Eur. J. Biochem. 208,769 -774 (1992)

0FEBS 1992

Characterization of the chicken al(V1) collagen promoter Erich KOLLER and Beat TRUEB Laboratorium fur Biochemie I, Eidgenossische Technische Hochschule, Zurich, Switzerland (Received March 3O/July 2, 1992) - EJB 92 0449

The promoter of the chicken al(V1) collagen gene resembles the 5’-flanking regions of many housekeeping genes. It lacks a canonical TATAA box but contains potential binding sites for transcription factors AP1 and SPI. The promoter region has a relatively high GC content and forms a typical CpG island. In accordance with the absence of a TATAA element, the gene contains multiple transcription-initiation sites distributed over 80 bp genomic DNA. A 621-bp fragment derived from the 5‘ end of the al(V1) collagen gene is able to direct transcription of a heterologous reporter gene in transient-expression assays. Other DNA fragments that are either shorter or longer than the 621bp fragment show markedly reduced promoter activity. Thus, the basic promoter element of the aI(V1) collagen gene must reside within this 621-bp fragment.

Transformation of fibroblasts by oncogenic viruses or by carcinogens triggers a number of cellular changes, including severe alterations in cell growth and shape and changes in the synthesis rate of a discrete group of proteins. While most proteolytic enzymes, such as plasminogen activator and stromelysin, are up-regulated in transformed cells, several components of the extracellular matrix are specifically downregulated. It is conceivable that these changes contribute to the unrestricted growth of malignant cells. One of the most prominent alterations in the extracellular matrix is observed with type-VI collagen (Carter, 1982; Trueb et al., 1985; Schreier et al., 1988). This collagen is composed of three different polypeptide chains, al(VI), a2(VI) and a3(VI), which form a disulfide-bonded molecule (Timpl and Engel, 1987). Structural studies with cloned cDNA probes specific for the three polypeptide chains have established that the molecule consists of a central triple helix which is flanked by large globular domains (Koller et al., 1989; Bonaldo et al., 1989,1990; Chu et al., 1989,1990). The globular domains are composed of several homologous subdomains which show a striking similarity to the collagen-binding motifs present in von Willebrand factor. The triple helix contains numerous Arg-Gly-Asp sequences which can be used as cell-binding sites (Aumailley et al., 1989). Type-VI collagen might therefore function as an important cell-adhesion molecule. Fibroblasts and other mesenchymal cells produce large amounts of type-VI collagen. This collagen, however, is barely detectable in cells transformed by the viral oncogenes v-myc and v-src, or in cells derived from spontaneous mesenchymal tumors (Schreier et al., 1988). There is evidence that the synthesis of type-VI collagen is blocked at the transcriptional level, because transformed cells do not contain any type-VIcollagen-specific mRNA (Trueb et al., 1985, 1989). In order

to study the regulation of transcription at the molecular level, we have isolated the genes for the al(V1) and the cr2(VI) collagen subunits (Hayman et al., 1990, 1991; Walchli et al., 1992) and characterized the a2(VI) collagen promoter (Koller et al., 1991). We found that this promoter differed substantially from the promoters of all other collagen genes characterized so far. It did not contain a typical TATAA box and consequently, transcription started at multiple initiation sites distributed over 75 bp of genomic DNA. The entire promoter region had a relatively high GC content and formed a typical CpG island. Such features are usually confined to the promoters of housekeeping genes that are constitutively expressed. A short DNA fragment encompassing all the transcription-initiation sites of the a2(VI) collagen gene exhibited strong promoter activity when placed in front of a heterologous reporter gene. Curiously enough, this promoter element did not lose its activity when it was linked to the reporter gene in an inverted orientation. In order to compare these properties with those of another type-VI collagen gene, we have now characterized the aI(V1) collagen promoter. This promoter resembles the a2(VI) collagen promoter with respect to the CpG island and the presence of multiple transcription-initiation sites. In contrast to the situation observed with the a2(VI) collagen promoter, however, a fairly large fragment is required from the al(V1) collagen gene to achieve full promoter activity in transient transfection assays. Thus, the al(V1) collagen promoter exhibits a more complex structure than the a2(VI) collagen promoter. This result is unexpected in view of the fact that the two genes are coordinately expressed in all cell types analysed so far.

