IFN-y regulatory proteins

Eur. J. Immunol. 1992. 22: 2419-2428

David A. Browno, Kimi L. Kondo, Shen-Wu Wong and Don J. Diamond Division of Immunology, Beckman Research Institute of the City of Hope, Duarte

Characterization of nuclear protein binding to the interferon-y promoter in quiescent and activated human T cells* Nuclear protein binding to the human interferon-y (IFN-y) promoter was investigated to determine the structural basis for the control of gene expression during T cell activation. DNase I footprinting of gel-shift complexes demonstrated that proteins bind to two downstream (-124 to -114 and -36 to -30) and one upstream (-534 to -486) element in the IFN-y gene promoter. Treatment of human peripheral blood lymphocytes or continuous T cell tumors with phorbol 12-myristate 13-acetate (PMA) plus phytohemagglutinin or calcium ionophore results in a pattern of response that is similar when using either the upstream or downstream elements. Upon induction of T cells, the lower mobility gel-shift band disappears. Yet the equivalent band which is also present in non-T cells is unperturbed after PMA + calcium ionophore treatment. The higher mobility band which is modified upon induction is restricted to the T cell lineage. Upstream and downstream elements share similar protein-binding motifs as indicated by the homology of footprinted sequences, the similarity of proteinbinding patterns, and the ability of these elements to compete against each other in gel-shift protein-binding assays. Protein binding to the downstream elements appears to be interactive, since both sites are required for complex formation. When either of the two downstream elements is disrupted by site-directed mutagenesis, the higher mobility gel-shift band is diminished by an amount that is consistent with the reduction in reporter (chloramphenicol acetyltransferase) gene expression. Therefore, proteins in the ubiquitous gel-shift band appear to be associated with the inactive state of IFN-y, while the modified band is closely associated with the positive regulation of IFN-y gene expression. such as PMA + PHA, PMA + ionomycin, PMA CD3, or Con A IL-2 [3, 4,7].

1 Introduction Interferon-y (IFN-y) plays a central role in fighting disease since it has antiviral, antitumor and immunomodulatory activities (reviewed in [ l , 21). However, few details are available regarding the molecular mechanisms by which IFN-y expression is regulated in activated T cells. Previous studies have investigated the induction of IFN-y expression by either measuring the protein product [3, 41, or steady-state mRNA levels [5-71, or by means of nuclear run-on transcription assay [8]. These reports have shown that induction of IFN-y is restricted to CD3+ T cells and large granular lymphocytes [3, 41. Similar to IL-2, induction of IFN-y is maximal when it is induced by a dual signal

[I 10003]

*

2419

This work was partially supported by a grant from the NCI to DJD (CA.52177) and Cancer Center Core Grant to the City of Hope (CA33.572) and startup funds from the Beckman Research Institute Research Grant program. Supported by an NIH Senior Postdoctoral Fellowship (CA08869) from the NCI.

Correspondence: Don J. Diamond, Division of Immunology, Bcckman Research Institute of the City of Hope, 1450 E. Duarte Rd., Duartc, CA 91010, USA Abbreviations: CAT Chloramphenicol acetyltransferase HTLV Human T cell leukemia virus LTR: Long-terminal repeat TK: Thymidine kinase IgEn: Immunoglobulin enhancer CsA: Cyclosporin A

0 VCH Verlagsgesellschaft mbH, D-6940 Weinheim, 1992

+

+ anti-

The kinetics of IFN-y mRNA synthesis and decay closely parallel that of IL-2 mRNA, indicating that the control of IFN-y synthesis may be transcriptionally regulated in a similar fashion [7]. As further proof of the transcriptional level of control, DNase I hypersensitivity sites [9, 101 appeared within the gene in actively IFN-y-producing cell lines. Gene activity appeared to be influenced by DNA elements 5' of the transcriptional start site and within the first intron of the human gene [9-111. We [12] and others [13] have generated a set of deletions within 700 bp 5' to the transcriptional start site that defined several sites important in the regulation of human IFN-y expression. As a result of the promoter-deletion analysis of the IFN-y gene, evidence was obtained for both negative- and positive-regulatory elements [12, 131. Furthermore, the putative negativeregulatory activity within the IFN-y gene promoter (Fig. 1A) was shown to be countered by the co-transfection of the HTLV I or I1 tux gene product in the presence of PMA PHA [12].

+

However, none of these studies has examined the role of DNA-binding proteins in the control of IFN-y gene transcription. This information would be especially useful for understanding the regulation of IFN-y gene expression. Additionally, establishing a possible link between T cell activation and the positive regulation of many genes including those for several lymphokines, the IL-2R, and the HIV long-terminal repeat (LTR) would be invaluable for a better understanding of T cell development (reviewed in [141).

+

0014-2980/92/0909-2419$3.50 .25/0

2420

D. A. Brown. K. L. Kondo, S.-W. Wong and D. J. Diamond

I n this study, we use a combination of gel-shift assays, DNase I footprinting, and site-directed mutagenesis to demonstrate that proteins bind to at least three distinct elements in the regulatory region of IFN-y. Binding to two of these elements appears to be cooperative since proteins do not bind to either element unless both sequences are present. A third protein-binding element corresponds to the region affected by a combination of PMA + PHA and the HTLV I or 11tax gene product.We are able to show that a subset of the proteins binding to these elements areT cell specific, while others are seemingly ubiquitous. As expected, the protein binding patterns are modulated in T cells following activation, but not in other cell lineages.

2 Materials and methods

Eur. J. Immunol. 1992. 22: 2419-2428

100000 x g for 60 min. Suspensions prepared from 5 10y cells were shaken for 30 min on an Eppendorf model 5432 mixer and then centrifuged at 16000 x g €or 60 min in a microcentrifuge. Supernatants were collected and dialyzed for 16 h against SO vol of buffer C (20 mM Hepes pH 7.9, 0.1 mM EDTA, 75 mM NaCl, and 20 YO glycerol). Dialysates were centrifuged at 7500 x g for 10 min and the supernatants stored at -70°C until used in gel-shift assays or fractionated. Extracts were fractionated by application to a column containing 10 vol of heparin Sepharose CL-6B (Pharmacia) equilibrated with chromatography buffer CB100 (100 mM NaCl, 20 mM Tris, pH 7.9,O.l mM EDTA, and 10% glycerol). The sample was eluted in a stepwise fashion with 2 vol of CB100, and 1vol of buffers containing 300,400,600,1000, and 2000 mM NaCl and other components identical to CB100. These fractions were dialyzed against buffer C, centrifuged and stored as described above for unfractionated extracts.

