MOLECULAR AND CELLULAR BIOLOGY, Sept. 1991, p. 4679-4689 0270-7306/91/094679-11$02.00/0 Copyright C) 1991, American Society for Microbiology

Vol. 11, No. 9

Characterization of the Major Regulatory Element Upstream of the Human a-Globin Gene Cluster ANDREW P. JARMAN,t WILLIAM G. WOOD, JACQUELINE A. SHARPE, GENEVIEVE GOURDON, HELENA AYYUB, DOUGLAS R. HIGGS* The MRC Molecular Haematology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DU, United Kingdom Received 7 January 1991/Accepted 24 June 1991

The major positive regulatory activity of the human a-globin gene complex has been localized to an element associated with a strong erythroid-specific DNase I hypersensitive site (HS -40) located 40 kb upstream of the ,2-globin mRNA cap site. Footprint and gel shift analyses of the element have demonstrated the presence of four binding sites for the nuclear factor GATA-1 and two sites corresponding to the AP-1 consensus binding sequence. This region resembles one of the major elements of the j8-globin locus control region in its constitution and characteristics; this together with evidence from expression studies suggests that HS -40 is a primary element controiling a-globin gene expression.

The two human globin gene complexes each consist of a of genes that are arranged on the chromosome in the order of their expression during development. The a-globin gene complex on chromosome 16 consists of the functional genes 5'-(2-a2-al-3'; the P-globin gene complex on chromosome 11 includes the genes 5'-E-G'y_A-y-b-P-Y. They provide good models for the study of the regulatory mechanisms responsible for tissue-specific and developmental activation of an entire group of genes, which ultimately must be due to the binding of trans-acting protein factors to cis-regulatory elements (for a review, see reference 44). The promoters and local enhancers of many of the ,-like globin genes have been characterized (for a review, see reference 44) and appear to contain much of the information required for their regulation. For example, isolated -y- and 3-globin genes are expressed in a tissue-specific manner and are developmentally regulated in transgenic mice (24, 28, 48). On their own, however, these local control sequences support only a very low level of expression, and it was surmised that this was due to position effects resulting from the absence of the primary control sequences. A group of erythroid-specific DNase I hypersensitive sites (HS) were discovered in a region upstream of the complex (13, 50), and it was demonstrated that inclusion of this region (the locus control region [LCR], previously termed the dominant control region [16], or locus-activating region [12, 41]) supported the high-level, tissue-specific, position-independent expression of the P-globin gene in transgenic mice and erythroid cell lines (2, 3, 5, 7, 45, 51). The two human globin gene complexes are coordinately regulated, and the simplest prediction would be that the control of the a-globin gene complex should therefore be similar to that of the ,B-globin complex, but it has been far from clear that this is the case. The a-globin gene and its promoter show significant structural differences from genes within the P-globin cluster (such as GC-richness, the possession of CpG islands, the lack of replication-transcription coupling, and the lack of scaffold-associated regions [for a

review, see reference 19]), and functionally it behaves very differently-notably in the lack of expression exhibited by the isolated gene in transgenic mice (17, 36, 42). This has led to suggestions that the mode of regulation of the a-globin genes may be different from that of the 3-globin genes (4; for a review, see reference 19). However, in a comprehensive search upstream of the a-globin gene complex, we have recently mapped a number of erythroid-specific hypersensitive sites resembling those of the ,B-globin complex LCR (Fig. 1) (19). Inclusion of part of this upstream region in recombinants allowed high-level, tissue-specific expression of the a-globin gene, and thus there appeared to be at least part of a functional counterpart of the P LCR. That this region contained bona fide regulatory element(s) of the a-globin complex was supported by its loss in a number of upstream deletion mutations that give rise to ot-thalassemia but leave the a-globin genes intact (18, 26, 54) (Fig. 1). The further characterization of this primary regulatory region is of obvious interest as a prelude to elucidating the mechanism of control of the a-globin genes and establishing whether the functional similarity between the a- and ,B-globin gene control elements is reflected in their structure. The major activity of the upstream region was traced to a 10-kb BglII fragment (19) 37 to 47 kb upstream of the (2-globin mRNA cap site. We report here an account of the detailed localization of this activity to a 350-bp element and the analysis of the in vitro binding of nuclear protein factors to this element.

