YEAST

VOL.

6: 429440 (1990)

Characterization of the Cytochrome c Gene from the Starch-Fermenting Yeast Schwanniomyces occidentalis and its Expression in Baker’s Yeast BERNARD Y. AMEGADZIE*f, RICHARD S. ZITOMER*$ A N D CORNELIS P. HOLLENBERGS *Department of Biological Sciences, State University of New York at Albany, Albany, New York 12222, U.S.A. Slnstitut fur Mikrobiologie, Heinrich-Heine-Universitat Dusseldorf, Universitatstrasse I , 0-4000 Dusseldorf I , Federal Republic of Germany

Received 26 September 1989; revised 26 February 1990

A cytochrome c protein gene, CYCl,, of the dextran- and starch-fermenting yeast, Schwanniomyces occidentalis was cloned and characterized. The DNA sequence was determined, and the predicted amino acid sequence of the proteincoding region shares close homologies to the cytochrome c genes. A S. occidentalis strain with a disruption of the gene revealed that CYCI, was the only functional cytochrome c protein-encoding gene in S. occidentalis, unlike the two cytochrome c protein genes (CYCl and CYC7) in Saccharomyces cerevisiae. The CYCI, gene was oxygen-induced but not subject to catabolite repression. The expression of the CYC1, gene was studied in the heterologous yeast S. cerevisiae. The oxygen induction of the gene was found to be identical to that of the C Y C l gene, indicating that these two genes share similar or closely related cis- and trans-acting oxygen regulatory elements. However, the C YCl ene was glucose repressed in S. cerevisiae 0. strains; a phenomenon which was not observed in the native S. occidentabscells. Search in the 5’ untranslated region of the C Y C l , gene revealed some homologies at -425 to -405 to UASl of the S. cerevisiae C Y C l gene. A deletion of a segment of upstream region including this sequence abolished expression in S. cerevisiae. Finally the phylogenetic relationships of different yeasts and fungi were determined based upon the amino acid sequences of the cytochrome c proteins. These relationships do not completely agree with classical divisions.

INTRODUCTION The baker’s yeast, Saccharomyces cerevisiae, has been extensively exploited for both basic research into gene expression and cell biology and industrial applications of the new biotechnology. The genetics of this simple eukaryote has a long history which has now been supplemented with high-powered molecular manipulations. In addition, over millennia of brewing experience has contributed a vast store of knowledge of large-scale fermentation processes. The success researchers have had with this yeast has encouraged further studies with other yeasts that allow exploitation of particular traits lacking in S. cerevisiae. Thus yeasts capable of growth on ?Present address: Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, N.I.H., Bethesda, Maryland 20892, U.S.A. $Correspondingauthor. 0749-503X/90/050429-12 $06.00 0 1990 by John Wiley & Sons Ltd

methanol or breakdown of starches, or possessing different polysaccharide modifications of secreted proteins have come under investigation. The development and application of molecular technology to a variety of yeast species has kindled our interest in the evolution of regulatory mechanisms. We wish to answer questions such as: how conserved are gene-specific regulatory transcription factors and the DNA binding sites with which they interact? and, in those cases where the habitat of one yeast is sufficiently different from that of another so as to obviate the need to regulate a specific gene or require that its expression responds to different signals, are the same regulatory mechanisms redirected or do new systems evolve? The cytochrome c protein genes represent an ideal system with which to answer these questions for a number of reasons. First, the expression of the two S. cerevisiae genes has been studied and the regulatory sequences and protein factors involved in oxygen induction and,

430 to a lesser extent, glucose repression have been identified (Sherman and Stewart, 1971; Zitomer and Hall, 1976; Zitomer et al., 1979; Rothstein and Sherman, 1980;GuarenteandMason, 1983;Lowryetal., 1983; Guarente et al., 1984; Laz et al., 1984; Lowry and Zitomer, 1984; Wright and Zitomer, 1984; Hahn et al., 1985; Lalonde et a / . , 1986; Verdiere et al., 1986; Pfeifer et al., 1987a,b; Zitomer et al., 1987; Cerdan and Zitomer, 1988;Cruesot et al., 1988). Second, we expect that the regulation of gene expression by oxygen and glucose will vary in different yeasts, such as between obligate and facultative aerobes or among species with less tolerance to ethanol or adapted to a low sugar environment. Third, thecytochromecprotein sequence has already been determined for a number of yeasts (Dayhoff et al., 1979), and this knowledge can be used to derive phylogenetic relationships which would help in choosing organisms for study. Fourth, the small size of the protein limits the extent of DNA sequence analysis required to deduce the protein sequence in those cases for which it is not known. Finally, it should be possible in many cases to clone cytochrome c genes by complementation. Russell and Hall (1982) demonstrated that the Schizosaccharomyces pombe gene, cloned by hybridization to a S. cerevisiae clone, was capable of complementing the cytochrome c deficiency of a S . cerevisiae mutant. Also, Clements et a / .(1989) found that a rat cytochrome c pseudogene, under the regulation of the S . cerevisiae C Y C l promoter, was capable of such complementation. Therefore, the high degree of conservation of the cytochrome c protein sequences plus the low level of cytochrome c expression required for respiration, make cloning by complementation feasible. In this context, we have initiated studies on the sequence, expression and regulation of the cytochrome c gene of the yeast Schwanniomyces occidentalis. This yeast possesses the ability, unlike S. cerevisiae, to ferment starch and dextrans (reviewed by Calleja et al., 1982; Wilson et al., 1982; McCann and Barnett, 1986), which has generated some industrial interest (Ingledew, 1987). This interest has spurred the development of a transformation system for this yeast (Dohmen et al., 1989), making our studies possible. We report here that this yeast contains a single functional cytochrome c gene. We have compared the deduced protein sequence with that of a number of other fungi and determined phylogenetic relationships. Also, we show that the expression of this gene is regulated by oxygen but not by glucose, yet is regulated by both oxygen and glucose in heterologous S . cerevisiae cells.

