Vol. 58, No. 6

INFECTION AND IMMUNITY, June 1990, p. 1678-1684

0019-9567/90/061678-07$02.00/0 Copyright © 1990, American Society for Microbiology

Characterization of the Pilin Gene of Moraxella bovis Dalton 2d and Expression of Pili from M. bovis in Pseudomonas aeruginosa T. C. ELLEMAN,1* PETER A. HOYNE,1 AND ANTHONY W. D. LEPPER2 Divisions of Biotechnology1 and Animal Health,2 Commonwealth Scientific and Industrial Research Organisation,

343 Royal Parade, Parkville, Victoria 3052, Australia Received 1 September 1989/Accepted 7 March 1990

The pilin gene of Moraxella bovis Dalton 2d was isolated by cloning in Pseudomonas aeruginosa. The nucleotide sequence of this gene encodes a prepilin of 156 amino acid residues. When high levels of pilin were expressed from the gene in P. aeruginosa, by using the PL promoter of bacteriophage lambda inserted upstream of the coding sequence, pili which were indistinguishable from pili of M. bovis were produced.

vol) ethanol, air dried, and dissolved in 10 mM Tris hydrochloride-1 mM EDTA, pH 8.0. Hybridization. Hybridizations were performed in 5 x SSPE buffer (0.9 M NaCl, 0.005 M EDTA, 0.05 M sodium phosphate [pH 7.0]) containing 5x Denhardt reagent (0.1% Ficoll [Pharmacia Fine Chemicals], 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.1% SDS, and 100 ,ug of heat-denatured and sheared herring sperm DNA per ml. Prior to hybridization, nitrocellulose membranes with bound DNA were equilibrated in this buffer for 4 h at 43°C. Hybridizations with oligonucleotide probes were performed overnight at 30°C, and membranes were subsequently washed for 45 min at 450C in 6x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate, pH 7.0)-0.1% SDS. Probes prepared by random priming (10) were heated at 100°C for 3 min prior to use in overnight hybridization at 49°C, and membranes were subsequently washed at 49°C for 45 min in 2x SSC-0.1% SDS (low stringency) or at 650C for 45 min in 0.lx SSC-0.1% SDS (high stringency). Cloning of the M. bovis pilin gene. An oligonucleotide, Mbol (5'-TTCGATAAGGGTGAAACCTTTTTG-3', the reverse complement of residues 304 to 327 in Fig. 1A), was synthesized as a probe for detection of the pilin gene on an Applied Biosystems 381A DNA synthesizer. The sequence of the probe was based on a conserved nucleotide sequence encoding the amino-terminal residues of pilin from B. nodosus 265 (6) and M. bovis Epp63 (29). The probe (20 ng) was radiolabeled at the 5' end with 32P by polynucleotide kinase (5 U) and [y-32P]rATP (2 ,uCi). DNA fragments carrying the pilin gene were detected in restriction endonuclease digests of M. bovis DNA following fractionation in 1% (wt/vol) agarose gels and transfer to nitrocellulose by a modified Southern method (35). DNA fractions containing the pilin gene were recovered from agarose gel following dissolution of the gel in 4 M sodium iodide and application of Geneclean (BiolOl Inc., La Jolla, Calif.). DNA fractions were ligated into cut and alkaline phosphatase-treated plasmid vectors as follows: Hindlll-cut fragments (2 kilobase pairs [kbp]) into both HindlIl-cut pBR322 and Hindlll-cut pME290 (16) and Sau3AI-cut fragments (1.9 kbp) into BamHI-cut pME290. The ligation mixtures were used to transform Escherichia coli with pBR322-based plasmids and P. aeruginosa with pME290-based plasmids. E. coli RR1, MC1061, ER1647, and pop2136 were made competent for transformation by CaCl2 treatment (22), and P. aeruginosa 01 and K2PfS were made competent by MgCl2 treatment (7) following overnight stationary culture at 43°C (13). Transformed cells were plated

Pili of many bacteria have been used in prophylactic immunization against a number of pathogens of animals and humans and so are of interest as vaccine components (2, 9, 20, 23, 24, 32, 36). The pili of Bacteroides nodosus, Moraxella bovis, Moraxella nonliquefaciens, Neisseria gonorrhoeae, Neisseria meningitidis, Pseudomonas aeruginosa, and Vibrio cholerae have been characterized by determination of the amino acid sequence of pilin, the protein subunit of which pili are comprised. These proteins constitute a homologous group which is distinguished by a highly conserved amino-terminal sequence and an N-methylated, amino-terminal phenylalanine residue (for a review, see reference 3; 39). Because of the highly conserved structure of pili from these organisms (mePhe pili), it has proved possible to induce one bacterial species (P. aeruginosa) to produce pili of a different species (B. nodosus) following transfer of the foreign pilin gene (7, 30). This genetic manipulation has resulted in the development of a pilus-based vaccine against ovine foot rot by amplifying the production of pili from a fastidious organism, B. nodosus, in an organism which is better suited to industrial processes (8, 37). M. bovis causes infectious bovine keratoconjunctivitis, a highly contagious ocular disease of cattle (commonly called pinkeye). Infection may result in temporary or sometimes permanent blindness. Vaccination of cattle with pili of M. bovis has been shown to provide protection against infectious bovine keratoconjunctivitis in homotypic challenges (23, 24, 32). With a view to the development of a pilus-based vaccine against pinkeye by using recombinant DNA technology, we characterized the pilin gene of M. bovis Dalton 2d, an Australian isolate of the organism, and investigated expression of the gene in P. aeruginosa.