group

MATERIALS AND METHODS

Construction of recombinant plasmids. For the neor-activation assay (see Results), test fragments were inserted, after filling in with Klenow enzyme, into the HincII site of pMClneo(polyA) (47), 3' of the neomycin resistance gene (neor) (the pMC series of recombinants). Before transfection, recombinants were linearized at the BamHI site between the neor gene and the insert, such that the component parts were in the order of 5'-test fragment-vector-neor-3'. For testing the activation of a-globin gene expression, certain fragments were also inserted into the plasmid pXAJa. This plasmid consists of a 3.7-kb BgIII-EcoRI fragment, which contains the human al-globin gene, inserted into the

* Corresponding author. t Present address: Howard Hughes Medical Institute, University of Califomia, San Francisco, Third and Parnassus Avenues, San Francisco, CA 94143.

4679

4680

JARMAN ET AL.

MOL. CELL. BIOL.

complex

position

previously described upstream deletion mutations (above) ated

with oi-thalassemia

(18,

26,

shown by the shaded region.

associ-

54) which give a minimum overlap

Deletion ( ;ux)T

is a truncation

healed

by telomeric sequences (54). Fragments previously shown to support high-level expression of a-globin in stable transformant assays (19)

are

shown below. Major erythroid-specific hypersensitive sites

indicated by

Previously described constitutive hypershown on this diagram. The 0-kb coordinate is taken as the mRNA cap and the

are

sensitive

positions

sites

are

not

C2-globin

shown

Xhol site [19]).

arrows.

(19)

of

are

the

distances

the vector

site,

in

pNXKN

kilobases

relative

from this

(which is

Test fragments were subsequently

point.

based on pSP64 inserted

into

the

BamHil site

upstream of the otl-globin gene after linker correct genomic orientation was miaintained in case. The joint fragment could then be excised with

addition; each

NotI, purified

from the vector

by

agarose

gel electrophoresis

and electroelution, and used in transfection experiments. Analysis of stable transformants. A detailed description of the techniques used given by Higgs et al. (19). In outline, mouse erythroleukemia (MEL) cells transfected by electroporation (375 V and 1,000 puF) with linearized pMC constructs, and stable transformants were selected with G418; or adenine phosphoribosyltransferase deficient (APRT-) MEL cells were cotransfected with the fragments from pXAJa plasmids and a fragment containing the hamster APRT gene (27) in a 10:1 ratio. Detection and quantitation of human and mouse oa-globin mRNA was by RNase protection analysis; estimation of transfected gene copy number was by Southern blot analysis. DNA sequencing. Fragments were subcloned into pUC13 and sequenced by the chain termination method by using M13 forward and reverse primers and the Sequenase protocol (US Biochemicals). Both DNA strands were sequenced. DNase I HS mapping. The isolation of nuclei, digestion with DNase I, and Southern blot analysis are based on the method of Weintraub and Groudine (53), detailed by Higgs et al. (19). Nuclear protein extracts. Extracts were prepared in accordance with the protocol of Dignam et al. (10), with the modification that the final dialysis step was replaced by desalting through a G-25 column (PD-10; Pharmacia) preequilibrated with buffer D (20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid [HEPES]-NaOH [pH 7.9], 50 mM KCl, 0.2 mM EDTA-NaOH [pH 7.9], 0.5 mM dithiothreitol, 20% glycerol). For some extracts, the proteins were precipitated by the addition of 0.35 g of (NH4)2SO4 per ml; after 30 min on ice, the precipitate was collected by centrifugation (25,000 x g for 30 min) and redissolved in buffer D. All buffers contained 0.5 mM phenylmethylsulfonyl fluoride and 1 ng of aprotinin per ml and usually also included 0.5 ng of leupeptin and 0.7 ng of pepstatin A (all from Sigma Chemical Co.) per ml. DNase I footprint analysis. The technique used is based on was