0. Y. AMEGADZIE ETAL.

MATERIALS AND METHODS Strains

The bacterial strain HBlOl (Boyer and RoullandDussoix, 1969)was used for all constructions except those involving MI3 vectors, in which case JMlOl (Messing, 1983) was used. The cytochrome c-deficient S . cerevisiae strains GM3C-2 (Faye et al., 1981) and AH12 (Healy et at., 1987) are congenic, differing only in that the former has a point mutation in the CYC7 gene, while the latter has a deletion. The S. occidentalis strains used were ATCC26076 (from the American Type Culture Catalogue) for the construction of the genomic library and NGA-23 (trp5,his-; Dohmen et al., 1989) for the construction of strain ARZ-1 by the integration of the S. cerevisiae TRP5 gene into the cytochrome c protein gene locus. Cellgrowth and transformation

HBlOl cells were transformed using the procedure of Hanahan (1983). JMlOl cells were grown and transformed using the procedures described by Messing (1983) and Yanisch-Perron et al. (1985). Media used included YP media (1 YOyeast extract, Difco; 2% Bacto-Peptone, Difco) containing 2% glucose (YPD), 2% raffinose (YPR), 3% glycerol (YPG), or 3% glycerol and 2% lactic acid (YPGL), and Cm-trp and Cm-leu (Zitomer and Hall, 1976). S. cerevisiae were transformed by the procedure of Hinnen et al. (1978) for the isolation of the cytochrome c protein gene, by the method of Ito et a / . (1983) for many experiments, and by the procedure of Klebe et al. (1 983) for others. All transformations of S . occidentalis were carried out using the procedure of Klebe et al. (1983). Plasmids and plasmid constructions

Large-scale (Elwell et at., 1975) and small-scale alkaline (Maniatis et al., 1982) plasmid preparations were carried out as described. Singlestranded DNA templates were prepared as described (Messing, 1983). Enzymatic procedures used for the construction and analyses of plasmids were carried out by the procedures recommended by the vendors. The following plasmids were used in this study: pBR322 (Bolivar et al., 1977), YRp7 (Struhl et al., 1979), YEp13 (Broach et al., 1979), pCDJ5-1, a S . occidentalis-transforming vector carrying the S . cerevisiae TRPS gene (Dohmen et al., 1989),and the

43 1

CYTOCHROME C GENE OF S. OCCIDENTALIS

H

AC

A

K A

Figure 1, The strategy for the sequence analysis of the CYCI, gene. The restriction map of the CYCI, gene is represented with the open box indicating the open reading frame for which translation would procede from left to right. The arrows below indicate individual sequence reactions. Reactions 1-5, 7, 8 and 11 were carried out with MI3 phage subclones from the indicated restriction site. Reactions 9 and 10were carried out using BAL3 1 deletions as described in the text. Reaction 6 was carried out using the oligonucleotide 5’-d(CTTTGTGTGGACC)-3’. The restriction sites are: A, AhuIII; Ac, AccI; B, BumHI; K , KpnI.

MI3 vectors mp18 and 19 (Yanisch-Perron et al., 1985). The following plasmids were constructed for the purpose of this study. The S. occidentalis genomic library The S. occidentalis genomic library was constructed by the insertion of restriction fragments generated by partial digestion with Sau3A into the BamHI site of YRp7. pSoCYC 1 pSoCYCl was constructed by insertion ofthe 1.7 kbBamHIfragmentfrom theYRp7library member containing the CYCI, gene, YRpCYCI,, into the BamHI site of pBR322. YCpSoCYCl was constructed by the insertion of the 1.7 kb BamHI site fragment from pSoCYCI into the BamHI site of YCp7 (a YRp7 derivative containing the 2 k b BamHI-BgZII CEN3 fragment [Clarke and Carbon, 19801inserted into the BamHI site). pSocycl ::TRPS The BamHI-BstEII fragment of pCDJ5-1 containing the TRPS gene made bluntended using the Klenow fragment of DNA polymerase I, and inserted into pSoCYCl linearized by digestion at the unique KpnI site within the CYCI, gene with the ends made blunt using T4 DNA polymerase. EcoRI linkers (pGGAATTCC, BoehringerMannheim) were included in the ligation reaction. YEpSoCYCIBH The 1.2 kb HindIII-BamHI fragment containing the CYCI, gene of YRpCYCZ, was inserted into Hind111 and BamHI sites of YEpl3.