Correspondence to B. Trueb, Biochemie I, ETH Zentrum, CH8092 Zurich, Switzerland Fax: +411 261 5677. Note. The novel nucleotide sequence data published here have been submitted to the GenBank/EMBL sequence data banks and are available under accession number X57987.

Isolation of the 5’ end of the d(V1) collagen gene

MATERIALS AND METHODS A cDNA probe encompassing 1.6 kbp from the 5’ end of the chicken al(V1) collagen mRNA (clone pA31; cf. Bonaldo et al., 1989) was labeled with [ E - ~ ~ P I ~ C byT the P randomprimed oligonucleotide-labeling method (Feinberg and

770 Vogelstein, 1983). This probe was used to screen a genomic DNA library prepared in the vector EMBL-3 as well as a cDNA library prepared in the vector l g t l 1 (Clontech Laboratories, Palo Alto, CA) as previously described (Koller et al., 1989; Hayman et al., 1990). The DNA inserts of positive clones were cut from the vectors with the restriction enzymes EcoRI, BamHI or SalI (Boehringer Mannheim) and cloned into the plasmid pUC13. The inserts were further characterized by restriction mapping using the enzymes HindIII, SmaI and PstI. Restriction digests were resolved on 1% agarose gels and transferred to Zeta-Probe nylon membranes (Bio-Rad) with the Vacugene blotting system (Pharmacia LKB Biotechnology Inc.). The blots were hybridized under standard conditions (Maniatis et al., 1982) to a radioactively labeled fragment spanning positions 1 - 31 8 of the published cDNA sequence (Bonaldo et al., 1989). This fragment had been obtained from clone pA31 by digestion with EcoRI and ClaI.

The hybridization products were digested at 37 "C with 50 U S1 endonuclease (Pharmacia). Digestion was terminated after 1 h by phenol extraction and ethanol precipitation. The reaction products from primer extension and S1nuclease analysis were characterized on a 6% polyacrylamide sequencing gel. The sizes of the products were determined by comparison with a DNA-sequencing reaction electrophoresed in parallel on the same gel. Transient transfection assays