MATERIALS AND METHODS DNA preparation. A colony of the piliated phase of M. bovis Dalton 2d, recognized by its smaller, high-domed, smooth-edged appearance, was used to inoculate 200 ml of 3% (wt/vol) Tryptone Soya broth (Oxoid Ltd.). The culture was grown with shaking for 48 h at 37°C. Cells were harvested by centrifugation and lysed by the addition of sodium dodecyl sulphate (SDS) to spheroplasts formed by lysozyme-EDTA treatment (4). Following proteinase K treatment and phenol extraction of the cell lysate, DNA was precipitated by ethanol and spooled from the ethanol-water interface. The DNA preparation was washed in 70% (vol/ * Corresponding author. 1678

EXPRESSION OF PILI FROM M. BOVIS IN P. AERUGINOSA

VOL. 58, 1990

1679

A or-i

CAAAATTACCCGCCAGACATCAAATTTTAAAAATTTTTTGGCAAAAAATAAAAAAATTTG

60

TACATATTTTAATCAATTTTAAAAAATGGCAAAAAATCTGCCTATTTTTTAGACAAAATC

120

TTTAAAATTTTCTCAATTTTGCGTATTTTTTCCAAAAACAGCCCAAATCCACCAAAAAGT

180

TGGCACAGACAATGCAACAGTATGAGTGTAAGGTTAGCAAATATGTTTAAAGTTGCTAAT

240

GTCGGTGAGCTAGCTGCTGCTAAGACTGGTGCAGATGCTGCACTATTCGAAGGTAAAACT

420

UO

ProValValAsnProSerAlaAspGLyl leALaGluValAspLeuGLyLeuGLyGluALa CCAGTGGTTAACCCTAGTGCTGACGGCATTGCAGAAGT TSACTTGGGTCTAGGTGAAGCA

PL

B" HI

GCTCAAAAAGGTTTCACCCTTATCGAATTAATGATTGTTATCGCCATTATTGGTATCCTA

VaLGlyGLuLeuAlaAlaALaLysThrGLyAlaAspAlaALaLeuPheGLuGLyLysThr

9000 bp la

300

AlaGlnLysGLyPheThrLeul LeGLuLeuMetI LeValIleAlalLel leGlyl leLeu AltaALal eALaLeuProAtaTyrGlnAspTyrl teSerLysSerGtnThrThrArgVat GCTGCAATCGCTTTACCTGCTTATCMGACTATATCTCTAAGTCTCAAACTACTCGTGTA

pMD2d

pPAH121 8000 bp ble

MetAsn

CAGTTAACTTAAACAAACTGGGCAATATCGCCCCTATGAACTAAGGAGTTCATTATGAAC

g

HiPL

N

N

p1

I

FIG. 2. Construction of plasmid pMD2d. A 1-kbp DraI fragment carrying the M. bovis Dalton 2d pilin gene was inserted into the HpaI site of plasmid pPAH121. Arrows indicate the direction of transcription of genes. Abbreviations: bla, P-lactamase gene; pL, X PL promoter; N, phage A N gene; ori, origin of replication; pil, M. bovis pilin gene.

540

inserted into an HpaI site downstream of the phage lambda PL promoter in plasmid pP-L lambda (Pharmacia, Uppsala, Sweden). The ligated mixture wasX used to transform E. coli spIteHisGlyThrVal AsnGlyThrIleSerGtyThrl LeGLyGLyAsnALaAsnAsnA ApI LeisGLyThrVaL 660 pop2136(F endA thi hsdR malT PR c1857 malPQ, a strain AATGGTACGATTTCAGGCACTATCGGTGGCAATGCTAACAATG AICATTCATGGTACTGTA "OP constructed by 0. Raibaud [33] and possessing a chromoI leSerGlnGluArgAspAtaThrGtyVatTrpSerCysLysV somal copy of the c1857 gene, which encodes a thermolabile ATTTCTCAGGAACGTGACGCTACTGGTGTTTGGTCATGTAAAG repressor of the PL promoter). Cells harboring plasmids with GlyTrpLysAspLysPhel teProThrGtyCysThrLysALa the desired orientation of the pilin gene relative to the GGCTGGAAAGACAAGTTCATCCCAACTGGTTGCACAAAAGCTT~ AGTMTTAGCMGACCA 780 promoter were identified by SDS-polyacrylamide (15%) gel CCCAAAAAACACCACTCCTTTATGGGGTGGTGTTTTACGTAAA TACATCATCAGCAACCA 840 electrophoresis (21) of cell lysates following induction of expression at 42°C (5). The plasmid from these pilin-proCTATTAACACCTCTTAAAAGAGCGATTAACATCAAATATAAGA. MAACCACCACTCAAAG 900 ducing clones was designated pPD2d. For expression of the AACCGTTGGCGTACCAGCTAGGTTACACATTCA 933 pilin gene of M. bovis in P. aeruginosa, the 1-kbp DraI