YCpSoCYC1 (0.2) The gel-purified 1 kb BamHIAccI fragment containing the CYCI, gene from YCpSoCYC1 was made blunt-ended using the Klenow fragment of DNA polymerase I and inserted into BamHI-digested, blunt-ended YCp7 in the presence of BamHI linkers (pCCGGATCCGG, Boehringer-Mannheim). Sequence analyses Sequence reactions are indicated in Figure 1. The templates used were M 13 derivatives containing appropriate subclones of the CYCl, gene. The dideoxyribonucleotide chain-termination procedure of Sanger et al. (1977) was used initially for the DNA sequence analyses; later reactions were carried out using the Sequenase kit (U.S. Biochemicals) following the procedure recommended by the vendor. All reactions were carried out using single-stranded templates and either the universal M 13 primer (Boehringer-Mannheim and U.S. Biochemicals) or the oligo-deoxyribonucleotide 5’-CTTTGTGTGG ACC-3’ (purchased from the New York State Department of Health, Albany, N.Y.), which was complementary to the coding region from nucleotides 91 to 104 (see Figure 2). D N A and R N A blots

Southern (DNA) blot analysis was performed (Southern, 1975)with genomic DNA prepared from yeast (Struhl et al., 1979). Total cellular RNA was prepared from yeast cells and Northern (RNA)

432

B. Y. AMEGADZIE ET AL.

-520

-500

AAGCTTTATTTAT

ATCTGTTTTCTTCTCGCTCT

TCTGTCCACCTTT(XMCAA

-480 GCACCTAATAAAGTTGACTC

-460

-440

GGGTGCAAATTGTCTCTCCA

TAGGTTGTMGGMCCTGTC

-420 CGGTTAGATCCAGATTTTM

-400

-380

GGTATGGTCAMATTTTTCA

AGCCCGTMCAGGTtXMCT

-360

-340

-320

CTCGTTTGAGCAACTTCAAG

GAACCTTTAGCAGCACTCAA

ATCTCGAAGMAAGTATACT

-300

-280

-260

GATCTTGTAAAMAGTACM

CTTGCGTTCGGCCAGAAGCA

ATAGACGTATCTATACMCC

-240

-220

-200

AAATTCCTCACTTGAACATA

G A M G W T A G G A T

CAAGCCGTWAAMACGGTC

-180

CTGCATGTGGATTGGCCMT

- 160

-140

AAMTCGAGCTTGTTTAAM

TTATATCMGGGCTMTTTT

- 120

-100

-80

CCACATATATAAATMGAGT

TGCCGTATCCTAGAGATTCG

GTGAAATAGTTTTTTTCCTT

-60

-40

-20

TTTTTTTTTCATTATCGCTT

TTGAGTAGATATTTATATCA

ATACTMTTMTATTCGACA

15

30

45

ATG CCA GCT CCA TAC G M AAA GGA TCA G M AAG AM GAT GCT M C TTA TTC Met Pro Ala Pro Tyr Glu Lys G l y Ser Glu Lys Lyn Asp Ala Asn Leu Phe 60 75 90 AAG ACT AGA TGT TTA C M TGT CAC ACC GTC G M AAA GGT GGT CCA CAC AAA Lys Thr Arg Cys Leu Gln Cys His Thr Val Glu Lys Gly Gly Pro His Lys

105 120 135 150 GTT GGT CCA AAC TTA CAC GGT ATT TTT GGT AGA AM TCA GGT C M GCT GCT V a l Gly Pro Ann Leu His Gly Ile Phe Gly Arg Lys Ser Gly Gln Ala Ala 165

180

195

GGT TAC TCT TAC ACT GAT GCC AAC AM M G AAA GGT GTC G M TGG ACT G M Gly Tyr Ser Tyr Thr Asp Ala Asn Lys Lys Lys Gly Val Glu Trp Thr Glu 225

210

240

255

CAA ACT ATG TCA GAC TAC TTG GAA M C CCA M G M G TAC ATT CCA GGT ACC Gln Thr Met Ser Asp Tyr Leu Glu Asn Pro Lys Lys Tyr Ile Pro Gly Thr 270

285

300

AAG ATG GCC TTT GGT GGT TTA AAG AAA CCA AAG GAC AGA AAC GAC TTG ATC Lys Met Ala Phe Gly Gly Leu Lys Lys Pro Lys Asp Arg Asn Asp Leu Ile 340

360

ACT TAC TTA GCC AAT GCT ACC AAA TAG ATCGAAT Thr Tyr Leu Ala Asn Ala Thr Lys *

3 15

330

TAACGWTGTMCATTGTM

380

400

420

TATTAGTTCACTGGTMTAG

ATTTACTTCTTGTTCATCAT

TTGGTTTTCGTTATTCAACA

440

460

480

MGAAAGTTACTTTGATTA

TTTCCATATTTTATTTGMA

TATTCTACACATTMTTCTT

500

520

528

TATCATATTTCTGTACATAC

ATTGCTATATTTATTATATA

TTATAGTG

433

CYTOCHROME C GENE OF S.OCCIDENTALIS

blots were performed as described (Lowry et al., 1983).For blots with S. cerevisiae RNA, the amount of RNA loaded in each well was standardized by comparing hybridization bands with either that for non-cytochrome c plasmid transcripts or, for Figure 7, that for actin mRNA. For blots with S. occidentalis RNA, the amount of RNA was standardized to the RNA levels visualized by staining with ethidium bromide before blotting. Muter iuls Restriction enzymes were purchased from either Boehringer-Mannheim or New England Biolabs. T4 DNA ligase, the Klenow fragment of DNA polymerase I, and T4 DNA polymerase were purchased from Boehringer-Mannheim.

