the SV40 promoter in pCH110 (data not shown). The results in Fig. 2, expressed as relative corrected CAT activity, show that numerous constructs between -1214/+115 and -101/+115 have similar activities ranging from a 7- to 17-fold increase in activity compared to a promoterless construct. The -18/+115 clone had markedly lower promoter activity relative to the more full-length clones (26% relative to - 1 0 1 / +115), while the +49/+115 clone showed no significant promoter activity. The data are the average of multiple experiments, with each mutant tested against the —1214/+115 in two to five experiments in duplicate. These results indicate that in CV-1 cells under the conditions of our experiments only 101 bases upstream of the transcriptional start site are necessary for full basal promoter activity, and elements more upstream have little or no effect. To define further functional c/s-acting elements within the first 101 bases of the G,2a promoter, further mutants were created by Sa/31 exonuclease digestion of the -101/4-115 construct. Activity for these further deletions was compared to the originally created - 1 0 1 / +115 clone. Results of the transient expression assays in four experiments are shown in Fig. 3, with activities expressed relative to the -85/+115 mutant. Only 85 bases upstream of exon 1 are necessary for full CAT expression. There appear to be two stepwise drops in activity, one occurring when the promoter is deleted
-262 - 91 P P
H Sp
itP Sa -1214
from - 8 5 to - 7 4 and the second from - 4 6 to - 3 3 . The sequence just downstream of - 8 5 resembles the sequence of the binding site for transcriptional factor AP2 (-84 GCCCAGTC -77) (23,24) (Fig. 4). Also noted is an AGTCA motif present within previously defined consensus sequences for the AP1 transcriptional factor-binding site (25, 26). The sequence between - 4 6 and - 3 3 contains a GC box making this region a potential functionally active Sp1 transcriptional factorbinding site (12). Determination of the Transcriptional Initiation Site in a Gi2a Promoter-CAT Construct by Primer Extension Analysis Total RNA was isolated from CV-1 cells transfected with either the -85/+115, -33/+115, or promoterless pGEMCAT plasmid and 50 ng hybridized to an endlabeled primer corresponding to positions 4912-4929 of pSV2CAT (27). Primer extension using AMV reverse transcriptase of the RNA from cells tranfected with the —85/4-115 plasmid DNA yielded an extended product of approximately 214 bases (Fig. 5, lane 3), while primer extension of RNAs from the -33/+115 and pGEMCATtransfected cells produced no similar band (Fig. 5, lanes 1 and 2). Experiments using the —101/4-115 construct resulted in a band similar to that seen using -85/+115 (data not shown). These results are consistent with the 214-base extension product predicted by the previously determined major transcriptional initiation site of the endogenously expressed gene. Also, the results of the primer extensions are consistent with the CAT assays showing promoter activity for —85/4-115, but minimal activity above background for -33/+115. This experiment confirms that a Gi2a promoter-CAT construct and the endogenous promoter have the same site of initiation by RNA polymerase II and that the results of the transient expression experiments are not likely to be due to aberrantly initiated messages. Analysis of 3' Deletion Mutants in Transient Expression Experiments The Sma fragment from -236 to +115 was digested with Ba/31 exonuclease and cloned upstream of the
1 15 Sm
CAT B -354
Sm -236
X -139
1600 bp
Fig. 1. Schematic Representation of the Insert of the Parent G,2a Promoter-CAT Construct —1214/4-115 The insert in plasmid pGEM 4Z (Promega) contains the 5' flanking region of the Gi2a gene from position -1214 to +115 relative to the major transcriptional start site (11) linked to the bacterial CAT gene with an adapter creating the Smal site at +115. Convenient restriction sites used to create some of the 5' deletion mutants are noted with their relative positions. The remainder of the 5' deletion mutants were created by exonuclease III digestion of —1214/4-115. To create 3' deletion mutants the -236/ +115 Sma\ fragment was digested with fla/31 exonuclease at the 3' end and then religated upstream of the CAT gene. The locations of seven GC boxes (potential Sp1-binding sites) (12) are noted with black boxes. A region highly homologous to a portion of the cellular Harvey ras protooncogene (c-Ha-ras) promoter (21) is noted with an open box. The major transcriptional initiation site is noted by the arrow. B, BamHI; H, H/ndlll; P, Pst\; Sa, Sail, Sm, Smal; Sp, Sph\, X, Xho\.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 07 October 2015. at 23:23 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1990 960
Vol 4 No. 7
0.5
1.0
1 .5
2.0
2.5
RELATIVE CORRECTED CAT ACTIVITY Fig. 2. Results of Transient Expression of a Series of Gi2a Promoter-CAT 5' Deletion Mutants The corrected CAT activities of extracts from CV-1 cells transfected with 5' deletion mutants are expressed relative to the most full-length construct (-1214/+115), with error bars representing the SE of the relative corrected CAT activity. The mutants are noted by the positions of the 5' and 3' boundaries of the promoter region relative to the transcriptional start site (11). Transfection experiments in CV-1 cells, CAT, and /3-galactosidase determinations were performed as described in Materials and Methods. Corrected CAT activities were determined for each experiment by dividing the percent conversion to mono- and diacetylated chloramphenicol by the /3-galactosidase activity for the same extract. Each plasmid was tested in duplicate on two to five occasions.