The activity of the al(V1) collagen promoter was analysed in transient expression assays as previously described (Koller et al., 1991). Promoter fragments of interest were provided with the desired linkers by subcloning into the polylinkers of pUCl3 and/or pBluescript SK- and subsequent cleavage with suitable restriction enzymes. The fragments were then ligated into the polylinker of the plasmid pOGH which contained the human growth hormone gene as a reporter system to analyse eukaryotic gene expression (Selden et al., 1986). The identity DNA sequencing and the orientation of the final constructs were verified by Suitable restriction fragments were subcloned into the DNA sequencing. The constructs were transfected into chicken tendon fibrosequencing vectors M13mp18 or M13mp19. Nucleotide sequences were determined by the dideoxy-chain-termination blasts (15 pg plasmid DNA/25 cm2 cell culture flask) by the method using the enzyme Sequenase Version 2.0 (United calcium phosphate coprecipitation method (Graham and van States Biochemical Corp.). In order to resolve compressions der Eb, 1973). Two and three days after transfection, the of oligonucleotide bands on the sequencing gels, dGTP was culture medium was assayed for its content of human growth replaced by dITP in most of the sequencing reactions. The hormone using the Allegro transient gene-expression kit sequence data were analysed with the software computer pack- (Nichols Institute, San Juan Capistrano, CA). All transfection age of the Genetics Computer Group (University of Wiscon- experiments were performed in duplicate to compensate for experimental variation. Transfection efficiency was not detersin, Madison, WI). mined by cotransfection of a standard plasmid, because competition between test and standard plasmids has been deS1-protection and primer-extension experiments scribed (Mar et al., 1988). The promoterless plasmid pOGH The 5' end of the al(V1) collagen gene was identified by served as a negative control, plasmid pXGH5 which contained primer-extension and by S1-protection experiments, essen- the mouse metallothionein-I promoter (Selden et al., 1986) tially as described previously (Koller et al., 1991). A synthetic was used as a positive control. oligonucleotide primer complementary to bases 146- 165 was labeled at its 5' end with [ Y - ~ ~ P I Ausing T P T4 polynucleotide kinase (Pharmacia). Approximately 1 ng of this primer RESULTS AND DISCUSSION (3 x lo5 cpm) was hybridized to 0.5 pg poly(A)-rich RNA The 5' end of the al(V1) collagen gene from chicken embryos (Koller et al., 1991). The annealed primer was extended at 42°C with reverse transcriptase from Screening of a genomic DNA library with a cDNA probe avian myeloblastosis virus (Pharmacia). After 1 h, the reaction corresponding to the 5' end of the chicken al(V1) collagen was stopped by adding EDTA to give a final concentration of mRNA led to the isolation of seven overlapping 1, clones 12.5 mM, followed by phenol extraction and ethanol precipi- (Walchli et al., 1992). These clones were characterized by tation. restriction mapping and by Southern hybridization with a For S1-protection analysis, two end-labeled probes were short DNA fragment encompassing nucleotides 1- 318 of the prepared (Weaver and Weissmann, 1979). A genomic frag- published cDNA sequence. Five genomic clones reacted with ment of 756 bp, spanning positions - 164 to + 592 was ligated the short DNA fragment, suggesting that these clones cominto the SmaI site of plasmid pUC13 and cut at the single prised the promoter of the al(V1) collagen gene. Suitable EspI site. The linearized plasmid was dephosphorylated with restriction fragments were subcloned into the plasmid pUCl3, bacterial alkaline phosphatase (Gibco BRL) and 32P labeled and the nucleotide sequence of 6233 bp was established. at both ends with T4 polynucleotide kinase (Pharmacia). SubA comparison of the genomic sequence with the published sequent cleavage with EcoRI generated a 340-bp probe that cDNA sequence allowed the identification of the first two was 32Plabeled exclusively at the EspI site. Similarly, a 427- exons of the al(V1) collagen gene (Fig. 1). The first exon bp fragment spanning positions +836 to + 1242 of the al(V1) comprised the 5' untranslated region of the mRNA and collagen gene was inserted into the SmaI site of pUC13. The nucleotides encoding the signal peptide and 13 113 amino acids plasmid was linearized with restriction enzyme ClaI, from the amino-terminal globular domain. The second exon dephosphorylated and 32Pend-labeled as above. Subsequent was 130 bp and encoded 43 1/3 amino acids from the aminocleavage with EcoRI generated a 183-bp probe which was terminal globular domain. The two exons were separated by specifically 32P labeled at the ClaI site. The two probes an intron of 670 bp which was flanked by the canonical splice (2.5 x lo4 cpm) were denatured and hybridized overnight at sites GGgtaagc and ttgccctcagAC. various temperatures to 50 pg total RNA from chicken emThe nucleotide sequences of the two exons were in accordbryos or from chicken fibroblast cultures (Koller et al., 1991). ance with the published cDNA sequence, with the exception

771 -4

-3

-2

~1

0

+I

I 7

1 2 3 4 5 6

kbp

7

9 10 11

8

340-

I BarnHl

EcoRl

Hindlll Smal PStl

165-

EXONl

EXON2

Fig.1. Schematic representation of the 5' end of the chicken al(V1) collagen gene. Exons are indicated by black boxes, noncoding regions by a horizontal line. The transcription-initiation site is denoted by an arrow. A partial restriction map is shown above the exons.

of the most 5' part (Bonaldo et al., 1989). The first 50 nucleotides of the published sequence, however, did not occur in our genomic sequence. We therefore isolated another cDNA clone for the 5' end of the crl(V1) collagen mRNA from a i g t l 1 cDNA library. Sequencing studies showed that this clone contained an insert of 1. I kbp which started at position 14 of our genomic sequence (for numbering of nucleotides, cf. Fig. 3). This result indicates that the 5' end of the published cDNA sequence is incorrect. The erroneous sequence data have recently been corrected by the authors. The corrected data, however, are still at variance with our genomic sequence data. Determination of the transcription-start site The transcription-initiation site of the al(V1) collagen gene was identified by S1-protection and by primer-extension experiments (Fig. 2). Extension of a 20-nucleotide primer with reverse transcriptase yielded more than ten extension products, suggesting that more than ten distinct initiation sites are used (Fig. 2B). S1-digestion experiments with a 340-bp probe produced seven major and several minor fragments (Fig. 2A). Most of these fragments corresponded in length to products obtained by primer extension (Fig. 3). Varying the reaction conditions (changing the hybridization temperature, increasing the amount of S1 nuclease, utilizing different preparations of mRNA) did not qualitatively affect our results. Thus, the a1 (VI) collagen gene must contain multiple transcription-start sites distributed over 80 bp genomic DNA. The nucleotide at the first initiation site is numbered 1 in Fig. 3. In a control experiment designed to standardize our S1protection assay, we determined the exact 5' end of exon 2 (Fig. 2C). A 183-bp probe encompassing part of intron 1 and 114 bp of exon 2 was hybridized to chicken mRNA and the hybridization products were subjected to S1 digestion. As expected, this experiment yielded a single band of 114 nucleotides, indicating that a single acceptor site is used for splicing exons 1 and 2.