AlaThrProArgSerAsnLeuLeuSerAlaVa lSerSerThrPIheThrLysGlyLysSer GCAACACCACGCTCTAACTTGCTATCAGCTGTATCTTCTACCT TTACAAAAGGTAAGC

600

MatThrGtyAsnGTyThr

-

-

B Hd

HS

D

Hd

D H

S

I- 1 kbp FIG. 1. (A) Nucleotide sequence of the rpilin gene from M. bovis Dalton 2d (GenBank accession no. M32665i). The encoded prepilin sequence appears above the nucleotide sequence. A region of hyphenated dyad symmetry, the potential tiranscription terminator, is indicated by arrows. (B) Map showing prc)ximal cleavage sites for restriction endonucleases relative to the pilirn-coding sequence of M. bovis Dalton 2d (arrow). Abbreviations: Hd, HindIII; S, Sau3AI; D, DraI; and H, Hinfl. Additional cleavage sit es of these enzymes not immediately adjacent to the pilin-coding se quence are not shown.

(E. coli) ml (~P. aeruginosa). The idenltify colonies of cells

on nutrient yeast agar with 50 ,ug of amj picillin per ml

or 500 pLg of carbenicillin per radiolabeled probe was used to which harbored the pilin gene (27). Nucleotide sequence determination. S,equences were determined either directly from plasmid DNA (11) by using oligonucleotide primers (14-mers) hav(ing sequences based on a predeterminated gene sequence orr from single-stranded templates prepared by subcloning thie 2-kbp HindlIl-cut fragment into the replicative fornn of bacteriophage M13mplO (31). The pilin gene sequen(ce was determined in both sense and antisense orientations. Expression of the M. bovis pilin gen e in E. coli and in P. aeruginosa. A 1-kbp fragment carrying the pilin gene of M. bovis Dalton 2d was isolated by DiraI digestion from a pME290-cloned 1.9-kbp Sau3AI fragm ent. For expression of the pilin gene of M. bovis in E. coli, ti he DraI fragment was

fragment was ligated into a unique HpaI site downstream of the PL promoter in plasmid pPAH121, an expression vector able to replicate in P. aeruginosa. This vector possesses the replicon from the Pseudomonas plasmid pVS1 (17), the

phage lambda PL BamHI cartridge (Pharmacia) for constitutive expression of genes from the A PL promoter, and the Tn801 P-lactamase gene for carbenicillin resistance (Fig. 2). The ligated mixture was used to transform P. aeruginosa K2PfS, a multipiliate variant of P. aeruginosa K (1). Colonies of cells harboring the pilin gene were detected by use of the radiolabeled probe, and those having plasmids with the desired orientation of the pilin gene relative to the promoter were identified by SDS-polyacrylamide (15%) gel electrophoresis (21) of cell lysates. Insertion of a single 1-kbp DraI fragment into expression vectors was verified by BamHI digestion of plasmid DNA prepared from minipreps (11). The plasmid derived from plasmid pPAH121 was designated

plasmid pMD2d. Pili preparation. M. bovis was grown on 5% blood agar at 35°C. P. aeruginosa was grown at 37°C on nutrient yeast broth or nutrient yeast agar (25 g of nutrient broth no. 2 [Oxoid] and 5 g of yeast extract [Oxoid] per liter) which were supplemented with 500 jig of carbenicillin per ml if P. aeruginosa harbored plasmids which produced P-lactamase. Small, high-domed colonies with smooth edges were chosen for subculture in all cases. Cells were harvested from the agar surface with buffered saline (0.15 M NaCl, 10 mM Tris hydrochloride, pH 8.0), and pili were sheared from cells by intermittent blending (5-s cycles) for 3 min. Bacterial cells were removed by centrifugation (17,000 x g, 30 min), and pili were precipitated from the supernatant with 0.1 M MgCl2 (4 h, 0°C). Pili were redissolved in water, and insoluble impurities were removed by centrifugation. Purity was assessed by SDS-polyacrylamide (15%) gel electrophoresis (21) and immunoblotting (18, 40). Antisera against M. bovis

1680

INFECT. IMMUN.

ELLEMAN ET AL.

C

B

A

4.o0 ON

2 .0" 1.5w

1.o0'

mm

N S

am ~

qm

''

1

2

3

4

5

6

1

2

3

4

5

6

1

2

3

4

5

6

FIG. 3. Autoradiographs of restriction endonuclease digests of M. bovis Dalton 2d DNA. Lanes: 1, DraI; 2, Sau3AI; 3, Hinfl; 4, HindIII; 5, Hinfl plus Hindlll; 6, HaeIII. (A and B) Probe was a DraI-HindIII restriction fragment carrying the entire coding region of the pilin gene and washed at high (A) or low (B) stringency; (C) probe was oligonucleotide Mbo2, AGCGATTGCAGCTAGGATACC, the reverse complement of residues 352 to 372 in Fig. 1A. Numbers to the left of panel A are DNA fragment sizes in kilobase pairs.