-101/+115
pGEM CAT 0.0
0.2
0.4
0.8
1.0
Relative Corrected CAT Activity Fig. 3. Results of Transient Expression Experiments of 5' Deletion Mutants of -101/+115 Further 5' deletion mutants were created by treatment of mutant -101/+115 at the 5' end with 8a/31 exonuclease. Transfection experiments were performed, and data were analyzed as for the original series of deletion mutants. Results are expressed as corrected CAT activity relative to -85/+115. The data are the average of four experiments that were performed in duplicate, except for —101/+115 for which the data from two experiments are averaged. The -101 /+115 plasmid from the initial experiments was used in these experiments.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 07 October 2015. at 23:23 For personal use only. No other uses without permission. . All rights reserved.
Human Gi2« Gene Promoter
961
-140 TTCGCT®!
-12P
©TCGAGCCAATCAACAGCCTCTAATCTCCTCTGGCCCCG
-100
-80
-60 CCTGCAAGC©©(i©©©CGGCCCAGTCACAGGCTTGGTTCGCCCAGGCCCC -40
-20
©
Lee S. Weinstein, Inna Kats, Allen M. Spiegel, and Anthony D. Carter* Molecular Pathophysiology Branch National Institute of Diabetes, Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892
are regulated may be determined. This paper reports the first characterization of a G a-subunit gene promoter. Gi2 is a G protein that appears to be expressed in all tissues and cell types examined (5, 6). It has a particularly high level of expression in cells of myeloid origin (7), and its expression is increased when myelomonocytic cells are induced to differentiate (8). Gi2, moreover, shows differential expression in melanoma cell subclones with high vs. low metastatic potential (9). The function(s) of Gi2 is not clearly defined, but recent work indicates that Gi2 mediates «2-adrenergic inhibition of adenylyl cyclase in platelets (10). We have previously isolated genomic clones encompassing the whole human Gi2a gene (11) and showing it to be a complex gene consisting of 9 exons spanning 23.5 kilobases (kb) on chromosome 3 (3). Examination of the 5' flanking region shows it to be highly G+C rich, with multiple GC boxes (potential Sp1-binding sites) (12), but no TATA box (13, 14), similar to ras and cellular housekeeping genes (15-20). A CAAT box (13, 14) 135 basepairs (bp) upstream of the major transcriptional start site is noted. By S1 nuclease and primer extension analysis, there appears to be one major transcriptional start site 133 bp upstream of the translational cap site in two different human cell lines with several probable minor start sites (11). Knowing this gene is ubiquitously expressed we chose to study its promoter in the CV1 green monkey kidney cell line. By cloning the 5' flanking region upstream of the CAT gene and measuring CAT expression in multiple 5' deletion mutants, we were able to confirm that this region is a promoter and have identified two regions whose 5' borders are - 8 5 and - 4 6 (relative to the major transcriptional start site) as crucial for full promoter activity. The results of primer extension using a CAT-specific primer as well as analysis of 3' deletion mutants confirm the functional importance of the previously determined major transcriptional initiation site.