2.1 Cell culture and treatments

2.3 Plasmid constructions and probe preparation Cell lines are described in Table 1. MOLT 4 and CEM cell lines were obtained from American Type Culture Collection (Rockville, MD). The Jurkat cell line was kindly provided by A. Weiss (University of California at San Francisco, San Francisco, CA), 577 (Jurkat subline) by G . Crabtree (Stanford Medical School, Palo Alto, CA), JY by T. Springer (Harvard Medical School, Boston, MA) EL4 by T. Taniguchi (Osaka University, Osaka, Japan), HeLa by I? Sharpe (MIT, Cambridge, MA), Peer and MOLT 13 by M. Brenner (Dana Farber Cancer Institute, Boston, MA), and C81-66-45 (C63\CRIl-2) by S. Salahuddin (National Cancer Institute, Bethesda. MD). Cell lines were cultured as previously described [12, 151. Cells (0.7 X 106 cells/ml) were exposed to 50 ng/ml PMA and 2 pg/ml PHA-P or 0.5 pg/ml A23187 (Sigma, St. Louis, MO) for 1 to 24 h as indicated. Human peripheral blood lymphocytes (PBL) were obtained from normal donors, and purified using Ficoll-Paque (Pharmacia, Uppsala, Sweden). The lymphocyte layer was removed by aspiration, washed twice with PBS, and resuspended to 2 X 106 cells/ml in RPMI 1640 containing 20 % heat-inactivated (60°C for 60 min) FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 pg/ml streptomycin sulfate, 30 U/ml rIL-2 (Cetus Emeryville, CA), and 50 p~ 2-mercaptoethanol (Sigma). Flow cytometry indicated that these PBL were 83 % CD3+ and 54 YO CD4+. Cultures were maintained for 16 h and then exposed to 10 ng/ml PMA and 1 pg/ml PHA-P for 5 or 24 h.

2.2 Preparation and fractionation of nuclear extracts Cells were harvested by washing twice with PBS. Pellets were resuspended in 10 vol of buffer A (300 mM sucrose, 10 mM Hepes pH 7.9, 10 mM KCI, 1.5 mM MgC12, 0.1 mM EGTA) and dounced 20 times with an A pestle (Wheaton, Milville, NJ). Buffer A and all buffers described below contained 0.5 mM DTT, 0.5 mM PMSF, and 2 pg/ml each of pepstatin, leupeptin, and antipain. Nuclei were pelleted by centrifuging at 400 x g for 10min. Pellets were resuspended in 10vol of buffer B (10mM Hepes, pH 7.9, 400 mM NaCl, 1.5 mM MgC12, 0.2 mM EGTA, and 5 YO glycerol) and were dounced 20 times with a B pestle. Suspensions prepared from 2 lo9 cells were mixed €or 30 min with a stirring bar and then centrifuged at

Construction of promoter-less vectors containing the chloramphenicol acetyltransferase (CAT) gene, the polyadenylation site of the HSV TK gene, and sequential deletions of the regulatory region of IFN-y are described in Brown et al. [12]. Construction of the pRSV-luciferase plasmid is described in [ 161. Gel-shift probes were prepared as follows. Sequentially deleted 5’-flanking IFN-y fragments were excised from CAT plasmids using Bam HI (5’) and Xba I (+78). Upstream probes (Fig. 1) were excised with an additional cut at -221 (Bst XI). Downstream probe Df (Fig. 1) was excised with an additional cut at -48 (Sau I). Downstream probe De (Fig. 1)was constructed by harvesting plasmids from dam- E. Coli and excising with Bam HI (5’) and Bcl I (+ 13).The immunoglobulin enhancer (IgEn) probe was excised with Pvu I1 and Ppu MI, which cut at nucleotides 385 and 586, respectively, of the IgEn fragment described by Gillies et al. [17]. Probes were separated on 5 YOpolyacrylamide: bis (20: 1) gels and electroeluted into an 1x0 1750 concentration well containing 25 pg tRNA. Probes were labeled with [a-”P] dNTP using Klenow fragment of DNA polymerase (NEB, Waltham, MA) [MI, and separated from free [ c L - ~ dNTP ~ P ] by Sephadex (3-50 chromatography. Probes for footprinting were labeled by Bam HI digestion of -595, -181 and -137 to +78 IFN-y sequential deletion mutants followed by 5’-labeling of the coding strand with [y-”P] ATP and Tbkinase, and the noncoding strand with [ c L - ~ dNTP ~ P ] and Klenow. Probes were then excised with Xba I (-181 to +78 and -137 to +78 IFN-y) or Hinc I1 (-595 to -312 IFN-y), separated on polyacrylamide gels, and electroeluted as described for gel shift probes. A portion of probes were subjected to Maxam-Gilbert G and G + A sequencing reactions [19]. 2.4 Gel-shift assays

Gel-shift assays were done as described in Singh et al. [20]. Briefly, nuclear extracts were incubated with labeled probe at room temperature for 30 min. Reaction mixtures were run on 4 % acrylamide: bis acrylamide (29 :1) gels for 3.5 at 7 V/cm. Gels were dried and autoradiographed. Protein

IFN-y regulatory proteins

Eur. J. Immunol. 1992. 22: 2419-2428

and dIdC concentrations were titrated so that for each experiment, a substantial portion of free probe remained in each gel-shift lane. Results of some gel-shift assays were quantified using a scanning radio-densitometer (AMBISTM).

2421

activity was corrected for transfection efficiency by normalizing to luciferase measurements.