RESULTS Cloning of the Schwanniomyces occidentalis c:vtochrome c gene The S. occidentalis cytochrome c protein gene was cloned by complementation of the respiratory deficiency of the cytochrome c-less S. cerevisiae strain, GM3C-2. This strain contains a deletion of the major cytochrome c protein gene, CYCI, and a point mutation in the minor gene, CYC7. A S. occidentalis genomic library, constructed in the S. crrevisiue shuttle vector YRp7, which contains the yeast TRPl gene, was transformed into the GM3C2 and trp’ transformants were selected. The transformants were pooled and replated on glycerol plates to select for respiratory competence, Several glycerol’ clones were obtained, and the plasmids in them were recovered by transforming bacterial cells with total yeast DNA selecting for the plasmidborne ampicillin resistance gene. All the plasmids was identical, containing a 1.7 kb BamHI insert, and all were capable of retransforming GM3C-2 to glycerol+. Southern analysis of S. occidentalis genomic DNA digested with BamHI indicated that the genomic equivalent of the cloned DNA did reside within a 1.7 kb BamHI fragment, and that no other fragment cross-hybridized with the clone, suggesting that, if the clone contained a cytochrome c protein gene, it was unique.

A 1.2kb HindIII-BumHI fragment of the original clone was subcloned into the vector YEpl3. GM3C-2 transformants carrying this plasmid were respiratory competent (glycerol’), indicating that the putative cytochrome c protein gene was contained within this fragment. Sequence analysis of the clonedgene

The sequence of a large portion of the 1.2 kb HindIII-BamHI fragment carrying complementing activity was determined. The strategy used and the results obtained are outlined in Figures 1 and 2. An open reading frame is contained within this region that encodes a cytochrome c-like protein. This putative protein contains a heme-binding domain, including the two appropriately spaced cysteine residues to which the heme is covalently linked in all cytochrome c proteins. In Figure 3, the deduced protein coding sequence is aligned with those of the two S. cercvisiae cytochrome c proteins, demonstrating extensive homology: 74% with the CYCIencoded protein and 7 1YOwith the CYC7-encoded protein. This sequence data and the complementation of the cytochrome c deficiency in S. cerevisiae strongly suggest that the cloned DNA encodes a functional cytochrome c protein gene. We designated this putative gene CYCl, but to avoid confusion in subsequent references to the cytochrome c protein genes in the two different yeast species used in this study, we will use the subscripts ‘c’ for the CYCl gene of S. cerevisiae and ‘0’for that of S. occidentalis. The CYCI, gene isfunctionally unique

Southern analysis indicated that no other sequences in the S. occidentalis genome strongly cross-hybridized with the clone, suggesting that no other cytochrome c protein-encoding sequences were present. If this assumption were correct, then inactivation of the genomic copy of the cloned gene would result in a respiratory-deficient phenotype. Such a strain was constructed by insertional inactivation of the CYCI, gene on a plasmid followed by a one-step gene replacement (Rothstein, 1983). The inactivation was achieved by insertion of the S.

Figure 2. The sequence of the CYCI, gene. The sequence of 1061 nucleotides of the coding strand of the CYCI, locus is shown. The deduced amino acid sequence of a 110 cytochrorne c-like protein is represented below the DNA sequence. The nucleotides are numbered starting with the A of the putative translational initiation codon as + 1, and bases 3’-wards in positive integers and bases 5’-wardsin negative integers.

CYC1, CYC7

TG T A G G C T T G A ATG GCT AM GM AGT ACG G I 3 TTC AM CCA GGC TCT GCA A M M G CGT

CYC1,

ATGCCAGTCC

A

M

G

A

A

A

G

A

A

Met Glu Ala net A l a Lys Glu Ser Thr G l y Phe Lys Pro G l y Ser Ala Lys Lys G l y

CYC1, cYC7

Met Pro A h Pro Tyr G l u Lya

CYC1,

A C T

T

G

C

TA

A

A

C

C

Glu

C G G

ASP

A

C

GCT ACC TTG TTT AM ACG AGG TGT CAG CAG TGT CAT ACA ATA GM GAG GGT GGT A

C

A

C

G

T

A

T T A A

C

C G C

A A

LeU Val Lys A l a Thr Leu Phe Lys Thr Arg Cys G l n G l n C y s His Thr I l e G l u G l u G t y Gly Asn

A C T

LW

C

T

A

C

Val

G

C

C

Lys

C

T

A

CCT AAC AAA GTT G W CCT M T GTA CAT GGT ATT TTT GGT AGA CAT TCA GGT CAG A C T A C C A A A

His Pro A s n Lys V a l G l y Pro A s n Leu His G l y Ile Phe G l y Arg H i s Ser G l y G l n Hi s

CTGA

LYS

G

G

C

T

G

A

G TTG

C

GTA AAG GGT TAT TCT TAC ACA GAT GCA M C ATC M C M G MC GTC AM TGG GAT CT GCT C T C M G A G G T G AC LYS Leu Ale Glu V a l Lys G l y Tyr Ser Tyr Thr Asp Ala A s n I l e A s n Lys A s n V a l Lys Trp Asp Ala Ale Lys Lys Gly GIU Thr

A A AC A T GAG GAT ACT ATG TCC GAG TAC TTG ACG M C CCA M G AM TAT ATT CCT GGT ACC GM G C A A C A C A C Asn Asn C l u A s p Ser Met Ser Glu Tyr Leu Thr A s n Pro Lys Lys Tyr I l e Pro G l y Thr G l n Thr

c

ASP

GlU

A

GT

C

C

AAG ATG GCG TTT GCC GGG TTG M G M E GM M G GAC AGA M C GAT TTA ATT ACT C G C C G T T A A CC Gly Lys Met A l a Phe Ala G l y Leu Lys Lys G l u Lys A s p Arg A s n Asp Leu Ile Thr Gly

Pro

C T A A CTGTGG A TAT ATG ACA AAG GCT GCC AM TAG C T A G C T A Leu Lys Cys G l u Tyr Met Thr Lys A h A l a Lys Leu A l a Asn Thr

Figure 3.