101-

73-

A

B

C

Fig. 2. Identification of the transcription-initiation sites by S1-mapping and by primer-extension experiments. For S1-nuclease protection (A), an EcoRI- EspI fragment (340 bp) containing part of the pUC13 polylinker and nucleotides - 164 to 165 of the al(v1) collagen gene (cf. Fig. 3) was 32P labeled specifically at the EspI site (lane 1). This probe was denatured and hybridized at 48°C (lane 2), 56°C (lanes 3 and 6), 60 "C (lane 4) and 64°C (lane 5 ) to RNA from chicken embryos (lanes 2-5) or to RNA from chicken fibroblasts (lane 6). The hybridization products were digested with S1 nuclease and analysed on a 6% polyacrylamide sequencing gel. For primer extension (B), a synthetic oligonucleotide complementary to bases 146 to 165 (cf. Fig. 3) was 32P labeled at its 5' end. This primer was hybridized to poly(A)-rich RNA from chicken embryos (lane 7) or to tRNA from yeast (lane 8) and extended with reverse transcriptase. The extension products were resolved on a 6% polyacrylamide gel. (C) An S1protection experiment designed to determine the 5' splice boundary of exon 2. An EcoRI - CluI fragment (1 83 bp), encompassing part of the pUC13 polylinker and nucleotides +816 to +987 of the aI(V1) collagen gene was 32P labeled at the CluI site (lane 9). This probe was hybridized at 56°C (lane 10) and 60°C (lane 11) to RNA from chicken embryos and processed as described above. The sizes of the major products as determined by parallel electrophoresis of a standard DNA sequencing reaction are shown on the left.

+

+

+

+

Features of the promoter region The nucleotide sequence in the vicinity of the multiple transcription-start sites was inspected for potential binding sites of transcription factors using the Tfsites databank provided with the GCG program package (Fig. 3). No typical

TATAA box was detected at the appropriate position, but we found a CAAT box at positions -211 to -208, as well as potential binding sites for transcription factors SP1 (positions -9 to -4) and AP1 (positions -80 to -73). Furthermore, there were several GC clusters which might interact with transcription factor ETF, a factor often associated with promoters lacking a typical TATAA box (Kageyama et al., 1989). The entire promoter region exhibited a fairly high GC content (67.2% GC between positions - 200 and 300). The dinucleotide sequence CpG which is rare in genomic DNA occurred with a relatively high frequency in the 5'-flanking region of the crl(V1) collagen gene. There were a total of 35 CpG dinucleotides present between positions -200 and

+

772 CAAT

CCGTTGGGCTCAGCTCAGGGCTCCGAGCCCCCAGGGCGCAGCTGGGGGACAG~GAGTCCTTCGGCAGGAGCGCGCGGGTACAAGGAGCACAGAA -111 GGCAACCCGAGTCGAGTCCCGAGGCTCGGGGGTCCCGCGTCGACCCCCTGTCGTCTCAGGAAGCCGTCCTCGCGCGCCCATGTTCCTCGTGTCTT

-110

1

-1

AGACAGCGAGGAGAAGCGCAGGCTGGCTT TCTGTCGCTCCTCTTCGCGTCCGACCGAA

t

t

CTTCCTTCCCCGGGTCCCAAGCGCTGAAACCACCCCCAGACCCGGACCCGGCCTCTCCCTCCTTCCTCCCTTCGCTGCAGCTCGATGTGAATCTGAGCCCAGCGA GllAGGAAGGGGCCCAGGGTTCGCGACTTTGGTGGGGGTCTGGGCCTGGGCCGGAGAGGGAGGAAGGAGGGAAGCGACGTCGAGCTACACTTAGACTCGGGTCGCT

A

A

111

AA

A

A

3

GGCTGCACGACTCCTTCTTGGCGCTGCTGCTTCTTCTGGGGGGTGCCTGGGCTCAGCAGGCTG~TCAACGCCCGTGTCCTCAGGGCTCAGTAAGCGGGGGACAGCC CCGACGTGCTGAGGAAGAACCGCGACGACGAAGAAGACCCCC~CGGACCCGAGTCGTCCGACTTTAGTTGCGGGCACAGGAGTCCCGAGTCC ATTCGCCCCCTGTCGG