Dalton 2d pili or P. aeruginosa K pili were raised in rabbits by three intramuscular injections of 50 p,g of pili emulsified in incomplete Freund adjuvant during a 2-month period. Immunocytochemical labeling of pili. Colonies of cells were suspended in saline and dried on 300-mesh carbon-parlodion-coated copper grids. After incubation with rabbit antiM. bovis Dalton 2d pilus antiserum, grids were washed and further incubated with goat anti-rabbit immunoglobulin G labeled with 15-nm-diameter gold spheres (Janssen Pharmaceutica, Olen, Belgium). The preparations were negatively stained with uranyl acetate and examined by transmission electron microscopy. RESULTS Isolation of the M. bovis pilin gene. The oligonucleotide probe hybridized to a single size fragment in each of several restriction endonuclease digests of M. bovis Dalton 2d DNA, viz., Dral, 1.0 kbp; Sau3AI, 1.9 kbp; Hinfl, 1.6 kbp; HindIII, 2.0 kbp; HindIII plus Hinfl, 1.1 kbp; and HaeIII, 4.3 kbp (Fig. 1B). E. coli transformed with the 2-kbp DNA fraction from HindIII digestion was screened with the oligonucleotide probe, but no colonies which carried the pilin gene were detected following transformation. This was despite the generation of large numbers of transformants; the use of strains lacking several specific restriction systems which degrade foreign DNA, viz., McrA, McrB, Mrr, and EcoK; and the use of a DNA fraction enriched in the pilin gene through gel fractionation. In contrast, several clones which harbored the pilin gene (-1% of transformants) were detected following transformation of P. aeruginosa 01 or K2PfM. Sequence studies with these clones showed that the HindIII-cut fragment lacked a translation termination codon and a sequence further downstream, so the 1.9-kbp Sau3AIcut fragment was cloned in pME290-P. aeruginosa K2Pfs to generate a full-length pilin gene. DNA fragments carrying the pilin gene of M. bovis, when isolated from recombinant plasmids in P. aeruginosa, could be introduced into E. coli with normal high efficiency. Gene sequence characterization. The nucleotide sequence

identified by the oligonucleotide probe encoded an amino acid sequence of 156 residues from the likely initiation codon 295ATG (38) (Fig. 1A). Potential signals for initiation and termination of transcription by RNA polymerase are found in close proximity to the coding sequence, viz., an upstream sequence (residues 180 to 196 of Fig. 1A) similar to the consensus sequence of NtrA-activated promoters (19), the type of promoter of the P. aeruginosa pilin gene (15); a downstream sequence having hyphenated dyad symmetry followed by a polythymidine stretch (3). Except for the presence of a six-residue leader sequence, the encoded sequence is identical with the amino acid sequence of pilin from M. bovis Dalton 2d (N. McKern, unpublished data). The unusually short leader sequence is a feature of the encoded prepilins of mePhe pili (3). The entire coding sequence is located between a DraI site situated 69 base pairs upstream of the initiation codon and a HindIII site coincident with the translation termination codon. A hybridization probe was prepared by random priming (10) from the DraI-HindIII fragment which encodes pilin. In restriction enzyme digests of M. bovis Dalton 2d DNA transferred to nitrocellulose, this probe hybridized to a fragment, in each digest, of the same size as was previously identified by the oligonucleotide probe Mbol, with no other fragments producing bands of comparable intensity in autoradiography after washing at high stringency (Fig. 3A). At low stringency, other, fainter bands were present in several digests (Fig. 3B). A second oligonucleotide probe, Mbo2 (5'-AGCGATTGCAGCTAGGATACC-3', the reverse complement of residues 352 to 372 of Fig. 1A which corresponds to amino acid residues 20 to 26 of prepilin), hybridized strongly both to those fragments identified by oligonucleotide Mbol and to fragments of 4.2, 1.3, 2.1, 3, and 2.1 kbp in DraI, Sau3AI, Hinfl, HindIII, and Hinfl plus HindIlI digests, respectively (Fig. 3C); all of these fragment sizes corresponded to weakly hybridizing fragments detected by the DraI-HindIII probe but not by the Mbol oligonucleotide probe. These additional fragments may be indicative of a

EXPRESSION OF PILI FROM M. BOVIS IN P. AERUGINOSA

VOL. 58, 1990 r-

94 67 43

_:_

1.