were

that of Angel et al. (1) and Jackson et al. (20). The reaction was carried out in a 50-,ul total volume, which included 0 to 25 RI of protein extract (0 to 50 jig), 1 jig of poly[(dIdC) (dI-dC)] (Pharmacia), 10 ,uM MgCl2, 2% polyvinyl alcohol (Sigma), and a final concentration of 0.5x buffer D. The reaction mixtures were incubated on ice for 5 min before the addition of 0.1 to 1 ng of 32P-end labeled DNA probe (104 cpm). Binding was allowed to proceed on ice for 20 min, and then DNase I digestion and isolation of DNAs was performed as previously described (20). Samples were electrophoresed on denaturing S to 8% polyacrylamide gels. EMSA. The electrophoretic mobility shift assay (EMSA) assay used closely followed the conditions of the footprint analysis. A 15-pI binding reaction mixture was set up as for the footprinting, except that 0.02% Nonidet P-40 was included in place of the polyvinyl alcohol, and the amount of poly[(dI-dC) (dI-dC)] was increased to 2.5 jig. After a 5-min preincubation on ice, 104 cpm of labeled oligonucleotide probe (0.1 to 0.5 ng) was added, and binding was carried out at room temperature for 10 min. Samples were loaded directly onto prerun native 4% polyacrylamide gels (30:1 acrylamide:bisacrylamide) and electrophoresed at 10 V/cm at 4°C in 0.25x TBE (45 mM Tris-borate, 1 mM EDTA [pH

8.0]). Oligonucleotides. Oligonucleotides were synthesized on an Applied Biosystems DNA synthesizer model 381A. Complementary pairs were annealed (9) and used as competitors directly. For oligonucleotides II through V, an extra 5' G residue was included to allow labeling with Klenow enzyme (Boehringer) and [a-32P]dCTP (Amersham International). Labeled double-stranded oligonucleotides were purified by electrophoresis on a native 6% polyacrylamide gel and elution. When necessary, other oligonucleotides were labeled by using T4 polynucleotide kinase and [_y-32P]ATP. Oligonucleotides are shown in Fig. 5 and in the legend to Fig. 7b. Others are as follows: collagenase AP-1 (25) (Stratagene), CTAGTGATGAGTCAGCCGGATC; PBG-D AP-1 (31), GCCTCCAGTGACTCAGCACAGGTTCCCCAG; Spl (22) (Stratagene), GATCGATCGGGGCGGGGCGATC; GA TA-1 (P-globin enhancer site D [52]), AGGGACATIAIAAG GGAGCCAGCAGAC; and the CAC box (P-globin promoter [9]), GAGCCTCACCCTGTGGAGCCACACCCTAGT. RESULTS Localization of regulatory sequence by activation of a neomycin resistance gene (neor). Figure 1 shows the location of the expression construct pa7.34, which is able to support high-level inducible expression of ot-globin in stable transformants of MEL cells (19). It is part of the region defined by the upstream deletion mutants as containing important regulatory elements and also includes one of the two erythroidspecific HS in this area (at -40 kb). During the production of the stable transformants, it was noticed that the presence of the element significantly enhanced the efficiency of transformation, such that more colonies were obtained with a cosmid (cNFG-CL9) that included the element than with other cosmids (pCL9 and cRN24a) (19). A similar effect has been previously noted when a ,-globin LCR element (PHS2) is linked to a neor gene (32). By analogy, it seemed likely that the effect observed here was due to the ability of the upstream regulatory element of the ax-globin cluster to activate the linked neor gene to a level which allows cell survival in the presence of G418. We have used this effect as a rapid assay for the localization of the regulatory element as follows. Fragments from the region of the element were