3 Results 3.1 Time course

2.5 DNase I gel-shift footprinting The footprinting procedure employed gel-shift assays and was a modification of the procedure used by Singh et al. [20]. All gel-shift assays for footprinting used fractionated extracts. After a 30-min incubation of gel-shift reaction mixtures at room temperature (22 "C), MgClz and CaC12 were added to final concentrations of 5 and 2.5 mM, respectively. Then DNase I (Promega, Madison, WI) was added to a final concentration of 0.005 U/pl and reaction mixtures were incubated for 2 min. EDTA and EGTA were added to final concentrations of 10 and 5 mM, respectively, to stop reactions. Samples were run on gels as described, but film was exposed to undried gels. Protein-bound- and free-probe gel-shift bands were excised and soaked in 1 ml of proteinase K (100 pg/ml) in buffer (10 mM Tris, pH 7.9, 5 mM EDTA, and 0.5 %I SDS) for 30 min at 37°C. Probes were electroeluted as described above for gel-shift probes, with the modification that eluants were treated with 10 pg/ml RNase A (for 10 min at 37°C) prior to phenol/chloroform extraction. These probes and MaxamGilbert reaction mixtures were counted on a Packard 1600CA TRI-CARB scintillation counter and dissolved in Sequenase stop solution at 2500 c p d p l . Three microliters of each was loaded onto 8% acrylamide: bis acrylamide (20 : 1)denaturing gels. Gels were run at 50 W, fixed in 10 % acetic acid, dried and autoradiographed. 2.6 Site-directed mutagenesis Site-directed mutagenesis was done as described by McClary et al. [21] except that E. Coli strain MC1061 was used instead of MV1190. Briefly, D probe (Fig. 1) was cloned into pTZ19U and the construct was transfected into dut ung strain CJ236. Single-stranded DNA was prepared and annealed with mutagenic oligonucleotides designed according to Sambrook et al. [18] and synthesized on an ABI 380B DNA synthesizer.These were: M1: TTAGTTATCAATACAAAC; M2: AAAACCTTAGTTATCCATACA A ACTATCAT M3: CTCAGGAGACTTCCCTTAGGTATAAATACC; and M4: AGACTTCAATTAGGCACACATACCAGCAGCCA. The complementary strand was synthesized byT4 DNA polymerase and ligated byT4 DNA ligase. The product was transfected into MC1061. The mutated strand was confirmed by sequencing, and was then excised for gel-shift assays and reinserted into the CATcontaining plasmid. 2.7 Transfections and CAT assays

Transfections and CAT assays were essentially done as described previously [12, 151. CAT activity was measured using 50 pg of protein as described by Sambrook et al. [18]. Luciferase activity was measured for five replicates using 5 pg of protein with a luminometer (Analytical Luminescence Laboratories) as described by de Wet et al. 1161. CAT

Previous studies utilizing CAT assays have shown that the 595 nucleotides immediatley 5' of the start site of transcription of the IFN-y gene contain all of the DNA elements found necessary to regulate its promoter in human peripheral T lymphocytes [11]and the Jurkat humanT cell line 1121. We used this region to construct a series of probes (Fig. 1) to explore whether any protein: DNA complexes were formed in the relevant areas of the inducible promoter following activation of T cells. Since earlier work had shown that the synthesis of IFN-y is tightly regulated at the mRNA level [7, 81, we examined whether the formation of these protein: DNA complexes on the inducible promoter were time dependent. A 365-bp downstream probe (probe D, Fig. 1A) was made, since this corresponds to the smallest promoter segment that responds well to induction by PMA + PHA when present in a CAT-expression plasmid [12]. Incubation of probe D with nuclear extracts from uninduced Jurkat cells, or those induced suboptimally with PMA PHA (I 3 h) resulted in a pair of bands (bands A and B) in gel-shift assays (Fig. 2A). Following 4 to 6 h of induction with PMA PHA, band A was absent but a diminished lower band (band C) appeared in place of band B. This period of induction corresponds to the time period when IFN-y mRNA levels are at their highest (Brown and Diamond, unpublished observations, and 171). The subsequent 8- to 24-h induction resulted in the elimination of any gel-shift bands using probe D, paralleling the virtual disappearance

+

+

A

u site I

D1 Site D2 Site TATAA

\ \F-

I I

II

-595 -5i4 -486 -595

111

-124 -36

U Probe

M Probe

1

+78

-221

- 360-221 -287

6

DProbe

+78

Upstream Ua

-492 Ub -221 -427 -221 -36OA-221

Downstream -137 +78 -95 -65-45De Dd +78 -137+13 -137Df -48

Do", l8 '8

Figure 1. Probes used for gel-shift assays. (A) A 595-bp region of the IFN-y promoter contains elements necessary for induction and repression of gene expression [4]. The locations of the U, D1 and D2 protein binding sites characterized in this study are indicated. The upstream (U probe), midstream (M probe) and downstream (D probe) are shown below. (B) The upstream and downstream deletion probes used to localize the regions of protein binding in the U and D probes.

2422

A

D. A. Brown, K. L. Kondo, S.-W.Wong and D. J. Diamond U Probe

D Probe

We also explored whether there were DNA: protein interactions within the segment containing an upstream regulatory element as defined by CATanalysis [ll,121. A pair of gel-shift bands (bands A' and B') were found when a 374-bp upstream probe (probe U, Fig. 1) was incubated with nuclear extracts from uninduced Jurkat cells or those induced with PMA PHA for up to 3 h (Fig. 2A). The intensity of these bands diminished sharply from 3 to 4 h, and they were absent following 8 or more hours of induction. A midstream probe (probe M) encompassing nucleotides -360 to -221 of the IFN-y promoter (Fig. 1A) showed no protein binding within any time period in gel-shift assays (Fig. 2A), thereby demonstrating that bands A' and B' bound probe U upstream of -360. This corresponds to the region shown by CATanalysis to contain a negative regulatory element that could be transactivated by the HTLV I or I1 tux gene products when the element was concomitantly activated by PMA + PHA [12].

n'

A B

B

D Probe

U Probe

A

A

B

B

+

IgEn Probe

M Probe

B

of IFN-y cytoplasmic mRNA (Brown and Diamond, unpublished observations, and [7]).

