G Model
ARTICLE IN PRESS
VIRUS 96410 1–7
Virus Research xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Characterization of the cytopathic BVDV strains isolated from 13 mucosal disease cases arising in a cattle herd
1
2
3 4 5 6 7
Q1
Mahmoud F. Darweesh a , Mrigendra K.S. Rajput a , Lyle J. Braun a , Julia F. Ridpath b , John D. Neill b , Christopher C.L. Chase a,∗ a
Department of Veterinary and Biomedical Sciences, SDSU, Brookings, SD 570076, USA Ruminant Diseases and Immunology Research Unit, National Animal Disease Center, Agricultural Research Service, United States Department of Agriculture, Ames, IA 50010, USA b
8
9 25
a r t i c l e
i n f o
a b s t r a c t
10 11 12 13 14 15 16
Article history: Received 29 May 2014 Received in revised form 25 September 2014 Accepted 29 September 2014 Available online xxx
17
24
Keywords: Bovine viral diarrhea virus Mucosal disease RNA recombination DnaJ Cytopathogenicity Insertion
26
1. Introduction
18 19 20 21 22 23
27 28 29 30 31 32
Bovine viral diarrhea virus (BVDV) is a positive single stranded RNA virus belonging to the Pestivirus genus of the Flaviviridae family. BVDV has a wide host range that includes most ruminants. Noncytopathic (ncp) BVDV may establish lifelong persistent infections in calves following infection of the fetus between 40 and 120 days of gestation. Cytopathic (cp) BVDV strains arise from ncp strains via mutations. The most common cp mutations are insertions of RNA derived from either host or a duplication of viral sequences into the region of the genome coding for the NS2/3 protein. Superinfection of a persistently infected animal with a cp virus can give rise to mucosal disease, a condition that is invariably fatal. A herd of 136 bred 3-year old cows was studied. These cows gave birth to 36 PI animals of which 13 succumbed to mucosal disease. In this study, we characterized the ncp and cp viruses isolated from these 13 animals. All viruses belonged to the BVDV type 2a genotype and were highly similar. All the cp viruses contained an insertion in the NS2/3 coding region consisting of the sequences derived from the transcript encoding a DnaJ protein named Jiv90. Comparison of the inserted DnaJ regions along with the flanking viral sequences in the insertion 3 end of the 13 cp isolates revealed sequence identities ranging from 96% to 99% with common borders. This suggested that one animal likely developed a cp virus that then progressively spread to the other 12 animals. Interestingly, when the inserted mammalian gene replicated within viral genome, it showed conservation of the same conserved motifs between the different species, which may indicate a role for these motifs in the insertion function within the virus genome. This is the first characterization of multiple cp bovine viral diarrhea virus isolates that spread in a herd under natural conditions. © 2014 Published by Elsevier B.V.
The family Flaviviridae is composed of four different genera Pestivirus, Flavivirus, Hepacivirus and Pegivirus (Adams et al., 2013). The genus Pestivirus contains 4 species: bovine viral diarrhea virus type 1 and type 2 (BVDV-1; BVDV-2), classical swine fever virus (CSFV), and border disease virus (BDV) (Fauquet et al., 2005). The virions are 40–60 nm in diameter, spherical in shape, and contain a
∗ Corresponding author at: Department of Veterinary and Biomedical Sciences, PO Box 2175, ADR Rm. 125, N Campus Dr. South Dakota State University, Brookings, SD 57007, USA. Tel.: +1 605 688 5652; fax: +1 605 688 6003. E-mail addresses: Mahmoud f
[email protected] (M.F. Darweesh),
[email protected] (M.K.S. Rajput),
[email protected] (L.J. Braun),
[email protected] (J.F. Ridpath),
[email protected] (J.D. Neill),
[email protected] (C.C.L. Chase).
lipid envelope. The capsid is composed of a single protein and the envelope contains two or three virus-encoded membrane proteins. The genomes are positive sense ssRNA of approximately 11, 12.3, 9.6 and 9.6 kilobases (kb) for members of the genera Flavivirus, Pestivirus, Hepacivirus, and Pegivirus respectively (Erker et al., 1998; King et al., 2011). The Pestivirus genome is composed of a positive sense single stranded RNA that is approximately 12.3 kb. The genome contains a single open reading frame (ORF) flanked by 5 and 3 two untranslated regions (UTR) (Collett et al., 1988). The open reading frame encodes one polyprotein composed of 3900 amino acids, which is co- and post-translationally processed by cellular and viral proteases, leading to twelve different viral proteins (Thiel et al., 2005). One of these proteins, nonstructural protein 2 (NS2), is a cysteine autoprotease that is responsible for the cleavage of the NS2 from NS3 (Lackner et al., 2004). Nonstructural protein 3 (NS3) has many functions including serine protease, helicase and NTPase and is necessary for virus replication (Yamane
http://dx.doi.org/10.1016/j.virusres.2014.09.015 0168-1702/© 2014 Published by Elsevier B.V.