VOL . 1 l,

MAJOR REGULATORY ELEMENT OF THE a-GLOBIN CLUSTER

1991

a -45

H

-40

H

B

H

E

E

B

pM%C-HdlI I~~

pt4C-Hdl ~~~

~

-uc-is

pUC-IA4

I

s-

pMC- aHp

pMC-Hp

-l m

pMC-Ac

pMC-TX pMC-XH

b Relative effidiency

pMC-Hdl 1-4 pMC-Hd2 1-4 pMC-Hd3 pMC-l.l pMC-1.5

pMC-lA

..H

pMC- a&p pMC-Hp

pMC-Ac pMC-TX

pMC-XH

-I

pMClneo(polyA)

FIG. 2. Fragments used in the neor activation assays. Each fragment was inserted into the neor gene-containing vector pMClneo(polyA). Fragments that generated increased colony numbers are shaded. Construct pa7.34 is shown for comparison. Restriction sites: H, HindlIl; E, EcoRI; B, BglIl. (b) Transfection efficiency relative to pMC-Hd3 is shown. Each bar represents an average of three experiments (two for pMC-Hdl and pMC-Hd2), with the standard errors of the mean indicated. Absolute efficiencies were 14.7 colonies/107 cells per 16 ,ug (pMC-Hd3) compared with 0.3 colonies/107 cells per 8 ,ug for pMClneo(polyA) (note that amounts of each recombinant used for transfection were adjusted to give equal molarities). Given the standard errors in these experiments, the apparently higher colony number obtained with pMC-TX is probably not significant.

inserted into the plasmid pMClneo(polyA) (47), which contains a neor gene driven off a herpes simplex virus thymidine kinase (TK) promoter. The gene has a mutation that reduces the activity of its product (55), and the plasmid transforms MEL cells with very low efficiencies on its own. Recombinant plasmids containing fragments to be tested were linearized and transfected into semiadherent MEL cells, and after selection with G418, the numbers of resistant colonies were counted. In the first round of sublocalization, three HindIII fragments spanning the 10-kb BglII active fragment were subcloned into pMClneo(polyA) to give pMC-Hdl, pMC-Hd2, and pMC-Hd3 and were tested in this assay (Fig. 2). Two of these showed transformation efficiencies that were no higher than the pMClneo(polyA) plasmid itself (Fig. 2), but pMCHd3 gave consistently higher levels (30-fold higher on the average), provisionally localizing the element to this 4.0-kb region. It is noteworthy that this stimulation is observed despite the uninduced state of the MEL cells. That this increase of colony numbers was a measure of the ability to enhance a-globin gene expression was confirmed by analysis of the same three fragments attached to an a-globin gene (see below).

4681

The neor-activation assay was used for further rounds of sublocalization. The insert of pMC-Hd3 was subdivided by using EcoRI to give three fragments of 1.1-, 1.5-, and 1.4-kb, which were subcloned into pMClneo(polyA) to give pMC1.1, pMC-1.5, and pMC-1.4, respectively. Of these, the ability to activate neor localized to pMC-1.4, the remaining two fragments showing no effect above background levels (Fig. 2). Consistent with this, when a 1.1-kb HpaI fragment (contained within pMC-1.4) was deleted from pMC-Hd3 (to give pMC-AHp) the activity of this fragment dropped to background levels; conversely, the HpaI fragment itself retained the activity (pMC-Hp, Fig. 2). Manipulation of the 1.4-kb EcoRI-HindIII fragment allowed further localization, first to a 900-bp EcoRI-AccI fragment (in pMC-Ac) and finally to a 350-bp TaqI-XmnI fragment (pMC-TX, Fig. 2). The adjacent XmnI-HindIII fragment (pMC-XH) showed no activity. Within the levels of accuracy allowed by the neor-activation assay, it appeared that the entire activity of the Hd-3 fragment could be accounted for by the 350-bp fragment in pMC-TX. Confirmation of ability to activate a-globin expression. Initially, to check the result of the neor-activation assay, the three Hindlll fragments were also directly assayed for their ability to activate expression from a human a-globin gene. The fragments were each inserted into the plasmid pXAJa upstream of a human al-globin gene (see Materials and Methods) to give pXAJa-Hdl, pXAJa-Hd2, and pXAJaHd3; the recombinant fragments were then isolated and cotransfected into MEL cells. Pools of APRT+ stable transformants were induced with hexamethylene-bis-acetamide (HMBA) and analyzed for levels of human and mouse a-globin mRNA. Of the recombinants, only pXAJa-Hd3 was able to support a high level of human a-globin mRNA expression, and this appeared to be approximately equivalent to the level given by the previously identified BglII fragment (Table 1 and Fig. 3a). This confirmed the localization of the active element and validated the neor-activation assay. The 1.4-kb EcoRI-HindIII and 350-bp TaqI-XmnI fragments were also analyzed in the same way (as plasmids pXAJa-1.4 and pXAJa-TX, respectively). Table 1 and Fig. 3b show that these fragments retain the ability to activate the a-globin gene. Expression of the human a-globin gene in the pXAJa-1.4 construct was inducible (Fig. 3c), although we have noted that the degree of inducibility varies from one experiment to another, with expression of the human a-globin gene often preceding that of the endogenous mouse a-globin gene during induction. There is some relationship between the estimated gene copy number and the level of