012345681224hrs

0 1 2 3 4 5 6 81224hrs

C

D Probe J77

Peer

Molt13

C81

Molt4 CEM

PBL

A

B PC

ILZ Probe

IgEn Probe

EL4

JY

Hela

U

Figure 2. Characterization of gel-shift bands. (A) The protein binding patterns of the D, U, M (Fig. 1A) and IgEn probes following induction of the Jurkat T cell line with PMA PHA for 0 to 24 h. Bands A, B, A' and B' are protein: DNA complexes resulting from incubation of D and U probes with nuclear extracts from suboptimally ( 53 h) induced Jurkat. Band C is present during the period of maximal IFN-y induction.The M probe shows no significant protein binding. The IgEn probe indicates that protein concentrations in extracts were similar from 0 t o 12 h . All gel-shift assays used 0.75 pg protein and 1.25 pg dIdC. (B) The effect of CsA on protein binding patterns. Concomitant treatment with CsA (P/P/CsA) prevented changes of protein binding to D and U probes induced by PMA + PHA (P/P). Similar results were obtained for a -165 to +42 TL2 probc.The IgEn probe indicated that protein concentrations were the same for all treatments. Treatments wcre for 5 h. All gel shift assays used 6 yg protein and 3 pg dTdC. (C) The tissue specificity of gel-shift bands. Treatments with PMA PHA (P/P) or PMA + A23187 (P/A) were for 5 h except for PBL which were instead treated for 24 h (PIP*). Extracts from all untreated cells formed protein: DNA complexes resulting in gel-shift band A, but only cells of the T lineage (see Table I) resulted in gel shift band B and induction-related alterations of gel-shift bands A and B. Gel-shift band A was not altered in the prc-T cell line C81, the murineT cell line EL4, the B cell line JY, or the epithelial cell line HeLa. Treatment of PBL for 24 h ( P P ) resulted in an intense band (PC). Gel-shift assays with 577, Peer and PBL used 5.0 yg protein: 2.5 pg dIdC; MOLT4, CEM and EL4 uscd 0.75 pg protein: 1.25 pg dIdC; MOLT 13 used 2 pg protein: 1.25 pg dIdC; C81 used 10 pg protein: 5 yg dIdC; JY used 6 yg protcin: 3 pg dIdC; and, HeLa used 2.5 pg protein: 1.25 pg dIdC.

+

+

Eur. J. Immunol. 1992. 22: 2419-2428

To verify that diminished protein binding to IFN-y probes was a result of T cell activation events and not of diminished protein concentrations in the extracts, a 200-bp fragment of the murine heavy chain IgEn was used in gel-shift assays [22].This DNA fragment binds ubiquitous proteins in most human and murine cell lines [22]. Our results show that protein binding to the IgEn probe remained unchanged from 0 to 12 h of induction with PMA + PHA, but decreased somewhat following 24 h of treatment. Therefore, during the period of the time course where the major IFN-y promoter DNA: protein binding changes occurred, the levels of the IgEn-binding protein(s) were not demonstrably altered.

3.2 Effect of cyclosporin A (CsA) treatment Previous studies have shown that CsA treatment of human PBL inhibits both I F N y and IL-2 gene expression at the level of mRNA synthesis [7, 8,231. Our previous data have suggested that CsA functions at the pre-transcriptional level, to inhibit inducible CAT expression directed by the human IFN-y promoter in the Jurkat cell line [12]. We tested both IFN-y and IL-2 probes to compare the response of both genes to the action of CsA upon induction with PMA PHA. We found that PMA PHA treatment resulted in the disappearance of a pair of gel-shift bands associated with probe D, probeU, and the IL-2 probe, however simultaneous treatment with CsA inhibited the disappearance of these bands (Fig. 2B). Therefore, the DNA-binding proteins examined here respond to CsA treatment as would be expected if they were involved in the transcriptional control of IFN-y mRNA synthesis.

+

+

3.3 Tissue specificity

A panel of T and non-T cell lines as well as PBL from normal human donors (Table 1) was examined using gelshift assays to determine if nuclear protein binding to the IFN-y promoter is tissue or lineage specific (Fig. 2C). All of the cell lines examined formed nuclear complexes resulting in gel-shift band A , however, only cells from the T lineage

Eur. J. Immunol. 1992. 22: 2419-2428

I F N y regulatory proteins

resulted in gel-shift band B. In addition, only cells from the T lineage showed responses of gel-shift bands A and B to induction. These changes were evident in human cells from both the u/fi (CEM, MOLT4, Jurkat) and y/6 (Peer, MOLT 13) lineages. However, the murine thymoma cell line EL4 showed no responses of bands A and B to Table 1. Comparison of the cell lines used in this studya)

Ccll Line

Origin

Cell CD3+ af3

yS

Ref.

+ + +

-

[26,28] [27,29,30] [27,31.32] [%,27,31) 1331 [341 ~351 [151 1311

ALL T ALL T ALL T ALL T T ALL M L T FB preT B EBV E CC

Jurkat

Peer MOLT4 CEM MOLT13 EL4 C8 1 JY HeLa

+ +

-

+

+ + -

+

+

-

+

+

-

-

-

-

+1-

i1

-20-

-40-

ID2 -40-

-60-

-60-

-80-

-80-

-100-

-100-

-120-

140-

-137

NC

+78

-137

-360-

-360-400-

-440-

-440-

-480-

-480-

-500-

-500-

DPSite t1-

20-

20-

rn

-

40-

U Site 60-

60-

I

I -540-

D1 Site

-

C A A T T A G - ~ -124'IAGTTATTI~T-~,~ -36 GTTAATC AICAATAAITA U

D2

40-

IU

U -520-

+?8

o$arnu&! tl-

1

I -520-

-540-

c

To further characterize the gel-shift bands formed with Of the IFN-?I promoter, we carried Out heparinSepharose StepWiSe-salt fractionation Of IlUClear extracts from untreated and induced Jurkat and PBL cells. Each salt

-400-

lo1

-120-

140-

B

ID2

induction. Uninduced human PBL exhibited gel-shift bands similar to those for cells of the Tcell lineage. Furthermore, induction of PBL for 24 h resulted in a distinct nuclear complex that we subsequently have shown to fractionate and footprint similar to Jurkat band C (Fig. 3). Extracts from non-T cell lines, such as JY (an EBV-transformed B cell), HeLa (an epithelial carcinoma cell), and a pre-T cell (C81), resulted in a single nuclear complex (band A) upon gel-shift analysis. This complex was unchanged after induction by PMA + calcium ionophore or PHA (Fig. 1C).Tentatively,we can assign band B as a T lineage-specific complex, while band A seems to be present in most cell types tested, and may be related to the inactive state of the gene. Finally, since the intensity of band Cis far less than that of bands A or B (except PBL),we only consistently observed it after fractionation of nuclear extracts on heparin-Sepharose (see below). 3.4 Fractionation of nuclear extracts

a) ALL: Acute lymphoblastic leukemia; ML: mouse lymphoma; FB: fetal blood; EBV: Epstein-Barr virus transformed; CC: cervical carcinoma; E: epithelial