Please cite this article in press as: Darweesh, M.F., et al., Characterization of the cytopathic BVDV strains isolated from 13 mucosal disease cases arising in a cattle herd. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.09.015
33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49
G Model VIRUS 96410 1–7
ARTICLE IN PRESS M.F. Darweesh et al. / Virus Research xxx (2014) xxx–xxx
2
et al., 2009). Uncleaved NS2-3 plays a role in virion morphogenesis (Agapov et al., 2004). The process of cleaving the NS2-3 plays an important role in Pestivirus biology especially BVDV (Quadros 52 et al., 2006; Becher and Tautz, 2011). Nonstructural protein 3 (NS3), 53 NS4A, NS4B, NS5A, and NS5B are involved in BVDV replication 54 55Q2 machinery (Behrens et al., 1998; Becher et al., 2001). The ability to cleave the NS2-3 efficiently divides BVDV into two biotypes that 56 differ in their effect in cell culture. Cells infected with cytopathic 57 (cp) viruses develop cytopathological changes including cytoplas58 mic vacuolization and cell death through apoptosis. More of the 59 NS3 product is formed by cp BVDV while very little NS3 cleavage 60 product is formed by noncytopathic (ncp) BVDV infection (Lackner 61 et al., 2004) and there are no cytopathological changes in ncp BVDV 62 infected cultured cells (Donis and Dubovi, 1987). 63 When ncp BVDV infects the fetus during the first 40–120 days 64 of gestation, the fetus may be born persistently infected (PI). The PI 65 calf is immunotolerant to the infecting BVDV strain and sheds this 66 strain of BVDV at for its entire life. Persistently infected (PI) cat67 tle may develop a fatal disease called mucosal disease (MD). A cp 68 BVDV can be isolated from MD animals in addition to the ncp virus 69 with which it is persistently infected. Analysis of the cp and ncp 70 BVDV isolated from MD cases indicated that often the cp BVDV is 71 derived from the PI ncp BVDV by RNA mutational changes (Meyers 72 and Thiel, 1996). Occasional the ncp-cp pair may not be antigeni73 cally similar (Howard et al., 1987; Corapi et al., 1988; Ridpath et al., 74 1991). The molecular analysis of the MD cp virus has demonstrated 75 a wide spectrum of mutational changes that occur to the RNA back76 bone of the original PI ncp virus. These changes include deletions 77 and duplications of viral sequences as well as insertions of viral and 78 cellular protein-coding sequences (Meyers et al., 1992; Meyers and 79 Thiel, 1996; Fricke et al., 2004). Most of these genomic alterations 80 take place because of nonhomologous RNA recombination events 81 (Becher and Tautz, 2011). All the host-derived insertions originated 82 from protein-coding cellular mRNAs. One of the most common 83 insertions is ubiquitin mRNA coding sequence (Meyers et al., 1991; 84 Qi et al., 1992; Tautz et al., 1993; Becher et al., 1999). Studies of 85 BVDV type I revealed cellular insertions including sequences cod86 ing for S27a-ubiquitin fusion ribosomal protein (Becher et al., 1998; 87 Becher et al., 2001) and ubiquitin-like proteins (SMT3B, NEDD8)(Qi 88 et al., 1998; Baroth et al., 2000) and proteins with ubiquitin89 like folding domains including light chain 3 (LC3) (Fricke et al., 90 2004), GABA(A)-RAP and GATE-16 (Becher et al., 2002). Another 91 common cellular insertion is J-domain protein, a member of the 92 DnaJ-chaperone family. This protein has been named Jiv [J-domain 93 protein interacting with viral protein (Jiv)] and interacts with BVDV 94 NS2 protein (Rinck et al., 2001). These BVDV RNA recombination 95 events result in a more efficient cleavage of the NS2/3 protein. 96 In this study, the viruses isolated from 13 mucosal disease cases 97 occurring in a single herd were investigated. The molecular changes 98 in the cp virus in each animal were characterized to answer three 99 important questions: (1) what type of nucleotide change took place 100 in the PI ncp BVDV to generate the cp virus? (2) Did this change 101 take place in one animal and spread to the rest of the animals or 102 did each PI animal that died acutely generate its own cp BVDV?; 103 and (3) what changes were observed in ncp viruses isolated from 104 the same animals within the NS3 region corresponding to the 3 105 sequences flanking the insertions in cp isolates compared to the 106 same region of the cp viruses isolated from their PI calves? 107 50 51
108
2. Materials and methods
109
2.1. Animals
110 111
In the fall of 2003, 136 bred Angus, Angus-cross 3-year-old cows were purchased from a cattle operation in western South Dakota