The promoter of the human gene for the a-subunit of Gi2, a GTP-binding signal transduction protein, was analyzed by cloning the 5' flanking region of the gene upstream of the bacterial chloramphenicol acetyltransferase (CAT) gene and measuring the level of CAT expression after transfection in CV-1 green monkey kidney cells. Analysis of multiple 5' deletion mutants reveals that a minimum of 85 bases upstream of the major transcriptional initiation site are required for full basal promoter activity. Deleting 11 bases to position - 7 4 causes a 4-fold decrease in promoter activity. Another major decrement in activity is seen when a GC box between - 4 6 and - 3 3 is deleted, consistent with this region being a functionally active Sp1 factor-binding site. Primer extension of a CAT-specific primer hybridized to RNA from cells transfected with a Gi2a promoterCAT construct confirms approximately the same transcriptional start site as the endogenous Gi2a gene. The 3' deletion mutants that either approach or delete the transcriptional start site have markedly diminished activity. (Molecular Endocrinology 4: 958-964, 1990)
INTRODUCTION
G proteins are an expanding family of heterotrimeric GTP-binding proteins that convey signals from cell surface receptors to intracellular enzymes and ion channels (1, 2). They are important in the transduction of diverse extracellular signals, including those of peptide and glycoprotein hormones, monoamine neurotransmitters, and physical agents such as light. G proteins consist of a-, j8-, and 7-subunits. The a-subunits, each the product of a separate gene (3), are unique for each G protein and may confer specificity to receptor and effector coupling. One mechanism by which a cell may alter its responsiveness to external signals is by altering the expression of a particular G« (4). By studying the Ga gene promoters, the mechanisms by which these genes
RESULTS Analysis of 5' Deletion Mutants in Transient Expression Experiments
0888-8809/90/0958-0964$02.00/0 Molecular Endocrinology Copyright © 1990 by The Endocrine Society
The 5' flanking region of the human Gi2 a-subunit gene was cloned upstream of the coding sequence for bac958
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 07 October 2015. at 23:23 For personal use only. No other uses without permission. . All rights reserved.
Human Gnu Gene Promoter
959
terial CAT. The parent clone spanned positions -1214 to +115 relative to the transcriptional start site of the endogenous gene, as determined previously by primer extension and S1 nuclease analysis (11). Deletion mutants were then created by either digestion and religation at convenient restriction sites or by exonuclease III digestion (Fig. 1). Transient CAT expression was determined in CV-1 green monkey kidney cells after transfection by calcium phosphate precipitation. Transfection efficiency was controlled by cotransfection with pCH110 (22), a plasmid containing the /3-galactosidase gene downstream of an SV40 early promoter. Under our conditions there did not appear to be competition between a test plasmid and the SV40 promoter in pCH110 (data not shown). The results in Fig. 2, expressed as relative corrected CAT activity, show that numerous constructs between -1214/+115 and -101/+115 have similar activities ranging from a 7- to 17-fold increase in activity compared to a promoterless construct. The -18/+115 clone had markedly lower promoter activity relative to the more full-length clones (26% relative to - 1 0 1 / +115), while the +49/+115 clone showed no significant promoter activity. The data are the average of multiple experiments, with each mutant tested against the —1214/+115 in two to five experiments in duplicate. These results indicate that in CV-1 cells under the conditions of our experiments only 101 bases upstream of the transcriptional start site are necessary for full basal promoter activity, and elements more upstream have little or no effect. To define further functional c/s-acting elements within the first 101 bases of the G,2a promoter, further mutants were created by Sa/31 exonuclease digestion of the -101/4-115 construct. Activity for these further deletions was compared to the originally created - 1 0 1 / +115 clone. Results of the transient expression assays in four experiments are shown in Fig. 3, with activities expressed relative to the -85/+115 mutant. Only 85 bases upstream of exon 1 are necessary for full CAT expression. There appear to be two stepwise drops in activity, one occurring when the promoter is deleted
-262 - 91 P P
H Sp
itP Sa -1214