Comparison of the cytochrome c protein sequences of Schwanniomyces occidentaiis and Saccharomyces cerevisiae

435

CYTOCHROME C GENE OF S. OCCIDENTALIS

cerevisiae TRPS gene into the KpnI site of the protein-coding region of CYCI,. We believed that such an insertion would lead to a non-functional gene because insertions into the analogous KpnI site of the CYCI, gene result in loss of cytochrome c function (R. S. Zitomer, unpublished results). The resulting plasmid, pSocycl::TRPS, was digested with BamHI, generating a fragment containing the inactivated CYCI, gene with ends homologous to the cloned locus. The trpS S. occidentalis strain NGA-23 was transformed with the digest, and trp+ transformants were selected. Twenty-three such transformants were tested for their ability to grow on glycerol; three were found to be glycerol- and, therefore. respiratory deficient. Southern analysis (data not shown) confirmed that the cycl:: TRPS disruption had displaced the wild-type allele at the cloned locus in all three glycerol- transformants. That the respiratory-deficient phenotype resulted from this disruption was demonstrated by rescuing the glycerol- phenotype by transformation of these cells with a S . occidentalis vector containing an intact CYCI, gene, pJCYC1. This plasmid gave high efficiency transformation when cells were plated directly on glycerol. Thus. based upon the complementation data, the sequence homology, and the demonstration that inactivation of the cloned gene resulted in a respiratory-deficient phenotype, we concluded that the cloned sequences encoded an authentic, functional cytochrome c protein gene. Furthermore, we believe that this gene is functionally unique in the S. occidentalis genome. Regulation of the expression of the CYCI, gene The CYCI, gene is oxygen induced and glucose repressed (Sherman and Stewart, 1971;Zitomer and Hall, 1976; Zitomer et al., 1979; Guarente and Mason, 1983; Lowry et al., 1983; Guarente et al., 1984; Laz et al., 1984). We investigated the expression of the S. occidentalis gene to determine if it behaved similarly. Total cellular RNA was prepared from S. occidentials cells grown either aerobically or anaerobically in media containing glucose, and aerobically in media containing either the trisaccharide raffinose or the non-fermentable mixture of glycerol plus lactic acid. The RNA was subjected to Northern analysis, and the results are presented in Figures 4 and 5. A hybridization band was clearly visible in the RNA prepared from aerobically glucose-grown cells, but no CYCI, mRNA was detectable in that from anaerobically grown

CYCI

+ N2 O2

Figure 4. Levels of CYCI, mRNA in aerobifally and anaerobically grown cells. RNA was prepared from S. oceidentalis strain ATCC 26076 grown anaerobically in 2% glucose (N,) or aerobically in either 2 % glucose (0,)or 2% raffinose (R) and subjected to Northern analysis. The plasmid pSoCYCI was used as a probe.

cells (Figure 4). Interestingly, the intensity of the hybridization band was unaffected by the type of energy source in which the cells were grown (Figure 5). Thus, while the CYCI, gene was subject to oxygen induction, it was not subject to glucose repression. Heterologous expression of the CYC 1, gene Since the expression of the CYCI, gene was regulated in a similar manner to that of the CYCI, gene with respect to oxygen but differently with respect to glucose, it was of interest to determine whether the expression of the S . occidentalis gene was regulated by either of these signals in S. cerevisiae. Such knowledge might provide insight into the relative conservation of regulatory sequences compared to protein-coding sequences. The S. cerevisiae strain AH12 (containing deletions of both cytochrome c genes) carrying the CYCI, gene on a centromeric plasmid (YCpSoCYCI) was grown under a variety of conditions, and total cellular RNA was prepared and subjected to Northern analysis. The results are shown in Figure 6 and clearly indicate that expression of this gene is regulated in an identical fashion to that of the S. cerevisiae gene, subject to both oxygen induction and, surprisingly, given the results found in S. occidentalis cells, glucose repression. These results indicate extensive conservation of both the cis- and trans-acting regulatory elements in these two yeasts. The oxygen activation of the CYCI? gene is affected by the HAP1 (CYPI) protein which binds to the upstream region of a number of oxygenregulated genes (Pfeifer et al., 1987a; Pfeiffer et al.,

436

B. Y. AMEGADZIE ET AL.

.

YPD

YPGL

YPR

02 Figure 5 . Levels of CYCf, mRNA in cells grown in varying energy sources. RNA was prepared from S. occidentalis strain ATCC 26076 grown aerobically in 2% glucose (YPD), 2% glycerol plus 2% lactic acid (YPGL) and 2% raffinose (YPR) and subjected to Northern analysis. The 1.7 kb BarnHI fragment from the plasmid pSoCYCI was used as a probe.

+CYCI ACT1

N2°2 Figure 6 . Levels of CYCI, mRNA in S. cerevisiae cells. RNA was prepared from the S. cerevisiue strain AH 12 transformed with the plasmid YCpSoCYCI and growth anaerobically in 2% glucose (N,) or aerobically in either 2% glucose (0,)or 2% raffinose (R) and subjected to Northern blot analysis. The plasmid pSoCYCl was used as a probe. The arrow indicates the position of the CYCf mRNA.