;

'i

"

--

4

t .-WI

1681

B

A

"w

30_o

20

130 75 50 39 A* 27 -" 17

14

1 8 6 7 5 4 3 2 1 FIG. 4. SDS-polyacrylamide (15%) gel electrophoresis of cellular proteins and pilus preparations stained with Coomassie brilliant blue R250. Lanes: 1, molecular weight markers (103); 2, E. coli pop2136 harboring pP-L lambda, induced at 42°C; 3, E. coli pop2136 harboring pPD2d, induced at 42°C; 4, P. aeruginosa K2PfS harboring pPAH121; 5, P. aeruginosa K2Pfs harboring pMD2d; 6, pili prepared from M. bovis Dalton 2d; 7, pili prepared from P. aeruginosa pMD2d; 8, pili prepared from P. aeruginosa pPAH121. Cell lysates were prepared by boiling cells in 2% SDS for 3 min.

further partial pilin gene sequence in the genome of M. bovis Dalton 2d, as found in M. bovis Epp63 (28). Expression of M. bovis pili by P. aeruginosa. P. aeruginosa K2Pfs cells which harbored plasmid pMD2d (i.e., those engineered for high-level expression of M. bovis pilin) grew more slowly than those of P. aeruginosa or P. aeruginosa harboring the plasmid vector pPAH121. In addition, the cells of P. aeruginosa pMD2d were slightly more heavily piliated. A strong pilin band was present in SDS-polyacrylamide gel electrophoresis of cell lysates from P. aeruginosa pMD2d (Fig. 4), and the mobility of this band indicated that processing of prepilin to pilin had occurred (compare with E. coli pPD2d-produced prepilin of greater apparent molecular weight). Pili prepared from P. aeruginosa pMD2d showed a single protein band in SDS-polyacrylamide gel electrophoresis, having the same mobility as that of pili from M. bovis Dalton 2d (and also the same mobility as that of pili from P. aeruginosa K). This protein band cross-reacted with anti-M. bovis Dalton 2d pilus antiserum after immunoblotting and showed no detectable cross-reactivity with anti-P. aeruginosa K pilus antiserum (Fig. 5). Inhibition of indigenous pilin and pilus production by P. aeruginosa in the presence of over-expressed foreign pilin was similarly noted when B. nodosus pili were expressed in P. aeruginosa (7). Immunocytochemical labeling showed that the M. bovis pilin protein produced by P. aeruginosa was assembled into pili (Fig. 6). The amino-terminal sequence of these pili (mePhe-Thr-

Leu-Ile-Glu-Leu-Met-Ile-Val-lle*-Ala-Ile-Ile-Gly-Ile) demonstrated that correct processing of M. bovis prepilin to pilin had occurred in P. aeruginosa and confirmed the pili as M.

2

3

4

2

3

4

FIG. 5. Immunoblots of pilus preparations. Lanes: 1, molecular weight markers (103); 2, pili from P. aeruginosa pPAH121; 3, pili from P. aeruginosa pMD2d; 4, pili from M. bovis Dalton 2d. (A) Nitrocellulose blot incubated with rabbit anti-M. bovis Dalton 2d pilus antiserum; (B) nitrocellulose blot incubated with rabbit anti-P. aeruginosa K pilus antiserum. Both membranes were subsequently treated with goat anti-rabbit immunoglobulin G antiserum-horseradish peroxidase conjugate for visualization (12).

bovis type, rather than those of P. aeruginosa, by the presence of isoleucine instead of valine at residue 10 (denoted by an asterisk).

DISCUSSION The use of P. aeruginosa as a primary cloning agent for the pilin gene of M. bovis was precipitated by the inability to detect E. coli clones harboring the gene. Restriction systems of E. coli other than the McrA, McrB, Mrr, and EcoK may inhibit cloning of the M. bovis pilin gene in competent E. coli through the degradation of pilin gene DNA. The later successful cloning of the pilin gene in E. coli following passage of pilin gene DNA through P. aeruginosa rules out the possibility that a lethal effect of the gene in E. coli prevents isolation. The successful application of P. aeruginosa to the primary cloning of the M. bovis pilin gene may result from the lack in this organism of an appropriate restriction system to degrade the pilin gene DNA or from inactivation of a restriction system by growth at 43°C (growth of P. aeruginosa at elevated temperature [43°C] is routinely used to inactivate host restriction systems that lower the efficiency of cloning of E. coli DNA [13]). These issues were not further addressed following the successful isolation of the pilin gene. In previous studies, workers have reported amino acid sequences of alpha and beta variants of M. bovis Epp63 pilins (29, 34). It has been proposed that organisms of this strain are able to undergo antigenic switching between alpha and beta pilins by a mechanism involving inversion of a 2-kbp fragment of DNA whose endpoint occurs within the coding region of the pilin gene (28). Our nucleotide sequence of the M. bovis Dalton 2d pilin gene permits a comparison to be made between pilin genes of different strains of M. bovis

1682

INFECT. IMMUN.

ELLEMAN ET AL. V*

*~~W-0

:

*

0

.&..