-20-

2423

-

A ~ C ATTTGA A AACITGIGGIAGATAITTIACIA~CCAACT~GAAG TCGTTAAACTTTGAACACCATCTATAAAATGAIIGGTTGAGACIACTIC

-534

-515

-486

Fzgure 3. DNase I footprinting analysis. Protein: DNA complexes were treated with DNase I, separated from free probe by gel shift, clectroeluted and run on 8 Yo acrylamide: bis acrylamide (20 :I) denaturing gels. (A) Gel-shift bands B, C, and PC resulted in footprints at 124 to -114 (D1 site) and -36 to -30 (D2 site) on noncoding (NC) and coding (C) strands of a -181 to +78 IFN-yprobe. Gel-shift band A resulted in a 1-bp diminution at the D1 site on the C strand. (B) Gel-shift bands B, C and PC resulted in footprints at the D2 site on both NC and C strands, whereas band A resulted in no footprint at the D2 site. (C) Gel-shift bands B', C', and P C resulted in extensive footprints (U site) bctween -534 and -486 on both NC and C strands of a -595 to -312 IFN-y probe, whereas band A' resulted in no discernible footprint. Regions of the U site that show homology with the D1 and D2 sites are indicated by double bars. (D) Footprinted sequences at the U site showing homology with the D1 site (7/8 bp) and the D2 site (6/7 bp) are indicated by a double bars over the U site. Amounts of protein and dIdC used were similar to those given in Fig. 4A and B. ~

2424

fraction gave similar patterns of mobility of gel-shift complexes for downstream (probe D) and upstream (probe U) probes. Bands A and A’ from untreated Jurkat cells partitioned into the 600 mM salt fraction, while bands B and B’ partitioned into the 300 mM NaCl fraction (Fig. 4A, B).The 300 mM salt fraction of a nuclear extract from .lurkat T cells induced for 5 h resulted in a similar gel-shift band using either probe D (band C) or probe U (band C’; Fig. 4A,B). Bands C and C‘ appear to have a slightly higher mobility that bands B and B’ in gel-shift assays. Finally, as expected from the experiments shown in Fig. 2, no bands were apparent in the 600 mM fraction from 5 h-induced Jurkat cells (Brown and Diamond, unpublished observations).

+

Fractionation of PBL induced with PMA PHA for 24 h resulted in gel-shift bands PC (probe D) and PC’ (probe U), both of which partitioned into the 300 mM NaCl fraction (Brown and Diamond, unpublished observations). Even though the time course of appearance of the two complexes is different between the Jurkat cell line (Fig. 2A) and PBL (Fig. 2C), the similarity of gel-shift mobility and salt fractionation properties of bands C and PC suggested they may bind similar promoter elements. As a result, we carried out deletion studies coupled with gel-shift analysis (see below) to localize the region(s) where the respective complexes form. A

A

Eur. J. Immunol. 1992. 22: 2419-2428

D. A . Brown, K. L. Kondo, S.-W.Wong and D. J. Diamond

Untreated

Untreated

5 hr PMA/PHA

600 mM NoCI

300 mM NoCl

300 mM NoCI

n8%XXE

o8%BX6 B

nB%B C

3.5 Deletion studies Our previously studied IFN-y promoter-CAT fusion plasmids [12] were further utilized in defining the binding domains of the nuclear complexes we observed using gel-shift analysis. The IFN-y promoter segments were excised from the CAT fusion plasmids, and the purified DNA was incubated with nuclear extracts as previously described, Probe D and probe Da, a 5’ (- 137) deletion of probe D (Fig. l), resulted in virtually identical gel-shift bands when incubated with the salt fractions described above (Fig. 4A). However, further 5’ deletion to either -95, -65 or -45 resulted in little or no complex formation (Fig. 4A). The correspondence in the binding of bands A , B, and C to deletion probes suggests that these protein complexes bind to very similar sequence elements (Fig. 4A). The 5’ deletion analysis of the upstream probe U showed results similar to those obtained using the downstream probe D (Fig. 4B). Each salt fraction produced gel-shift complexes with similar patterns of mobility for probes D and U (compare bands A, B, C with A’, B’, C‘; Fig. 4A, B). Analogous to our findings with probe D, all gel-shift complexes seem to bind t o the same region within probe U. 5’ deletion analysis of probe U showed that band A’ bound upstream of -427 while bands B’and C‘ bound upstream of -492 (Fig. 4B). Therefore, 5’ and 3’ deletion analysis of probeU showed that bands A’, B’, C, and PC’ bound between -551 and -458 (Fig. 5, and Brown and Diamond, unpublished data).These results suggest that the pattern of complex formation on the U and D IFN-y, promoter fragments is similar (see below). To examine the 3’ sequence requirements for complex formation with probeD, we deleted probe Da to t-13 (probe De, Fig. 1B). As expected, there was no discernable difference in complex formation between probe De (Fig. 5 and Brown and Diamond, unpublished observa-

Probe D e , /

s 8’ ,

Figwe 4. Gel-shift patterns using fractionated proteins. Proteins from untreated and PMA + PHA-induced Jurkat were eluted from a hcparin-Sepharosc column using a stepwise NaCl gradient. Proteins that formed gel-shift bands A and A’eluted in the 600 mM NnCI iraction, while proteins that formed gel-shift bands B, B’, C and C eluted in the 300 mM NaCl fraction. (A) 5’ deletions of probc D (Fig. 1B) showed that proteins in gel shift bands A , B, and C bound between -137 (probe Da) and -95 (probe Db), but 3’ deletions of probe Da indicated that proteins were not bound to the region between -137 and -95 if sequences downstream of -48 were deleted (probc Df). Gel-shift assays used 5 pg protein and 3.75 (band A1 or 2.5 (bands B and C) pg dIdC. (B) 5’ deletions of probc U (Fig. IB) showed that proteins in band A’ bound between -492 (Ua) and -427 (Ub),while proteins in bands B’and C‘bound between -595 (U probc) and -492 (probe Ua). Gel-shift assays used 2 png protein (band A’) or 1.5 pg protein (bands B’ and C’), and 1 vg dIdC (band A’) or 1.5 pg dIdC (bands B and C).