and moved to a field station in northwestern SD. Beginning in the spring and summer of 2004, losses were seen in this herd including 8 early embryonic deaths (EED) or abortions (no fetuses were recovered) from 8 animals that had previously been diagnosed as pregnant but did not calve and the birth of 8 weak calves that died in the first week of loss (many had evidence of congenital BVDV infection including corneal opacities, reduced birth weight, and reddish hair coat). At weaning time, 5 calves died and were BVDV ear notch positive. The remaining 115 calves were tested and 36 were determined to be BVDV PI by ear notch and virus isolation. BVDV infection of this herd was suspected to result in 43% (58/136) of the total calf herd being affected by BVDV infection (8 abortions, 8 weak calves, 5 PI calves died at weaning, 36 PI calves weaned). The 36 PI calves were transported 400 miles to a feedlot facility at South Dakota State University (SDSU), Brookings SD in September 2004 for further study. The SDSU Institutional Animal Care and Use Committee approved animal handling and blood collection methods. The first weaned PI calf did not die until it was 12 months of age in May of 2005. Calves died from mucosal disease between 368 and 491 days of age, with an average life span of 432 ±32 days. Within 3 months of the first death, 23 PI calves died, 2 PI calves were euthanized and 11 PI calves were sold for immediate slaughter to reduce the economic loss. Analysis of the cohorts, revealed that PI calves were not born in a cluster but births occurred throughout the entire 2004 calving season. Viruses were isolated from 21 of 23 animals that died. Two animals had extensive tissue autolysis at time of necropsy and no virus was recovered. The isolated viruses at necropsy were cpBVDV and/or ncpBVDV. Lesions observed at necropsy were also recorded. Lesions were detected in 17 of the 23 PI animals that died. No gross lesions were detected in six of the PI calves (26%) that died. Phylogenetic analysis of ncp revealed two clades of very similar viruses (sequence identity of 99% in the 5 UTR and 95% in the E2) (data not shown). All of the 13 calves from which a cp virus was isolated had lesions consistent with MD. 2.2. Cells and viruses BVDV-free Madin-Darby bovine kidney (MDBK) cells were purchased from American Type Culture Collection (ATCC). Cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% horse serum. Madin-Darby bovine kidney (MDBK) cells were used for virus culture and virus isolation through plaque purification. Cytopathic (cp) virus and ncp virus were isolated from tissue homogenate (liver and lung samples) from necropsied animals. Cytopathic (cp) viruses were isolated from 13 PI animals that died with symptoms consistent with mucosal disease over a 3-month period. These 13 cp BVDVs were plaque purified four times followed by cloning by limiting dilution. The ncp virus from tissue homogenate following isolation on MDBK was used for analysis. In addition ncp virus from blood samples from the PI animals collected in March 2005 was directly sequenced at the National Animal Disease Center (NADC), Ames, IA. 2.3. Plaque purification Madin-Darby bovine kidney (MDBK) cells were plated at 4 × 105 cells/well in a six-well plate and incubated at 37 ◦ C and 5.0% CO2 for 4 h. Two hundred l aliquots of 10-fold serial dilutions of tissue homogenate supernatant from MD animals were added and incubated for 1 h at 37 ◦ C and 5.0% CO2 . Supernatants were then removed and 2 ml of 0.5% low melting temperature agarose + 1× MEM growth overlay was added to each well. The overlay was prepared by diluting 5 ml of 5% low melting temperature agarose to 45 ml of 1× growth medium. Plates were incubated for 72–96 h until plaques were visible through the overlay. Plaques were picked by inserting the trimmed end of a micropipette tip through the
Please cite this article in press as: Darweesh, M.F., et al., Characterization of the cytopathic BVDV strains isolated from 13 mucosal disease cases arising in a cattle herd. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.09.015
112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145
146
147 148 149 150 151 152 153 154 155 156 157 158 159 160 161
162
163 164 165 166 167 168 169 170 171 172 173
G Model VIRUS 96410 1–7
ARTICLE IN PRESS M.F. Darweesh et al. / Virus Research xxx (2014) xxx–xxx
Table 1 Primer sequences used to generate PCR products in the NS2-3 region. 1F NS2 1R NS2 2F NS2 2R NS3
5 : GGACACCTTGGACACAACTGTAATCAGG 5 : CATCTGGCACCATCTGGGCATCCT 5 : ACTGCCCAAAGTGTGGTAGACAGG 5 : ACCAACCACCCTGCCACTGGATGC
178
overlay into the plaque. Isolated plaque was dissolved into 1 ml MEM media containing 10% FBS to obtain the virus. Plaque purified virus was then titrated. The isolates were individually identified as South Dakota Antelope Range Station (SDARS) with the animal number (i.e. SDARS 5Y).