--

110

Primer

220

Fig. 3. Nucleotide sequence flanking the transcription-initiationsites. Arrows denote the major start sites identified by S1 protection, arrowheads those determined by primer extension. The first start site is numbered + 1. The EspI restriction site used for the construction of the S1protection probe and the oligonucleotide used for primer extension are indicated. The translation initiation codon for methionine, a CAAT sequence and two putative binding sites for transcription factors API and SPl are boxed. The end of exon 1 is shown by a bracket.

*O 10

1 -2

A -1

Activity of the al(V1) collagen promoter

A

0

I

2

SEQUENCE, kbp

Fig. 4. Distribution of CpG dinucleotide sequences along the al(V1) and the a2(VI) collagen genes. The frequency of CpG sequences in a window of 300 bp is plotted against the gene sequences. Exons are indicated by horizontal lines.

+300, while the rest of the gene contained an average of 1.2 CpG dinucleotides/100 bp (Fig. 4). Thus, the al(V1) collagen promoter forms a typical CpG island, as found in many housekeeping genes (Bird, 1987). The 5'-flanking region of the al(V1) collagen gene also harboured two peculiar homopurine/homopyrimidine elements. One of these elements was located between positions + 52 and 73 and contained exclusively pyrimidine deoxynucleotides on the coding strand; the other one was found between positions - 31 and + 11 and comprised 39 pyrimidine and three purine deoxy-nucleotides on the coding strand. Similar homopurine/homopyrimidine elements have been identified in the proximity of a number of eukaryotic promoters, including that of the a2(VI) collagen gene (Koller et al., 1991). Since these elements have the capability to adopt a novel hairpin triplex structure (H-DNA), which is sensitive to digestion by single-strand-specific endonucleases, they have attracted considerable attention (Wells et al., 1988). Neither of the two elements of the al(V1) collagen gene, however, was susceptible to S1 digestion in vitro (results not shown). It is therefore unlikely that these elements will form an intramolecular triplex structure under physiological conditions.

+

In order to prove that the 5' flanking region of the crl(V1) collagen gene has promoter activity, we performed transient transfection assays utilizing the human growth hormone as a reporter system (Selden et al., 1986). To this end, a DNA fragment of 621 bp (restriction sites included), encompassing all the major transcription-initiation sites, was placed in front of the reporter gene, and the resulting construct was transfected into chicken fibroblasts (Fig. 5). This construct exhibited strong promoter activity (lOOo/~)in comparison with a control construct which contained the metallothionein promoter linked to the reporter gene (173%). When 66 bp were removed from the 3' end of the 621-bp fragment, thereby deleting all but the first of the transcription-initiation sites, the promoter activity dropped to about 50%. All initiation sites are therefore required to achieve full promoter activity. Shortening the 621-bp fragment at its 5' end by 254 bp reduced the activity by 40%. Elongating the 621-bp fragment by 1.2 kbp of 5'-flanking sequence caused a similar decrease in promoter activity. Thus, the basic promoter element of the crl(V1) collagen gene must reside within nucleotides - 541 to 80. This element must be fairly complex since it appears to contain at least two positive regulatory regions, one situated between nucleotides 80 and - 287 and another one situated between nucleotides -287 and -541. Our studies further indicate that a negative regulatory element may be located in the upstream region somewhere between positions - 536 and -1737. We also investigated whether the crl (VI) collagen promoter was functional in either direction (Fig. 5). A construct containing a 367-bp fragment (positions - 287 to 80) linked to the reporter gene in an inverted orientation showed nearly full promoter activity. The minimal promoter element of the al(V1) collagen gene must therefore possess bidirectional activity. Two other fragments that were longer than the 367-bp element, however, did not exhibit any activity when ligated to the reporter gene in an inverted orientation. This may be explained by the creation of several new ATG codons just upstream from the correct translation initiation site for human growth hormone. It is therefore likely that any fragment