:

.8

S

q

* .;

41;..-

:::

': *' *W

41 6

^~~~i"I

s3|_

FIG. 6. Immunocytochemical labeling of pili. (A) P. aeruginosa pPAH121; (B) P. aeruginosa pMD2d (harboring the pilin gene of M. bovis Dalton 2d); (C) M. bovis Dalton 2d. Cells were labeled with rabbit antiserum against M. bovis Dalton 2d pili and goat anti-rabbit immunoglobulin G conjugated with 15-nm gold spheres.

and between interstrain and intrastrain sequence variations of pilins. The cloned sequence reported for the pilin gene of M. bovis Epp63, shows a high degree of similarity (97%) with that of M. bovis Dalton 2d in the 280 upstream residues adjacent to the coding sequence. The cloned sequence reported for the pilin gene of M. bovis Epp63,B is an artifact upstream of some undetermined position (29), so comparison of sequences suggests that only the 280 upstream nucleotides adjacent to the coding sequence of the pilin gene from M. bovis Epp63,3 represent the correct upstream sequence of this strain. The limited sequences available downstream of the pilin genes show similarity in the position and structure of a region of hyphenated dyad symmetry which is presumably the transcription terminator of the pilin genes, but downstream sequences do not show extensive similarity as do the coding and upstream sequences. The amino acid sequences encoded by the pilin genes of M. bovis Dalton 2d and Epp63P show a high degree of similarity with each other and with pilin of M. bovis Epp63o (Fig. 7). Extensive conservation of sequence occurs in the terminal regions, and this reflects the conservation of sequence displayed by all mePhe pilins in these regions, presumably related to structural constraints for pilus formation (3). The greatest variation of sequence is found within the central region of the pilin sequences (alignment positions 58 to 101), with residues 61 to 67 showing the highest variability in amino acid type of any region, while residues 69 to 100 require numerous insertions and deletions for alignment. Overall sequence variation between pilins from alpha and beta isolates of M. bovis Epp63 is surprisingly almost as large as that between pilins of these isolates and pilin of M. bovis Dalton 2d (Table 1). Nevertheless, the pilus variants of Epp63 are reported to be more closely related antigenically to each other than to pili of Dalton 2d; the alpha and beta pili of Epp63 exhibit 50% shared antigenicity (34), whereas pili of Epp63 and Dalton 2d show considerably less cross-reactivity (25). The sequence comparison of pilins

(Fig. 7) gives no obvious indication of the closer serological relationship between the pili of the Epp63 variants; the only region showing appreciably closer similarity between Epp63 pilin sequences occurs at alignment positions 110 to 117, where residues of like charge are conserved between Epp63 pilin variants. It remains to be demonstrated whether the shared antigenic determinants of the alpha and beta pilins of Epp63 or other strains of M. bovis are immunologically cross-protective in cattle. Pili from strains of B. nodosus which show less than 82% identity in pilin sequence provide no cross-protection against foot rot infection in sheep (3, 14). If alpha and beta pilus variants, which in M. bovis Epp63 show 72% identity in pilin sequence, are not cross-protective, the

Dalton2d

10 20 30 40 meFTLIELMIVIAIIGILAAIALPAYQDYISKSQTTRVVGEL

Epp63Q

meFTLIELMIVIAIIGILAAIALPAYQDYISKSQTTRVS+GEL

Epp630

meFTLIELMIVIAIIGILAAIALPAYQDYISKSQTTRVIVGEL

XiTGA

50 60 70 80 90 100 DAALFEGKTP VVNPSADGIAiEVDL CL E---AATP RSNL LSA VSST-FTKGKS

AAGKTIA VDAALFEGKTPjVLSEESSTSKIEI-NI GLT SSETSTKP RSNL MAS VELTGFADN-G K AVPAALFEGKTP KLGKAANDTEjEJ-DI

110

120

NUGl ISG_I5G KP JGDI1HGIS

130 RDATG VW

GLrT--TGGTA SNL MSS NIGGGAFATG 140 KV TN-GTG K

150 F1PTG

KA

AGlTISAT1L GNAN|D1lAKTVI'l |RtTT GVWTCKIDGSQAAKY|KEKFNPTGCVKK E L NK Gl

C

EDAE_y rIffI iJSAAPG WKK VTGC E FIG. 7. Comparison of pilin sequences from M. bovis Dalton 2d, Epp63a, and Epp63P. Residues identical in pilins of all three strains are boxed. Sequences of pilins from Dalton 2d and Epp630 (29) were predicted from pilin gene sequences. The sequence of pilin from Epp63O is that reported by Ruehl et al. (34). A

A G AGV I

EXPRESSION OF PILI FROM M. BOVIS IN P. AERUGINOSA

VOL. 58, 1990

TABLE 1. Sequence comparisons of pilins from M. bovis Dalton 2d and Epp63 % Identity ina:

Strain Epp63a

Epp63a Epp63,B Dalton 2d

100 72 (2) 63 (3)

Epp63P 72 (2) 100 61 (2)

3. Dalton 2d

63 (3) 61 (2) 100

a The number of identities in each comparison is expressed as a percentage of the maximum possible number of aligned residues in that comparison. Gaps (in parenthesis) were introduced in alignments if the total number of identical residues aligned increased by more than two for each added gap.