expression (for example, see Fig. 3b); however, as previously noted (19, 33), strict copy number dependence cannot be assessed in pools of stable trahsformants. These active fragments correspond approximately to the position of an erythroid-specific HS (HS -40) located 40 kb upstream of the 42-globin mRNA cap site. A second erythroid-specific HS (HS -33) is also present in the region of overlap of the deletion mutants (Fig. 1). Although this was present in the original cosmid construct cNFG-CL9, fine localization (not shown) has shown that this was not analyzed previously by the plasmid expression constructs reported in reference 19. In the event that HS -33 may also be associated with an important activator element, we have tested this region as 4.3-kb HincII and 2.5-kb BglIH fragments in pXAJa (to give pXAJca-Hc-33 and pXAJa-Bg2.5, respectively). In MEL cell stable transformants, it was

4682

JARMAN ET AL.

MOL. CELL. BIOL.

TABLE 1. a-Globin expression in stable transformants containing plasmid constructs Fragment studied

pa7.34 pXAJa-Bg2.5 pXAJa-Hc-33 pXAJa-Hdl pXAJa-Hd2 pXAJa-Hd3 pXAJa-1.4 pXAJot-TX a

Avg pool size (range)

8 4 9 5 10 8 11 21

(1-32) (2-7) (1-21) (3-7) (4-18) (3-17) (3-40) (9-44)

No. of pools studied

Avg no. of gene

9 6 4 4 7 12 19 10

28 (1-100) 2 (1-4) 2 (2-4) 2 (1-4) 14 (4-32) 4 (1-32) 11 (1-32) 2 (1-2)

copies per

cell

(range)

Avg expression (%) of ah/am

mRNA

(range)a

31(1-73) 0 0 0 0 19 (4-72) 13 (3-29) 12 (3-23)

Avg expression (%) of ah/ am mRNA

per gene copy

(range)a

13 0 0 0 0 27 16 30

(1-50)

(8-69) (3-46) (11-61)

ah, human a-globin; am, mouse a-globin.