+

+

+

773 CONSTRUCT

RELATIVE ACTIVITY %

poGH puc13

pXGH5

- 1737

+ 80

-17fl - 1737

-536

+ 14

+ 80

-541

-287

+80

+80

-287

5

f SD *

1

O f 1 173 f 14 61

f 3

39

f

4

O

f

1

100

i 7

i f 1 49

f

2

O

i

l

60

f 2

98

f

4

Fig. 5. Activity of the al(V1) collagen promoter. The relative activities of several restriction fragments derived from the 5’ end of the ctl(V1) collagen gene were determined in a transient expression assay using the gene for human growth hormone as a reporter system. The fragments were ligated into the test plasmid pOGH in a normal (black) or in an inverted (grey) orientation and transfected into chicken fibroblasts. Activities are expressed in relation to the activity of the 621-bp construct (100%). The numbers are means from two separate transfection experiments. The promoterless plasmids pUC13 and pOGH are included as negative controls; plasmid pXGH5, which contains the strong metallothionein promoter, is included as a positive control. In a parallel experiment, the 213-bp fragment derived from the a2(VI) collagen promoter (cf. Koller et al., 1991) displayed 84 *4% activity.

longer than the 367-bp element will direct the synthesis of nonsense translation products in reversed orientation. Comparison with other eukaryotic promoters The features identified in the al(V1) collagen promoter are characteristic of an entire family of eukaryotic genes termed housekeeping genes. This family comprises genes whose protein products are essential for the maintenance of vital metabolic functions, such as the genes for hypoxanthine phosphoribosyl-transferase and dihydrofolate reductase (for a review, see Dynan, 1986). Typically, the promoters of these genes are GC rich, they lack a TATAA box and contain multiple transcription-initiation sites, as found in the case of the al(V1) collagen promoter. Interestingly, a heterogeneous transcription-start site and a high GC content have also been identified in the promoters of several proto-oncogenes, including the genes for c-Ha-ras (Ishii et al., 1985), epidermal growth factor receptor (Johnson et al., 1988), c-ets (Mavrothalassitis et al., 1990), c-re1 (Hannink and Temin, 1990) and c-yes (Matsuzawa et al., 1991). Furthermore, similar features are found in the genes for the extracellular matrix proteins laminin (Ogawa et al., 1988),elastin (Bashir et al., 1989) and SPARC/osteonectin (McVey et al., 1988). All collagen genes characterized so far, however, possess a canonical TATAA box which may position RNA polymerase I1 onto a single transcription-initiation site (Vuorio and de Crombrugghe, 1990). Recently, we have also characterized the promoter for the a2(VI) collagen gene (Koller et al., 1991). This promoter resembles the al(V1) collagen promoter with respect to the high GC content and the heterogeneous transcription-start site. Both genes possess a typical CpG island at their 5’ end (Fig. 4). Interestingly, this island is somewhat larger in the al(V1) collagen gene and extends into the second exon,

whereas the region around the second exon in the a2(VI) collagen gene does not exhibit an unusual CpG content. In their structural features, however, the two promoters differ remarkably from each other. Thus, a relatively large DNA fragment (621 bp) is required from the al(V1) collagen gene to achieve full promoter activity in transient expression assays. In the case of the rx2(VI) collagen gene, however, all promoter activity can be attributed to a short DNA fragment of only 213 bp. Furthermore, the two promoters do not share substantial similarity at the level of the nucleotide sequence. In fact, the similarity is mainly confined to the putative binding sites for transcription factor SP1 and does not exceed the similarity observed between a type-VI collagen promoter and the promoter of the epidermal-growth-factor receptor gene. Such a low degree of sequence similarity between the al(V1) and the a2(VI) collagen promoters is surprising in view of the fact that the two genes are coordinately expressed in all cell types tested so far (Schreier et al., 1988; Hatamochi et al., 1989; Heckmann et al., 1989). It would therefore be expected that the two genes are controlled by a common set of transcription factors which may interact with a common set of DNA motifs present in the two type-VI collagen promoters. Our preliminary results, however, do not support this conclusion. In a DNA-footprinting experiment performed with the al(V1) collagen promoter, we find at least five distinct sites distributed over 500 bp which are protected from DNAse-I digestion by nuclear factors. The a2(VI) collagen promoter, however, reveals only a single protected area in close proximity to the first transcription-initiation site by similar analysis (T. Willimann, unpublished results). Further experiments are therefore required to elucidate the mechanisms underlying the coordinate regulation of the al(V1) and the a2(VI) collagen genes.