179
2.4. RNA isolation
174 175 176 177
180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198
199 200
201 202 203 204 205 206 207 208 209 210 211 212 213 214
215 216 217 218 219 220 221 222 223 224 225
For the cp viruses, RNA was isolated from virus propagated in cell cultures following plaque purification. MDBK cells were cultured in 25 ml culture flasks. When cells were at 80% confluency, the cells were infected with 1 ml of 1 × 103 pfu plaque purified BVDV isolate and incubated at 37 ◦ C for 1 h. Virus inoculum was removed and the cells were washed 3 times with phosphate buffered saline (PBS) and then maintenance medium was added. Flasks were incubated at 37 ◦ C for 3–5 days then monolayer plus media was frozen at −80 C and thawed at room temperature for three cycles. The resulting lysates were then centrifuged at 1000 × g for 5 min at 4 ◦ C and supernatants were collected. To further concentrate virus, supernatants were ultra-centrifuged through a 5 ml, 20% sucrose cushion in an SW 28 Beckman rotor at 30,000 rpm for 2 h at 4 ◦ C. Viral pellets were suspended at 4 ◦ C in PBS for 30 min. Viral RNA from the suspended viral pellets was extracted using the QIAamp viral RNA mini kit (QIAGEN). For ncp viruses, the viral RNA was isolated directly from the initial isolation on MDBK cells or in buffy coats from the blood sample collected in March using the QIAamp viral RNA mini kit (QIAGEN). 2.5. First strand cDNA synthesis, polymerase chain reaction (PCR), and DNA sequencing Synthesis of cDNA from the viral RNA was carried out using SuperScript® III Cells Direct cDNA Synthesis Kit (Life Technologies) as per manufactures guidelines. The cDNA was then used as a template for the polymerase chain reaction (PCR). The polymerase enzyme was high fidelity polymerase (Phusion Hot Start II HighFidelity DNA Polymerase, Thermo) as per manufactures guidelines. The reaction mixture was 5 l of 10× Mg-free 10× PCR buffer, 1 l of 10 mM dNTP mixture, 1.5 l 50 mM MgCl2 , 1 l of sense primer, 1 l of anti-sense primer, 2 l of cDNA, 0.4 l Phusion Hot Start II High-Fidelity DNA Polymerase and water was added to a final volume of 50 l. The PCR conditions were 95 ◦ C for 15 min then 35 cycles of (94 ◦ C/20 s, 50 ◦ C/1 min and 72 ◦ C/1 min) followed by 72 ◦ C for 10 min. After PCR amplification, the PCR product was separated on 1% agarose gel to determine PCR product size. 2.5.1. Primers and oligonucleotides All the primers were designed according to the sequence generated from the ncp BVDV of the PI animals (Table 1; Fig. 1). The PCR strategy was designed to identify two different types of mutations in NS2-3 gene that have been reported in cp BVDV. The primers 1F and 1R were designed to detect insertions in the 3 end of the E2 to the 5 end of the NS2 gene (2894–4976) (Fig. 1A). To investigate insertions in the junction between NS2 and NS3, primers 2F and 2R were designed (Fig. 1B). This primer pair flanks the junction between NS2 and NS3 (4955–5686). In the absence of the insertion, the amplicons generated using this primer pair are approximately
3
Table 2 Comparison of the size Jiv insert in CP BVDV isolates. Cytopathic BVDV with Jiv insertion
Number of nucleotides of Jiv insertion
SDARs isolates BVDV2-296nc BVDV2-125c BVDV2-5912c BVDV2-6082c BVDV2-Galena 16425c BVDV2-ND 8799c BVDV2-OkSt BVDV2-SD1630c BVDV 296c Indiana KS86-1cp MD1 NADL Nose Type1 CP8
323 327 272 296 309 339 278 316 331 339 322 323 306 279 326 498
750 bp in length. If an insertion were present, larger amplicons would be generated. 2.5.2. Sequencing All amplicons generated using the 2F/2R primer set were gel purified (Qiagen gel purification kit) and sequenced at Retrogen Inc., San Diego, CA by the primer walking method using forward and reverse primers. The ncp BVDV were directly sequenced at NADC, Ames IA. For the purposes of comparison, the sequences were aligned using Clustal W multiple sequence alignment using BioEdit free software (Hall, 1999).
226 227
228 229 230 231 232 233 234 235
3. Results
236
3.1. PCR products, nucleotide sequencing and sequence analysis
237
3.1.1. PCR product analysis The PCR product generated with primers 1F and 1R produced a fragment of about 2000 bp in all of the 26 virus strains (13 cp and 13 ncp). The amplicons generated from the cp viruses were identical to the amplicons generated from the ncp viruses. No cellular insertions were noted in any amplicons generated from either cp or ncp viral samples using these primers (data not shown). The PCR reaction with the 2F and 2R primers that flanked the junction between NS2 and NS3 generated amplicons of