No Cornp

l o o x Ud

1OOx Ub

‘ 4 Probe 1Probe

+

De

Fr

C

Fr PC

Ud

*

Fr C

Probe Ud

1

Fr PC

IOOx De

1

lOOx D e M2M3

Figure 5. Competition analysis using the protein binding fragments of the U and D probes. Proteins in bands C and PC are competed from labeled probe D e (-137 to +13) and proteins in bands C‘and PC‘ are competed from probe Ud (-551 t o -458) by a 100-fold molar excess of unlabeled probes De and Ud, but not unlabeled probe Ub (-427 to -221) or probe De mutated at both the D l (M2) and D2 (M3) sites. Gel-shift assays used 1.25 wg protein and 1.25 pg dIdC (bands C), 1.5 pg protein and 1.25 pg dIdC (band PC), 2.5 pg protein and 1 pg dIdC (band C ) , or, 3.75 pg protein and 1 pg dIdC (band PC‘).

IFN-y regulatory proteins

Eur. J. Immunol. 1092. 22: 2419-2428

tions) and the larger probe Da (Fig. 4A). Probe De was further deleted at the 3' end t o -48 (probe Df, Fig. lB), while maintaining a 5' end identical to probe De (Fig. 1). Surprisingly, this probe did not support complex formation, even though it contained the sequences between -137 and -05 shown to be essential by our 5' deletion studies (Fig. 4A). These results suggest that complex formation with probe De may also require sequence contribution from the 3' end of the fragment for the 5' end to be effective in protein binding. To reconcile how probe De but not probe Df was able to bind protein complexes, we conducted DNAse I footprinting and other analyses on the relevant regions (see below).

2425

C' and P C footprints indicates that protein: DNA complexes also may be very similar for PBL and Jurkat in the region defined by probe U (Fig. 3C). In fact, comparison of the sequence of footprint sites D1, D2, and U reveals a short sequence similarity among them (Fig. 3D). The similar gel-shift mobility patterns using upstream and downstream probes, as well as their ability to compete against each other with the same protein fractions (see below), indicates a functional similarity between them.This is further supported by the finding that mutation of the D 1 and D2 sites in probe De (-137 to +13) eliminates the ability of this probe to compete against the upstream probe Ud (-551 to -458) which encompasses the U site (Fig. 5).

3.6 Footprinting 3.7 Site-directed mutagenesis DNAse I footprinting studies were done to provide more detailed information concerning the nature of the binding motifs for the protein complexes we have found. We took advantage of the property of the gel-shift technique so that footprinting would be specific for the protein: DNA complexes discussed above. Protein-DNA complexes were treated with DNase I, separated from free probe by gel shift and the individual bands were electroeluted. The complexes were phenol extracted, and subsequently separated on denaturing polyacrylamide gel to determine the regions of protection. Preliminary studies using end-labeled probe D provided evidence that gel-shift bands B, C, and PC resulted in two footprints within this fragment (Brown and Diamond, unpublished observations). As a result, we chose to examine two separate end-labeled probes that would aid in identifying more clearly both footprinted regions (Fig. 3A, B). Site D2 is clearly shown using probe Da (-137 to +78), whereas site D1 is best shown using the slightly larger fragment (-181 to +13) in Fig. 3A. The pattern of protection is slightly different for each complex B, C, and PC (Fig. 3A,B)*. For example, the footprint at site D 1 obtained from band PC is slightly more extensive than that from band C. Nevertheless, at both sites D 1 and D2, the footprinted regions for bands B, C, and PC overlap, which provides evidence that the protein: DNA complexes are similar in PBL and the human continuous tumor cell line, Jurkat. It is also significant that the double footprint was found for both Jurkat and PBL nuclear complexes. Possibly, the D2 footprint (Fig. 4B) may explain the necessity of sequence 3' of -48 to maintain the integrity of the nuclear complexes over the D1 site (Fig. 4A) or vice versu. We also made an upstream probe for DNase I footprint analysis, and similar to the downstream probe, we found that gel shift bands B', C', and P C footprinted the same region (Fig. 3C, D). In contrast, gel-shift band A' resulted in no discernable footprint (Fig. 3B).The similarity of band

*

Gcl-shift band A resulted in only a single base diminution at the D1 site on the coding strand (Fig. 3A), and repeated DNase I gel-shift footprinting attempts revealed no other areas of protection (Brown and Diamond, unpublished results). However. a gel-shift footprinting procedure, using Cu-phenanthroline [24] instead of DNase I, showed a more extensive footprint for gel-shift band A at the D1 site on both noncoding and coding strands (Brown and Diamond, unpublished results).

To determine the functional significance of protein: DNA complexes (Fig. 3 and 4), we disrupted protein binding by base substitution and examined the effect on promoter activity.We reasoned that alteration of either the D1 or D2 sites might be sufficient to alter complex formation using the De fragment (Fig. 6). Shown in Fig. 6D are the sequence alterations we used in an attempt to disrupt site D 1 (M1 and M2), as well as site D2 (M3). As a control we mutated the TATAA box (M4) as shown in Fig. 6D, with the expectation that promoter function would be severely affected. In all cases, the mutated promoters were reinserted into the pOCAT expression plasmid and tested for functional expression by transfection into Jurkat T cells with and without PMA + PHA induction (Fig. 5C).

A

0

'-

0

-2

m" v 30

-a

B

6 -

ImndPC

%

6

20

20

:

10

10

0

0

s

s

N

C

IBOndC

30

M1

M2

M3

N

M4

M1

M2

M3

M4

D -124

N' M1: M2

-114

TAGTTATTAAT TAGTTATCAAT TAGTTATccAT -36

N M3 M4

CAATTAGGTAT~? CGGTTAGGTATAA

CAATTAGGcAcAc

Figure 6. Effect of site-directed mutagenesis at the D1 site (M1 and M2), the D2 site (M3), and theTATAA box (M4) on D probe gel-shift bands and CATactivity. (A) Mutations M1 to M4 have a much greater effect on gel-shift band B than on gel-shift band A . Gel-shift bands were quantified by radio-densitometry. The standard errors of the measurement ares shown. Gel-shift assays used 1.5 pg protein (band A) or 0.5 yg protein (band B), and 1.25 kg dIdC. (B) Mutations M1 to M4 sharply reduce gel-shift bands C and PC. Gel-shift assays used 0.5 pg protein (band A) or 0.75 yg protein (band PC), and 1.25 pg dIdC. (C) Mutations M2 and M4 sharply reduce CAT activity whereas M1 and M3 have a lesser effect. The standard errors of the measurement corrected for transfection efficiency measured by cotransfection of pRSVluciferase) are given. (D) Comparison of mutations M1 to M4 to the normal (N) sequences in D probe.