774 Johnson, A, C., Shii, S., Jinno, Y., Pastan, I. & Merlino, G. T. (1988) Epidermal growth factor receptor gene promoter: deletion analysis and identification of nuclear protein binding sites, J . Biol. Chem. 263, 5693 - 5699. Kageyama, R., Merlino, G. T. & Pastan, I. (1989) Nuclear factor REFERENCES ETF specifically stimulates transcription from promoters without Aumailley, M., Mann, K., von der Mark, H. & Timpl, R. (1989) a TATA box, J. Biol. Chem. 264, 15508 - 15514. Cell attachment properties of collagen type VI and Arg-Gly-Asp Koller, E., Winterhalter, K. H. & Trueb, B. (1989) The globular dependent binding to its a2(VI) and a3(VI) chains, Exp. Cell Res. domains of type-VI collagen are related to the collagen-binding 181,463-474. domains of cartilage matrix protein and von Willebrand factor, Bashir, M . M., Indik, Z . , Yeh, H., Ornstein-Goldstein, N., RosenEMBO J . 8, 1013- 1017. bloom, J. C., Abrams, W., Fazio, M., Uitto, J. & Rosenbloom, Koller, E., Hayman, A. R. & Trueb, B. (1991) The promoter of the J. (1989) Characterization of the complete human elastin gene: chicken a2(VI) collagen gene has features characteristic of housedelineation of unusual features in the 5’ flanking region, 1. Biol. keeping genes and of proto-oncogenes, Nucleic Acids Res. 19, Chem. 264, 8887 - 8891. 485-491. Bird, A. P. (1987) CpG islands as gene markers in the vertebrate Maniatis, T. Fritsch, E. F. & Sambrook, J. (1982) Molecular cloning: nucleus, Trends Genet. 3, 342- 347. a laboratory manual, Cold Spring Harbor Laboratory Press, Cold Bonaldo, P., Russo, V., Bucciotti, F., Bressan, G. M. & Colombatti, Spring Harbor, NY. A. (1989) a1 chain of chick type-VI collagen: the complete cDNA sequence reveals a hybrid molecule made of one short collagen Mar, J. H., Antin, P. B., Cooper, T. A. & Ordahl, C. P. (1988) Analysis of the upstream regions governing expression of the chicken carand three von Willebrand factor type-A-like domains, J . Biol. diac troponin T gene in embryonic cardiac and skeletal muscle Chem. 264, 5575 - 5580. cells, J . Cell Biol. 107, 573 - 585. Bonaldo, P.. Russo, V., Bucciotti, F., Doliana, R . & Colombatti, A. Matsuzawd, Y., Semba, K., Kawamura-Tsuzuku, J., Sudo, T., Ishii, (1990) Structural and functional features of the a3 chain indicate S., Toyoshima, K. & Yamamoto, T. (1991) Characterization of a bridging role for chicken collagen VI in connective tissues, Biothe promoter region of the c-yes proto-oncogene: the importance chemistry 29, 1245- 1254. of the GC boxes on its promoter activity, Oncogene 6, 1561 Carter, W. G. (1982) Transformation-dependent alterations in glyco1568. proteins of the extracellular matrix of human fibroblasts: characterization of GP250 and the collagen-like GP140, J . Biol. Chem. Mavrothalassitis, G. J., Watson, D. K. & Papas, T. S. (1990) Molecular and functional characterization of the promoter of ETS2, the 257, 1 3 805 - 1381 5. human c-ets-2 gene, Proc. Natl Acad. Sci. USA 87, 1047- 1051. Chu, M.-L., Pan, T.-C., Conway, D., Kuo, H.-J., Glanville, R. W., Timpl, R., Mann, K. & Deutzmann, R. (1989) Sequence analysis McVey, J. H., Nomura, S., Kelly, P., Mason, I. J. & Hogan, B. L. M. (1988) Characterization of the mouse SPARC/osteonectin gene of al(V1) and u2(VI) chains of type-VI collagen reveals internal triplication of globular domains similar to the A domains of von intron/exon organization and an unusual promoter region, J . Biol. Willebrand factor and two cr2(VI) chain variants that differ in the Chem. 263, 11111-11116. carboxy terminus, EMBO J . 8, 1939 - 1946. Ogawa, K., Burbelo, P. D., Sasaki, M. & Yamada, Y. (1988) The Chu, M.-L., Zhang, R.-Z., Pan, T.