found that neither fragment gave detectable enhancement of a-globin gene expression (Table 1). Fine mapping of the erythroid-specific DNase I hypersensitive site (HS -40). The major erythroid-specific HS -40 had been previously mapped between the EcoRI and HindlIl sites in the region of coordinate -40 (19). It seemed likely that this HS was associated with the binding of nuclear proteins to the regulatory element; therefore, we have mapped the site in more detail. For the DNase I mapping, we used a stably transformed MEL cell line containing multiple copies of the element in cNFG-CL9, in which we have previously shown that the erythroid-specific HSs are reformed. DNA samples from a DNase I time course were limit digested with Hindlll and with EcoRI and HindIII, electrophoresed in a 1.6% agarose gel, and Southern blotted. Probing with the 1.4-kb EcoRI-HindIII fragment (RA1.4) demonstrates a broad subband of 840 to 1,150 bp (Fig. 4). This same subband was also observed in a HindIll digest probed with RA1.4 (Fig. 4), locating the HS this distance upstream of the HindlIl site. The 350-bp fragment that was active in expression assays is 845 to 1,191 bp upstream of this restriction site, and thus the hypersensitive area coincides very well with the active TaqI-XmnI fragment. Analysis of the 350-bp TaqI-XmnI fragment. The sequence of the 1.4-kb EcoRI-HindIII fragment was determined. Analysis revealed a cluster of nine potential nuclear proteinbinding sites (Fig. 5) in a region coinciding with the TaqIXmnI fragment. Particularly significant is the presence of multiple GATA-1 (previously known as NF-E1 [52], GF-1 [49], or Eryfl [11]) sites and a pair of AP-1 sites. In vitro footprinting analysis. DNase I footprinting of the TaqI-XmnI fragment was carried out to examine the binding of nuclear protein factors to these sites (Fig. 5 and 6). When the footprinting was performed in the presence of nuclear protein extracts from human erythroleukemia (HEL) cells, five distinct areas of protection were observed (FP-I to -V). The same footprints were observed with MEL nuclear protein extracts. With HeLa extracts, however, only two areas showed protection, corresponding to the 3' half of FP-II [i.e., FP-II(b)] and FP-III. The four MEL/HEL-specific protections, FP-I, FP-II(a), FP-IV, and FP-V, coincide with consensus binding sites for the erythroid nuclear factor GATA-1, and indeed an excess of a unlabeled oligonucleotide corresponding to a confirmed GATA-1 site from the 3' enhancer of the human ,B-globin gene (52) competes effectively with these sites. In some cases, strong hypersensitive sites were observed around the borders of the protein-DNA interactions, a common characteristic of GATA-1 binding (for examples, see references 9 and 52).

Both FP-II and FP-III appear to consist of two adjacent, separable binding components. FP-II(a), which is specific to MEL and HEL extracts, contains a GATA-1-binding site consensus sequence and competition with the ,-globin GATA-1 oligonucleotide removes this footprint. The remainder of FP-II [i.e., II(b)] and FP-III(a) are seen with all extracts; they both coincide with perfect consensus-binding sites for the activating protein AP-1 (1, 25, 30) and both disappear on competition with oligonucleotides of the AP-1binding sites from both the collagenase (1) and porphobilinogen deaminase (PBG-D [31]) gene promoters. These two AP-1-binding sites thus exist as an inverted repeat separated by 26 bp. FP-III(b) is rather variable. It appears to be due to the binding of a factor(s) to the G-rich area that resembles a CAC box. It is generally found in all extracts (although to a variable extent; e.g., it is missing in one HeLa extract (Fig. 6b), and it is only weakly affected by an oligonucleotide corresponding to an Spl-binding site (22) and by one containing the CAC box from the ,B-globin gene promoter (9). Competition is much greater when an oligonucleotide to the region itself is used as the competitor, suggesting the binding of a unique factor. Two other CAC box-like sequences are present but do not appear to bind proteins in vitro (Fig. 6). Electrophoretic mobility shift analysis. Oligonucleotides spanning each of the five protected regions were synthesized for use in electrophoretic mobility shift assays (Fig. 5 and 7). These have largely confirmed the conclusions obtained from footprinting. With MEL and HEL nuclear extracts, oligonucleotides I, IV, and V each exhibit a single major shifted band that corresponds to GATA-1; the P-globin 3' enhancer oligonucleotide can compete with the formation of the complex, and oligonucleotides IV and V themselves crosscompete for the formation of the complex. An adjacent CAC box-like sequence was included in oligonucleotide IV to test whether CAC box protein binding that might have been missed by the less sensitive technique of footprinting could be detected. In all extracts, however, only very minor bands were visible and these appeared to be nonspecific, since the CAC box, Spl, and FP-IV oligonucleotides did not compete with them. Oligonucleotide II exhibits a number of shifted complexes. The erythroid-specific complex 11-2 corresponds to GATA-1 binding. It comigrates with the major shifts given with oligonucleotides IV and V, and these sequences, as well as the ,-globin 3' enhancer sequence, compete with it. The intensity of this shifted band is invariably less than those observed with IV and V. Complex II-4 appears the same in all extracts and probably represents the binding of ubiquitous proteins of the AP-1 family (such as jun or fos). The