2426

D. A . Brown, K. L. Kondo, S.-W.Wong and D. J. Diamond

Extracts from induced and uninduced Jurkat cells and PBL were all incubated with unmutated (N) and mutated (M1-M4) I F N y promoter fragment De, and the gel-shift bands were quantitated using the AMBIS radio-densitometer (Fig. 6A,B). Gel-shift bands B, C and PC show a dramatic reduction of complex formation as a result of mutations M1-M4. Mutations either in site D1 or D2 were almost equally effective in disrupting induced complexes. A somewhat different story emerges when band A (Fig. 6A) is analyzed, which is a protein complex likely to be associated with the off-state of the IFN-y gene (Fig. 2A, C). Band A is not reduced as much as bands B, C, or PC when the unmutated form (N) is compared to any of the mutated forms (M1-M4). Interestingly, in all cases (bands A, B, C, or PC) the triple mutation in the TATAA box (M4) was partially effective in abrogating the protein complexes.The D2 site is situated 1-2 bp from theTATAA box, so it is possible that it also functions in stabilizing upstream interactions with site D1. These mutations provide further evidence that the gel-shift complex formed on probe De necessitates the participation of sequences at two different positions within the fragment. We also carried out transient transfection studies using the mutated promoter elements in the pOCATvector as shown in Fig. 6C. As expected, only the cells treated with PMA + PHA show an effect of using the mutated promoter compared to the normal unmutated D1 and D2 sites.The double mutation in site D1 (M2) disrupts promoter activity as effectively as the reduction in protein binding shown in Fig. 6A,B. The single mutation in site D1 (M1) and the double mutation in site D2 (M3) are less effective at reducing promoter activity. As expected, the triple mutation in the TATAA box (M4) severely affected promoter function. Neither the unmutated or the whole series of mutant promoters show significant activity without induction (Fig. 6C).These results show that disruption of nuclear protein binding at either site D1 or D2 coincides with the reduction of functional promoter activity in induced Jurkat cells. 3.8 Competition analysis To determine if the binding motifs contained in probes U and D interacted with similar protein complexes,we carried out a series of competition studies. Competition analysis utilized labeled probes De (-137 to +13) and Ud (-551 to -458) that contained downstream- and upstream-footprinted sequences, respectively.These were incubated with unlabeled probes as described below, and examined using fractionated extracts that included bands A, B, C, and PC (Fig. 5 , and Brown and Diamond, unpublished observations). When probes De or Ud were incubated with a 100-foldmolar excess of unlabeled IgEn probe (Brown and Diamond, unpublished with a 100-fold molar excess of unlabeled IgEn probe (Brown and Diamond, unpublished observations), or, probe Ub (-427 to -221) that constituted sequences between footprinted regions, there was no significant reduction in the intensity of bands A , B, C or PC (Fig. 5). As expected, the unlabeled forms of probes De or Ud in 100-fold molar excess were able to compete against their respective labeled counterparts to virtually eliminate the gel-shift bands. In addition, 100-fold excess cold De probe competed against labeled Ud probe about as well as

Eur. J. Immunol. 1992. 22: 2419-2428

against itself. Although, cold excess Ud probe only slightly diminished the signal from labeled probe De. However, incubation of labeled probe De or Ud with a 100-fold molar excess of unlabeled probe De containing mutated D1 and D2 sites resulted in little or no reduction of gel-shift bands. The ability of upstream and downstream probes to compete with each other for protein binding provides further evidence that upstream and downstream binding motifs share some functional binding homology. The inability of the downstream probe mutated at both the D1 and D2 sites to compete with either probe De or Ud for bound proteins (Fig. 6E) provides evidence that the footprinted sequences that are homologous in the D1, D2 and U sites (Fig. 3D) provide the basis for this functional binding homology. Interestingly, a downstream probe from -129 to -98 within the IFN-y promoter, which contained the D1 site (Fig. 1)when present at a 100-fold molar excess, resulted in no competition of bands A , B, C or PC from radioactive probe De (Brown and Diamond, unpublished observations). This provides further evidence that protein: DNA complex formation with probe De requires sequences from both the 5’ and 3’ ends of the IFN-y D promoter probe.

4 Discussion Transcription from the IFN-y gene is restricted to T lymphocytes and to NK cells (reviewed in [1, 2]), and only upon activation of these cells, such as in an immune response, is there significant RNA synthesis and production of the lymphokine product [7, 141. As has been previously documented, a program of gene activity ensues after T cell activation that lasts for approximately 8 h and that culminates with the return to a state of inactivity of the I F N y gene [7]. In either the peripheral blood, antigenspecific T cell clones, or tumor lines such as Jurkat, the IFN-y gene remains inactive until the cell is activated. This control may take place at more than one location within the promoter, as evidenced by the multiple protein: DNA interactions that we have characterized (Fig. 3, 4, 6). The complexity of the regulation is illustrated by the fact that the interaction sites of the induced (band C or PC) and non-induced (band A or B) protein: DNA complexes occur in similar overlapping regions of the promoter. This situation may have evolved to control the response of the gene to external factors more tightly. Examination of several different cell lines (Fig. 2C) indicate proteins constituting gel-shift band A may be ubiquitous and associated with the inactive state of the IFN-y gene. Gel-shift band A was present in all uninduced cell lines tested, but absent in extracts from induced human T cells. As a further test of the association of gel-shift band A with the inactive state of the IFN-y, gene, we treated Jurkat cells with CsA which inhibits IFN-y gene expression [7] combined with PMA PHA. CsA completely inhibited the changes in nuclear protein binding that we have shown to coincide with induction (Fig. 2B). Therefore, the activity of pharmacological agents such as CsA may be mediated in the case of the IFN-y gene by the nuclear complexes we have identified as bands A , B, C and PC.