1987b; Zitomer et al., 1987). Although the precise consensus sequence to which the HAP1 proteins binds has not been conclusively defined, a general sequence has been proposed (Cerdan and Zitomer, 1988) and such a sequence is present upstream of the S . occidentalis gene between -425 and -405 (see Figure 2). A 228 bp deletion which included this sequence, from -305 to -533, was constructed in YCpSoCYCI, and the plasmids were transformed into S. cerevisiae strain AH12. The transformants were glycerol-, and, as can be seen in the Northern

CYCl+ Figure 7. The effect of a deletion of the upstream sequences on the levels of CYC1, mRNA is S. cerevisiue. RNA was prepared from S. cerevisiae strain AH12 transformed with either YCpSOCYCf or YCpCYCl (0.2) grown aerobically in 2% glucose and subjected to Northern blot analysis. The plasmid pSoCYCf was used as a probe.

analysis in Figure 7, no CYCI, mRNA was detectable in the transformed cells. Unfortunately, this deletion could not be tested for its effects on the expression of the CYClqgenein S . occidentalis cells due to the lack of a selection for transformants in the one existing CYCI, deficient mutant we had constructed. Nonetheless, the results obtained in S.

437

CYTOCHROME C GENE OF S. OCCIDENTALIS

Figure 8. Phylogenetic tree for several yeast and fungi.

cerevisiae cells support the hypothesis that the CYCI, oxygen activation site is homologous to that in S. cerevisiae oxygen-regulated genes, although further analysis is required to demonstrate this point conclusively. Phylogenetic relationships deduced from yeast cytochrome c proteins The cytochrome c protein has long been a favorite for structural studies by protein chemists, and its amino acid sequence has been determined for a large number of species. The data have allowed studies of phylogenetic relationships on the basis of amino acid substitutions as a measure of evolutionary distance and have been found to agree well with the more traditional morphological schemes for higher eukaryotes (Fitch and Margoliash, 1967). The classification of microorganisms is particularly difficult given the lack of distinct morphological traits, and the use of protein sequence data might be of particular importance here as is the ribosomal RNA sequence data for prokaryotes (Woese, 1987).

Using programs designed by Felsenstein (1989, we have derived a phylogenetic tree for a number of yeast species as well as some fungi for which the sequence of the cytochrome c protein is known (either determined directly or, as in the case of S . occidentalis, through the DNA sequence). The result is shown in Figure 8. One surprising finding is that S. pombe, which by classical methods was believed to be closely related to baker’s yeast, placed within the same family, is quite distantly related to the other yeasts presented here, while Candida krusei, considered to be distantly related to the other yeasts, placed within a different family, is less so (Lodder et al., 1958; Pfaff et al., 1978). Clearly, further studies of this type are required to generate a true picture of the evolutionary relationships between yeast species. DISCUSSION We have described here the cloning and sequence analysis of the cytochrome c gene from the yeast, S. occidentalis. The proof that the sequence cloned is

438

indeed an authentic cytochrome c protein gene is based upon three lines of evidence. First, the DNA sequence contains an open reading frame that encodes a putative protein with extensive homology to other cytochrome c proteins. Second, the cloned sequence complemented a cytochrome c deficiency in S. cerevisiae. Third, a disruption of the open reading frame in the s. occidentalis genome resulted in a respiratory-deficient phenotype, which was rescued by transformation with an intact copy of the cloned sequences. Furthermore, the disruption experiments, as well as Southern analysis, strongly suggest that the cloned cytochrome c protein gene is unique in the S. occidentalis genome. This finding is of interest given the two copies of differentially expressed cytochrome c protein genes of baker’s yeast. No functional role has been assigned to the minor species, iso-2-cytochrome c; laboratory strains containing mutations in the CYC7 gene encoding this protein are viable and quite capable of making the transition from aerobic to anaerobic growth and back again (R. S. Zitomer, unpublished results). While we cannot rule out the possibility that iso-2-cytochrome c plays a role in the natural habitat of yeast, that role is either non-essential in S. occidentalis or the single gene present in these cells can fulfil the function of the two genes in S. cerevisiae. We have initiated an investigation of the regulation of the expression of the CYCZ, gene, and found it to be induced by oxygen, as is the major S. cerevisiae gene, but unlike the S. cerevisiae gene, it was not glucose repressed. One cautionary note must be interjected; we have observed that the extent of glucose repression of respiratory function in S. cerevisiaeisextremely strain-dependent, and we have not made a survey of different S . occidentalis strains to determine whether insensitivity to glucose is a universal trait. Nonetheless, it is interesting to note that this lack of glucose repression may be physiologically important to thecell. S. occidentaliscellsare less tolerant of high ethanol concentrations than are S. cerevisiaecells(Wilsonetal., 1982),and, therefore, high levels of respiratory proteins might be necessary during growth in high sugar concentrations to prevent ethanol accumulation. We also studied the regulation of the CYCI, gene in heterologous S. cerevisiae cells and found expression to be indistinguishable from the native CYCI, gene. Interestingly, this heterologous regulation also included glucose repression of the gene, which, as stated above, was not observed in S. occidentalis. The mechanism of glucose repression