from - 8 5 to - 7 4 and the second from - 4 6 to - 3 3 . The sequence just downstream of - 8 5 resembles the sequence of the binding site for transcriptional factor AP2 (-84 GCCCAGTC -77) (23,24) (Fig. 4). Also noted is an AGTCA motif present within previously defined consensus sequences for the AP1 transcriptional factor-binding site (25, 26). The sequence between - 4 6 and - 3 3 contains a GC box making this region a potential functionally active Sp1 transcriptional factorbinding site (12). Determination of the Transcriptional Initiation Site in a Gi2a Promoter-CAT Construct by Primer Extension Analysis Total RNA was isolated from CV-1 cells transfected with either the -85/+115, -33/+115, or promoterless pGEMCAT plasmid and 50 ng hybridized to an endlabeled primer corresponding to positions 4912-4929 of pSV2CAT (27). Primer extension using AMV reverse transcriptase of the RNA from cells tranfected with the —85/4-115 plasmid DNA yielded an extended product of approximately 214 bases (Fig. 5, lane 3), while primer extension of RNAs from the -33/+115 and pGEMCATtransfected cells produced no similar band (Fig. 5, lanes 1 and 2). Experiments using the —101/4-115 construct resulted in a band similar to that seen using -85/+115 (data not shown). These results are consistent with the 214-base extension product predicted by the previously determined major transcriptional initiation site of the endogenously expressed gene. Also, the results of the primer extensions are consistent with the CAT assays showing promoter activity for —85/4-115, but minimal activity above background for -33/+115. This experiment confirms that a Gi2a promoter-CAT construct and the endogenous promoter have the same site of initiation by RNA polymerase II and that the results of the transient expression experiments are not likely to be due to aberrantly initiated messages. Analysis of 3' Deletion Mutants in Transient Expression Experiments The Sma fragment from -236 to +115 was digested with Ba/31 exonuclease and cloned upstream of the
1 15 Sm
CAT B -354
Sm -236
X -139
1600 bp
Fig. 1. Schematic Representation of the Insert of the Parent G,2a Promoter-CAT Construct —1214/4-115 The insert in plasmid pGEM 4Z (Promega) contains the 5' flanking region of the Gi2a gene from position -1214 to +115 relative to the major transcriptional start site (11) linked to the bacterial CAT gene with an adapter creating the Smal site at +115. Convenient restriction sites used to create some of the 5' deletion mutants are noted with their relative positions. The remainder of the 5' deletion mutants were created by exonuclease III digestion of —1214/4-115. To create 3' deletion mutants the -236/ +115 Sma\ fragment was digested with fla/31 exonuclease at the 3' end and then religated upstream of the CAT gene. The locations of seven GC boxes (potential Sp1-binding sites) (12) are noted with black boxes. A region highly homologous to a portion of the cellular Harvey ras protooncogene (c-Ha-ras) promoter (21) is noted with an open box. The major transcriptional initiation site is noted by the arrow. B, BamHI; H, H/ndlll; P, Pst\; Sa, Sail, Sm, Smal; Sp, Sph\, X, Xho\.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 07 October 2015. at 23:23 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1990 960
Vol 4 No. 7
0.5
1.0
1 .5
2.0
2.5
RELATIVE CORRECTED CAT ACTIVITY Fig. 2. Results of Transient Expression of a Series of Gi2a Promoter-CAT 5' Deletion Mutants The corrected CAT activities of extracts from CV-1 cells transfected with 5' deletion mutants are expressed relative to the most full-length construct (-1214/+115), with error bars representing the SE of the relative corrected CAT activity. The mutants are noted by the positions of the 5' and 3' boundaries of the promoter region relative to the transcriptional start site (11). Transfection experiments in CV-1 cells, CAT, and /3-galactosidase determinations were performed as described in Materials and Methods. Corrected CAT activities were determined for each experiment by dividing the percent conversion to mono- and diacetylated chloramphenicol by the /3-galactosidase activity for the same extract. Each plasmid was tested in duplicate on two to five occasions.
-101/+115
pGEM CAT 0.0
0.2
0.4
0.8
1.0
Relative Corrected CAT Activity Fig. 3. Results of Transient Expression Experiments of 5' Deletion Mutants of -101/+115 Further 5' deletion mutants were created by treatment of mutant -101/+115 at the 5' end with 8a/31 exonuclease. Transfection experiments were performed, and data were analyzed as for the original series of deletion mutants. Results are expressed as corrected CAT activity relative to -85/+115. The data are the average of four experiments that were performed in duplicate, except for —101/+115 for which the data from two experiments are averaged. The -101 /+115 plasmid from the initial experiments was used in these experiments.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 07 October 2015. at 23:23 For personal use only. No other uses without permission. . All rights reserved.
Human Gi2« Gene Promoter
961
-140 TTCGCT®!
-12P
©TCGAGCCAATCAACAGCCTCTAATCTCCTCTGGCCCCG
-100
-80
-60 CCTGCAAGC©©(i©©©CGGCCCAGTCACAGGCTTGGTTCGCCCAGGCCCC -40
-20
©