-C., Stokes, D., Conway, D., Kuo, laminin B2 chain promoter contains unique repeat sequences and H.-J., Glanville, R., Mayer, U., Mann, K., Deutzmann, R. & is active in transient transfection, J . Biol. Chern. 263, 8384-8389. Timpl, R. (1990) Mosaic structure of globular domains in the Schreier, T., Friis, R. R., Winterhalter, K. H. & Trueb, B. (1988) human type-VI collagen a3 chain: similarity to von Willebrand Regulation of type-Vl collagen synthesis in transformed mesfactor, tibronectin, actin, salvary proteins and aprotinin type proenchymal cells, Biochem. J. 253, 381 - 386. tease inhibitors, EMBU J . 9, 385-393. Selden, R. F., Burke Howie, K., Rowe, M. E., Goodman, H. M. & Dynan, W. S. (1986) Promoters for housekeeping genes, Trends Genet. Moore, D. D. (1986) Human growth hormone as a reporter gene 2, 196-197. in regulation studies employing transient gene expression, Mol. Feinberg, A. P. & Vogelstein, B. (1983) A technique for radiolabeling Cell. Biol. 6, 3173-3179. DNA restriction endonuclease fragments to high specific activity, Timpl, R. & Engel, J. (1987) Type VI collagen, in Structure and Anal. Biochem. 132, 6- 13. function of collagen types (Mayne, R. & Burgeson, R. E., eds) pp. Graham, F. & van der Eb, A. (1973) A new technique for the assay 105- 143, Academic Press, Orlando, FL. of infectivity of human adenovirus 5 DNA, Virology 52, 456Trueb, B., Lewis, J. B. & Carter, W. G. (1985) Translatable mRNA 457. for GP140 (a subunit of type-VI collagen) is absent in SV40 transHannink, M. & Temin, H. M. (1991) Structure and autoregulation of formed fibroblasts, J . Cell Biol. 100, 638 -641. the c-re/ promoter, Oncogene 5, 1843- 1850. Trueb, B., Schaeren-Wiemers, N., Schreier, T. & Winterhalter, K. H. Hatamochi, A., Aumailley, M., Mauch, C., Chu, M.-L., Timpl, R. & (1989) Molecular cloning of chicken type-VI collagen : primary Krieg, T. (1989) Regulation of collagen VI expression in fibrostructure of the subunit aZ(V1)-pepsin, J . Biol. Chern. 264, 136blasts: effects of cell density, cell-matrix interactions and chemical 140. transformation, J . Biol. Chem. 264, 3494-3499. Hayman, A. R., Koppel, J., Winterhalter, K. H. & Trueb, B. (1990) Vuorio, E. & de Crombrugghe, B. (1990) The family ofcollagen genes, Annu. Rev. Biochem. 59,837- 872. The triple-helical domain of a2(VI) collagen is encoded by 19 short Walchli, C., Koller, E. & Trueb, B. (1992) Structural comparison of exons that are multiples of 9 base pairs, J . Biol. Chem. 265,9864the chicken genes for al(V1) and a2(VI) collagen, Eur. J . Biochem. 9868. 205, 583 - 589. Hayman, A. R., Koppel, J. & Trueb, B. (1991) Complete structure of the chicken a2(VI) collagen gene, Eur. J . Biochem. 197,177- 184. Weaver, R. F. & Weissmann, C. (1979) Mapping of RNA by a modification of the Berk-Sharp procedure: the 5’ termini of 15s P-globin Heckmann, M., Aumailley, M., Hatamochi, A., Chu, M.-L., Timpl, mRNA precursor and mature 10s B-globin mRNA have identical R. & Krieg, T. (1989) Down-regulation of the a3(VI) chain exmap coordinates, Nucleic Acids Res. 7, 1175-1193. pression by y-interferon decreases synthesis and deposition of Wells, R. D., Collier, D. A., Hanvey, J. C., Shimizu, M. & Wohlrab, collagen VI, Eur. J . Biochem. 182, 719- 726. F. (1988) The chemistry and biology of unusual DNA structures Ishii, S., Merlino, G. T. & Pastan, I. (1985) Promoter region of the adopted by oligopurine/oligopyrimidinesequences, FASEB J . 2. human Harvey ras proto-oncogene: similarity to the EGF receptor 2939 - 2949. proto-oncogene promoter, Science 230, 1378- 1381.

We thank Dr. A. Colombatti for providing the aI(V1) collagen cDNA probe. This work was supported by grants 31-9065.87 and 3130881.91 from the Swiss National Science Foundation.