possibility arises that spontaneous intrastrain antigenic variation through genetic switching in M. bovis could pose problems for vaccine formulation, since the number of antigenically different components in a vaccine is limited by economics and possible antigenic competition. The extent of pilus antigen switching in strains of M. bovis remains to be determined. Pilus subunit size variation (i.e., alpha and beta variants) has been detected only in some strains (26), but an inability to resolve pilins of different antigenic forms by SDS-polyacrylamide gel electrophoresis may account for this. Only a single pilin band has been observed in SDSpolyacrylamide gel electrophoresis of pili from M. bovis Dalton 2d. However, this strain, like Epp63, may have a second partial pilin gene, as suggested by the existence in the genome of a small region of sequence which hybridized weakly to the pilin-coding sequence. The different hybridization patterns of oligonucleotide probes Mbol and Mbo2 suggest that the putative second gene is missing a small part of the sequence corresponding to the encoded N-terminal region of the structural pilin gene (somewhat less than 21 residues of the prepilin sequence). P. aeruginosa K2PfS, which harbors plasmid pMD2d, has been shown to produce M. bovis pili rather than the indigenous pili of P. aeruginosa. The pilin produced by these cells has been correctly processed (by removal of a leader sequence and N methylation) and is assembled into extracellular pili structures. Extensive sequence and structural conservation among pilins of P. aeruginosa, M. bovis, and B. nodosus may account for the compatibility between the pilus biosynthesis system of P. aeruginosa and the pilin gene products of M. bovis and B. nodosus. The demonstrated ability to produce M. bovis pili in P. aeruginosa may enable the more facile production of pili for a vaccine against pinkeye in cattle. ACKNOWLEDGMENTS We are grateful to R. D. Edwards and L. Hermans for skilled technical assistance and to L. Tatarczuch for assistance with electron microscopy.

4.

5. 6. 7. 8.

9. 10.

11. 12.

13. 14.

15.

16. 17. 18.

19. 20. 21.

ADDENDUM We have become aware, during the course of this work, that pili from M. bovis Epp63 have been expressed in P.

22.

aeruginosa (M. Beard, personal communication).

23.

LITERATURE CITED 1. Bradley, D. E. 1974. The absorption of Pseudomonas aeruginosa pilus dependent bacteriophage to a host mutant with nonretractible pili. Virology 58:149-163. 2. Brinton, C. C., Jr., S. W. Wood, A. Brown, A. M. Labik, J. R. Bryan, S. W. Lee, S. E. Polen, E. C. Tramont, J. Sadoff, and W.

24.

25.

1683

Zollinger. 1982. The development of a neisserial pilus vaccine for gonorrhoea and meningococcal meningitis. Semin. Infect. Dis. 4:140-159. Elieman, T. C. 1988. Pilins of Bacteroides nodosus: molecular basis of serotypic variation and relationships to other bacterial pilins. Microbiol. Rev. 52:233-247. Elleman, T. C., P. A. Hoyne, D. L. Emery, D. J. Stewart, and B. L. Clark. 1984. Isolation of the gene encoding pilin of Bacteroides nodosus (strain 198), the causal organism of ovine foot rot. FEBS Lett. 173:103-107. ElHeman, T. C., P. A. Hoyne, D. L. Emery, D. J. Stewart, and B. L. Clark. 1986. Expression of the pilin gene from Bacteroides nodosus in Escherichia coli. Infect. Immun. 51:187-192. Elleman, T. C., P. A. Hoyne, N. M. McKern, and D. J. Stewart. 1986. Nucleotide sequence of the gene encoding the two-subunit pilin of Bacteroides nodosus 265. J. Bacteriol. 167:243-250. Elleman, T. C., P. A. Hoyne, D. J. Stewart, N. M. McKern, and J. E. Peterson. 1986. Expression of pili from Bacteroides nodosus in Pseudomonas aeruginosa. J. Bacteriol. 168:574-580. Elieman, T. C., and D. J. Stewart. 1988. Efficacy against footrot of a Bacteroides nodosus 265 (serogroup H) pilus vaccine expressed in Pseudomonas aeruginosa. Infect. Immun. 56: 595-600. Every, D., and T. M. Skerman. 1982. Protection of sheep against experimental footrot by vaccination with pili purified from Bacteroides nodosus. N. Z. Vet. J. 30:156-158. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13. Hattori, M., and Y. Sakaki. 1986. Dideoxy sequencing method using denatured plasmid templates. Anal. Biochem. 152:232238. Hawkes, R., E. Niday, and J. Gordon. 1982. A dot-immunobinding assay for monoclonal and other antibodies. Anal. Biochem. 119:142-147. Holloway, B. W. 1969. Genetics of Pseudomonas. Bacteriol. Rev. 33:419-443. Hoyne, P. A., T. C. Elieman, N. M. McKern, and D. J. Stewart. 1989. Sequence of pilin from Bacteroides nodosus 351 (serogroup H) and implications for serogroup classification. J. Gen. Microbiol. 135:1113-1122. Ishimoto, K. S., and S. Lory. 1989. Formation of pilin in Pseudomonas aeruginosa requires the alternative cr factor (RpoN) of RNA polymerase. Proc. Natl. Acad. Sci. USA 86:1954-1957. Itoh, Y., and D. Haas. 1985. Cloning vectors derived from the Pseudomonas plasmid pVS1. Gene 36:27-36. Itoh, Y., J. M. Watson, D. Haas, and T. Leisinger. 1984. Genetic and molecular characterization of the Pseudomonas plasmid pVSl. Plasmid 11:206-220. Johnson, D. A., J. W. Gautsch, J. R. Sportsman, and J. H. Elder. 1984. Improved technique utilizing non-fat dry milk for analysis of proteins and nucleic acids transferred to nitrocellulose. Gene Anal. Tech. 1:3-8. Johnson, K., M. L. Parker, and S. Lory. 1986. Nucleotide sequence and transcriptional initiation site of two Pseudomonas aeruginosa pilin genes. J. Biol. Chem. 261:15703-15708. Klemm, P. 1985. Fimbrial adhesins of Escherichia coli. Rev. Infect. Dis. 7:321-340. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. Lederberg, E. M., and S. N. Cohen. 1974. Transformation of Salmonella typhimurium by plasmid deoxyribonucleic acid. J. Bacteriol. 119:1072-1074. Lehr, C., H. G. Jayappa, and R. A. Goodnow. 1985. Serologic and protective characteristics of Moraxella bovis pili. Cornell Vet. 75:484-492. Lepper, A. W. D. 1988. Vaccination against infectious bovine keratoconjunctivitis: protective efficacy and antibody response induced by pili homologous and heterologous strains of Moraxella bovis. Aust. Vet. J. 65:310-316. Lepper, A. W. D., and L. R. Hermans. 1986. Characterisation