MAJOR REGULATORY ELEMENT OF THE a-GLOBIN CLUSTER

VOL. 11, 1991

a

I1

HI

B

E

H

E

B

4683

if

pEx 7.34

______---I pxAJ -Hd3

pxAjc:x-Hd2

pxAJ c-Hdl

a

Hd2

Hd3 Hdl Il 11

M R C II

-

M -

ac h

C

R C

M

2

1 _-

a*--**SOwgo 8

4

2

'

I

I

3 -

4

+ -4-

6

5 +

-

+

-

+

c m

---

ca

32 16

+

N

_

_

W

_

ll

4~~~~4

cah

o -a l dmaa

c

m epo

b -45

-35

-40

if

B

E

E

|I

---

H

= ] pxAJci-l.4

I

aJ

pxAJ c-TX

TX

Hd3

MRCI

1.4

MRC

MRCI

to

"

A&

Hi

pxAJcx-Hd3

I---

dw

B

.1

-

".

lip-

M

Wm

.*.i

4

-.

--

m

4--am

k

16

4 2

ahm

~w

4-

.0

-

a

so

8

64 32

128

":

FIG. 3. (a) Analysis of stable transformants containing fragments from the recombinants pXAJa-Hdl, pXAJcc-Hd2, and pXAJa-Hd3. The extent of the previously described fragment from pa7.34 (19) is shown for comparison; shaded boxes indicate fragments that produced high levels of a-globin mRNA expression. Restriction sites: B, BglII; E, EcoRI; H, Hindlll. Middle, RNase protection assay on 4 pools of stable transformants containing each of the Hdl, Hd2, and Hd3 fragments. All pools were induced with HMBA prior to analysis. axh and am indicate the positions of protected fragments representing human and mouse a-globin mRNA, respectively. Controls of RNA from MEL cells (M), human reticulocytes (R), and a previously characterized stable transformant (28-2) containing the cosmid cNFG-CL9 (19) (C) are shown. Bottom, estimates of gene copy number in each pool of stable transformants were obtained by comparison with a set of standard DNAs as previously described (19); ah and m epo represent the bands corresponding to the human a-globin gene and the mouse erythropoietin gene. (b) RNase protection analysis of stable transformants containing fragments from the recombinants pXAJaL-Hd3, pXAJa-1.4, and pXAJaL-TX. Controls and annotations are as for Fig. 3a. (c) RNase protection analysis of stable transformants containing a fragment from the recombinant pXAJa-1.4. The results from uninduced (-) and induced (+) pools are shown. Controls and annotations are as for Fig. 3a.

collagenase and PBG-D AP-1 oligonucleotides, as well as oligonucleotide III, compete for the formation of this complex. A second shift with which AP-1 could compete was observed with HEL extracts (II-3) and corresponded approximately to the migration position expected for the factor NF-E2. This factor has been reported by some groups (30, 46) to be present in all erythroid nuclear extracts; however,

have yet to detect it in our MEL nuclear extracts (presumably its isolation conditions are not yet properly defined). Two other complexes (II-1 and II-5) exist in all extracts but are presently unexplained, since there appears to be no footprint corresponding to factors other than AP-1 and GATA-1 (e.g., Fig. 6). As may be predicted, oligonucleotide III also forms the we

r0

MOL. CELL. BIOL.

JARMAN ET AL.

4684 2

5

10

15

30

50

3

2

5

10

20

50

FP-I

r,

23.1