B. Y. AMEGADZIE ETAL.

is not at all clearly understood and may occur indirectly, through the regulation of activity of the oxygen activation system. Therefore, the significance of this finding cannot be fully assessed at this time. We have used the deduced cytochrome c protein sequence reported here in conjunction with a number of other yeast and fungal cytochrome c protein sequences to derive a phylogenetic tree. One of the interesting features to emerge is that the genus Candida appears to be much more closely related to Schwanniomyces, Debaryomyces, and, to a lesser extent, Saccharomyces than was previously thought. Having demonstrated the extensive conservation of regulatory mechanisms between Saccharomyces and Schwanniomyceshere, we feel it likely that Candida must also share common mechanisms with Saccharomyces, and even more so with Schwanniomyces. Thus study of the pathogenic yeast, made difficult in part because the organism is diploid with no known sexual cycle (Olaiya and Sogin, 1979; Whalen et al., 1980), may be augmented by the knowledge of this close relationship and the attendant assumption of the conservation of regulatory mechanisms. ACKNOWLEDGEMENTS This work was supported by grants from the General Medical Institute of the National Institutes of Health and the Deutsche Forschungsgemeninschaft, and an Alexander von Humbolt Fellowship. REFERENCES Bolivar, F., Rodriguez, R. L., Green, P. J., Betlach, M. C., Heyneker, H. L., Boyer, H. W., Crosa, J. H. and Falkow, S. (1977). Construction and characterization of new cloning vehicles. 11. A multipurpose cloning system. Gene 2,95-113. Boyer, H. W. and Roulland-Dussoix, D. (1969). A complementation analysis of the restriction and modification of DNA in Escherichia cofi. J. Mol. Biol. 4,

459-412. Broach, J. R., Strathern, J. N. and Hicks, J. B. (1979). Transformation in yeast: development of a hybrid cloning vector and isolation of the CAN1 gene. Gene 8, I2 1-1 33. Calleja, G. B., Levy-Rick, S., Lusena, C. V.,Nasim, A. and Moranella, F. (1 982). Direct and quantitative conversion of starch to ethanol by the yeast Schwanniomyces atluvius. Biotechnof.Letts. 4,543. Cerdan, M. E. and Zitomer, R. S. (1988). Oxygendependent upstream activation sites of the Saccharomyces cerevisiae cytochrome c genes are related forms of the same sequences. Mol. Cell. Biol. 8,2215-2219.

CYTOCHROME C GENE OF S.OCCIDENTALIS

Clarke, L. and Carbon, J. (1980). Isolation of a yeast centromere and construction of small functional circular chromosomes. Nature 287,504-509. Clements, J. M., O’Connell, L. I., Tsunasawa, S. and Sherman, F. (1989). Expression and activity of a gene encoding rat cytochrome c in the yeast Saccharomyces cerevisiae. Gene 83, 1-14. Cruesot, F., Verdiere, J., Gaisne, M. and Slonimski, P. P. (1988). The CYPI ( H A P I ) regulator of oxygen dependent gene expression in yeast: I. Overall organisation of the protein displays several novel structural domains. J. Mol. Biol. 204,263-276. Dayhoff, M. O., Schwartz, R. M. and Orcutt, B. C. (1979). A model of evolutionary change in proteins. In Dayoff, M. 0. (Ed.), Atlas of Protein Sequence and Structure, vol. 5. National Biomedical Research Foundation, Washington, D.C., pp. 300-362. Dohmen. R. J., Strasser, A. W. M., Zitomer, R. S. and Hollenberg, C. P. (1989). Regulated overproduction of a-amylase by transformation of the amylolytic yeast Schwanniomyces occidentalis. Curr. Genet. 15,319-325. Elwell, L. P., DeGraaff, J., Selbert, D. and Falkow, S. (1975). Plasmid-linked ampicillin resistance in Haemophilus influenzae type B. Infect. Immun. 12,404-410. Faye, G., Leung, D. W., Tatchell, K., Hall, B. D. and Smith, M . (1981). Deletion mapping of sequences essential for in vivo transcription of the iso-lcytochrome c gene. Proc. Natl. Acad. Sci. USA 78, 2258-2262. Felsenstein, J. (1985). Confidencelimitsonphylogenies: an approach using the bootstrap. Evolution 39,783-791. Fitch, W. M. and Margoliash, E. (1967). Construction of phylogenetic trees: A method based on mutational distances as estimated from cytochrome c sequence is of general applicability. Science 155,279-284. Guarente, L., Lalonde, B., Gifford, P. and Alani, E. ( 1984). Distinctly regulated tandem upstream activation sites mediate catabolite repression of the C Y C l gene of S. cerevisiae. Cell 36,503-5 1 1 . Guarente, L. and Mason, T. (1983). Heme regulates the transcription of the C Y C l gene of S. cerevisiae via an upstream activation site. Cell32, 1279-1286. Hahn, S., Hoar, E. T. and Guarente, L. (1985). Each of three “TATA elements” specifies a subset of transcription initiation sites at the CYCI promoter of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U S A 82,8562-8566. Hanahan, H. (1983). Studies on the transformation of Escherichia coli with plasmids. J. Mol. EioI. 166, 557-580. Healy, A. M., Helser, T. and Zitomer, R. S. (1987). Sequences required for transcriptional initiation of the Saccharomyces cerevisiae C YC7 gene. Mol. Cell. Biol. 7,3785-3791. Hinnen, A., Hicks, J. B. and Fink, G. R. (1978). Transformation of yeast. Proc. Natl. Acad. Sci. USA 75, 1929-1933.