1684

26.

27.

28.

29. 30.

31.

32.

ELLEMAN ET AL.

and quantitation of pilus antigens of Moraxella bovis by ELISA. Aust. Vet. J. 63:401-405. Lepper, A. W. D., and B. E. Power. 1988. Infectivity and virulence of Australian strains of Moraxella bovis for the murine and bovine eye in relation to pilus serogroup sub-unit size and degree of piliation. Aust. Vet. J. 65:305-309. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. The identification of recombinant clones, p. 309-362. In Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Marrs, C. F., W. W. Ruehl, G. K. Schoolnik, and S. Falkow. 1988. Pilin gene phase variation of Moraxella bovis is caused by an inversion of the pilin genes. J. Bacteriol. 170:3032-3039. Marrs, C. F., G. K. Schoolnik, J. M. Koomey, J. W. Hardy, J. B. Rothbard, and S. Falkow. 1985. Cloning and sequencing of a Moraxella bovis pilin gene. J. Bacteriol. 163:132-139. Mattick, J. S., M. M. Bills, B. J. Anderson, B. Dalrymple, M. R. Mott, and J. R. Egerton. 1987. Morphogenetic expression of Bacteroides nodosus fimbriae in Pseudomonas aeruginosa. J. Bacteriol. 169:33-41. Messing, J. 1983. New M13 vectors for cloning. Methods Enzymol. 101:20-78. Pugh, G. W., Jr., D. E. Hughs, and G. D. Booth. 1977. Experimentally induced infectious bovine keratoconjunctivitis: effectiveness of a pilus vaccine against exposure to homologous strains of Moraxella bovis. Am. J. Vet. Res. 38:1519-1522.

INFECT. IMMUN.

33. Raibaud, O., M. Mock, and M. Schwartz. 1984. A technique for integrating any DNA fragment into the chromosome of Escherichia coli. Gene 29:231-241. 34. Ruehl, W. W., C. F. Marrs, R. Fernandez, S. Falkow, and G. K. Schoolnik. 1988. Purification, characterization and pathogenicity of Moraxella bovis pili. J. Exp. Med. 168:983-1002. 35. Sniith, G. E., and M. D. Summers. 1980. The bidirectional transfer of DNA and RNA to nitrocellulose or diazobenzyloxymethyl-paper. Anal. Biochem. 109:123-129. 36. Stewart, D. J. 1978. The role of various antigenic fractions of Bacteroides nodosus in eliciting protection against footrot in vaccinated sheep. Res. Vet. Sci. 24:14-19. 37. Stewart, D. J., and T. C. Elleman. 1987. A Bacteroides nodosus pili vaccine produced by recombinant DNA for the prevention and treatment of footrot in sheep. Aust. Vet. J. 64:79-81. 38. Stormo, G. D., T. D. Schneider, and L. M. Gold. 1982. Characterization of translational initiation sites in E. coli. Nucleic Acids Res. 10:2971-2996. 39. Taylor, R. K., V. L. Miller, D. B. Furlong, and J. J. Mekalanos. 1987. Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin. Proc. Natl. Acad. Sci. USA 84:2833-2837. 40. Towbin, H., T. Staehlin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354.