439 Ingledew, W. M. (1987). Schwanniomyces: A potential superyeast? CRC Critical Rev. in Biot. 5, 159-176. Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983). Transformation of intact yeast cells treated with alkali cations. 1.Bacteriol. 153, 163-168. Klebe, R. J., Harriss, J. V., Sharp, Z. D. and Douglas, M. G. (1983). A general method for polyethylene-glycol-induced genetic transformation of bacteria and yeast. Gene 25,333-341. Lalonde, B., Arcangioli, B. and Guarente, L. (1986). A single Saccharomyces cerevisiae upstream activation site (UASI) has two distinct regions essential for its activity. Mol. Cell. Biol. 6,4690-4696. Laz, T. M., Pietras, D. F. and Sherman, F. (1984). Differential regulation ofthe duplicated iso-cytochrome c genes in yeast. Proc. Natl. Acad. Sci. USA 81, 475-4479, Lodder, J., Slooff, W. Ch. and Kreger van Rij, J. W. (1958). Classification of yeasts. In Cook, A. H. (Ed.), The Chemistry and Biology of Yeasts. Academic Press, Inc., New York, pp. 1-62. Lowry, C. V., Weiss, J. L., Walthall, D. A. and Zitomer, R.S. (1983). Modulator sequences mediate the oxygen regulation of CYCI and a neighboring gene in yeast. Proc. Natl. Acad. Sci. USA 80, 151-155. Lowry, C. V. and Zitomer, R. S. (1984). Oxygen regulation of aerobic and anaerobic genes mediated by a common regulatory factor in yeast. Proc. Natl. Acad. Sci. USA 81,6129-6133. Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. McCann, A. K. and Barnett, J. A. (1986). The utilization of starch by yeasts. Yeast 2, 109-1 15. Messing, J. (1983). New M13 vectors for cloning. Methods in Enzymol. 101,20-78. Olaiya, A. F. and Sogin, S. J. (1979). Ploidy determination of Candida albicans. J. Bacteriol. 140, 1043-1049. Pfaff, H. J., Miller, M. W. and Mrak, E. M. (1978). The Life of Yeasts, 2nd edn. Harvard University Press, Cambridge, Mass. Pfeifer, K., Arcangoli, B. and Guarente, L. (1987a). Yeast HAPl activator competes with the factor RC2 for binding to the upstream activation site UASl of the C Y C l gene. Cell 49,9-18. Pfeiffer, K., Prezant, T. and Guarente, L. (1987b). Yeast HAPl activator binds to two upstream activation sites of different sequence. Cell49, 19-27. Rothstein, R. J. (1983). One-step gene disruption in yeast. Methods in Enzymol. 101,202-2 1 1. Rothstein, R. J. and Sherman, F. (1980). Genes affecting the expression of cytochrome c in yeast: genetic mapping and genetic interactions. Genetics 94, 871-889. Russell, P. R. and Hall, B. D. (1982). Structure of the Schizosaccharomyces pombe cytochrome c gene. Mol. Cell. Biol. 2, 106-1 16.

440 Sanger, F., Nicklen, S. and Coulson, S. A. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74,5463-5467. Sherman, F. and Stewart, J. W. (1971). Genetics and biosynthesis of cytochrome c. Ann. Rev. Genet. 5, 257-296. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98,503-517. Struhl, K., Stinchcomb, D. T., Scherer, S. and Davis, R. W. (1979) High frequency transformation of yeast: autonomous replication of hybrid DNA molecules. Proc. Natl. Acad. Sci. USA 76,1035-1039. Verdiere, J., Creusot, F. and Guarente, L. (1986). The overproducing C Y P l mutation and the underproducing hap1 mutations are alleles of the same gene which regulates in trans the expression of the structural genes encoding iso-cytochrornes c. Curr. Genet. 10, 339-342. Verdiere, J., Creusot, F. and Guerineau, M. (1985). Regulation of the expression of is0 2-cytochrome c gene in S . cerevisiae: cloning of the positive regulatory gene C Y P l and identification of the region of its target sequence on the structural gene CYP3. Mol. Gen. Genet. 199,524-533.

B. Y. AMEGADZIE ETAL.

Whalen, W. L., Partridge, R. M. and Magee, P. T. (1 980). Heterogosity and segregation in Candida albicans. Mol. Gen. Genet. 180,107-1 13. Wilson, J. J., Khachatourians, G .G. and Ingledew, W. M. (1982). Schwanniomyces: SCP and ethanol from starch. Biotechnol. Letts. 4,333-338. Woese, C. R. (1987). Bacterial evolution. Microbiol. Rev. 51,221-271. Wright, C. F. and Zitomer, R. S. (1984). A positive regulatory site and a negative regulatory site control the expression of the Saccharomyces cerevisiae CYC7 gene. Mol. Cell. Biol. 4,2023-2030. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). New M13 host strains and the complete sequences of M13mp and pUC vectors. Gene 33,103-1 19. Zitomer, R. S. and Hall, B. D. (1976). Yeast cytochromec mRNA. J. Biol. Chem. 251,6320-6326. Zitomer, R. S., Montgomery, D. L., Nichols, D. L. and Hall, B. D. (1979). Transcriptional regulation of the yeast cytochrome c gene. Proc. Natl. Acad. Sci. USA 76, 3627-363 1. Zitomer, R. S., Sellers, J. W., McCarter, D. W., Hastings, G. A., Wick, P. and Lowry, C. V. (1987). Elements involved in oxygen regulation of the Saccharomyces cerevisiae CYC7 gene. Mol. Cell. Biol. 7,2212-2220.