+

Our findings indicate that the nuclear complexes which bind to the IFN-y promoter are modulated during T cell

Eur. J. Immunol. 1992. 22: 2419-2428

activation. More provocatively, our results also suggest that the ability of the protein: DNA complexes to modulate transcription is dependent on at least two separate but interacting DNA elements. We have demonstrated that protein binding to the downstream portion of the IFN-y promoter is dependent upon the integrity of both the D 1 and D2 sites. The evidence for this is: (a) bands B, C, and PC will bind to an intact De fragment but not to either portion after restriction enzyme digestion between proteinbinding domains (Fig. 4A), (b) a single band (B, C, or PC) from a gel shift produces footprints at both the D 1 and D2 sites (Fig. 3A,B), and (c) site-directed mutagenesis at either the D1 or D2 sites disrupts protein binding equivalently as though each site were necessary for complex formation (Fig. 6A,B). In addition, site-directed mutagenesis at either the D1 or D2 sites reduces PMA + PHAinduced CATactivity by an amount that is consistent with the diminution of B, C and PC complexes. Therefore, the activation of the IFN-y gene promoter may be mediated in part by the interaction of protein complexes binding to the D1 and D2 sites. The deletion analysis of upstream probe U also identified a site that binds nuclear proteins.The U probe regulatory site was originally defined by CAT analysis, and we further characterized this site through gel-shift and footprinting studies (Figs. 3B and 4B). Deletion of the U region allowed the IFN-y promoter to exhibit greater CAT activity in the presence of inducers [12]. In addition, we found that the nuclear regulatory factors tux I or I1 could equivalently override the negative regulatory effect of the upstream site as when it had been deleted [12]. Surprisingly, we have found that the most heavily protected sequence in the U site (-515 to -508) is very similar to the downstream D 1 site, while another portion of the U site is similar to the D2 site (Fig. 3D). Our competition studies demonstrate that unlabeled probe De was able to compete band A’, B’ (unpublished data), and C‘ (Fig. 5 ) complexes from labeled probe Ud almost as effectively as cold competitor probe Ud. Conversely, 100fold excess cold probe Ud was less effective in competing proteins from labeled probe De than from labeled probe Ud, possibly indicating a greater affinity of the protein complexes A, B (unpublished data), C, and PC (Fig. 5) for probe De relative to probe Ud. However, when probe De was mutated at both the D 1 and D2 sites, it was not able to compete protein from either probe De or probe Ud (Fig. 5). We have also found that promoter fragments deleted to -117 at the 5’ end or to -20 at the 3’ end will independently eliminate gel-shift bands with fractions B and C (Pang, Slice, and Diamond, unpublished data). These findings are in good agreement with the protein: DNA interaction sites determined by DNase footprinting (Fig. 3). Therefore, our data suggest that the D1 and D2 sites interact with each other, and similar proteins may also bind to the U site. Our results are compatible with a model in which protein: DNA interactions may affect DNA elements located at a distance from the original site [25). For instance, we previously showed by CAT analysis that the sequences necessary for maximal PMA + PHA inducibility are located between -284 and -260. The 3’ deletions beyond this region result in relatively little inducibility [12].

IFN-y regulatory proteins

2427

However, alteration of sequences 150 bp downstream of the -284 to -260 site cause a reduction of promoter activity (Fig. 6) equal to deletion of that site [12]. However, we have detected no protein binding to the -284 site, either by gel-shift assays (Fig. 1A) or by footprinting of gel-shift complexes (Brown and Diamond, unpublished observations). Therefore, either a factor responsible for the activity at the -284 region exists in quantities too minute to detect by the methods used here, or, the protein binding we have observed at the D1, D2 and U sites acts at a distance to regulate the site at -284. The authors would like to thank those who supplied cell lines or D N A vectors during the course of these studies. D. J. D. thanks Dr. David Moore for his continuing interest in this project and his thoughts on the manuscript. The technical help of Mr. Forrest Nelson, Ms. Anne Chandler, and Mr. Peter SzaIay is gratefully acknowledged. Received October 3, 1991; in final revised form April 22, 1992.

5 References 1 Trinchieri, G., Kobayashi, M., Murphy, M. and Perussi, B., Lymphokines 1987. 14: 267. 2 Vilcek, J., Gray, F? W., Rinderknecht, E. and Sevastopoulos, C. G., Lymphokines 1985. 11: 1. 3 Kasahara, T., Hooks, J. J., Dougherty, S. F. and Oppenheim, J. J., J. Immunol. 1983. 130: 1784. 4 Young, H . A. and Ortaldo, J. R., J. Immunol. 1987.139: 724. 5 Hardy, K. J. and Sawada, T., J. Exp. Med. 1989. 170: 1021. 6 Lebindiker, M. A.,Tal, C., Sayar, D., Pilo, S., Eilon, A , , Banai, Y. and Kaempfer, R., EMBO J. 1987. 6: 585. 7 Wiskocil, R., Weiss, A . , Imboden, J., Kamin-Lewis, R. and Stobo, J., J. Immunol. 1985. 134: 1599. 8 Kronke, J., Leonard,W. J., Depper, J. M. and Greene,W. C., J. Exp. Med. 1985. 161: 1593. 9 Hardy, K. J., Peterlin, B. M., Atchison, R. E. and Stobo, J. D., Proc. Natl. Acad. Sci. USA 1985. 82: 8173. 10 Hardy, K. J., Manger, B., Newton, M. and Stobo, J. D., J. Immunol. 1987. 138: 2353. 11 Ciccarone,V. C., Chrivia, J., Hardy, K. J. and Young, H . A., J. Immunol. 1990.144: 725. 12 Brown, D. A., Nelson, F. B., Reinherz, E. L. and Diamond, D. J., Eur. J. Immunol. 1991. 21: 1879. 13 Chrivia, J. C., Wedrychowicz, T., Young, H . A. and Hardy, K. J., J. Exp. Med. 1990. 172: 661. 14 Crabtree, G. R., Science 1989. 243: 355. 15 Diamond, D. J., Nelson, F. B. and Reinherz, E. L., J. Exp. Med. 1989. 169: 1213. 16 De Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R. and Subramani, S., Mol. Cell. Biol. 1987. 7: 725. 17 Gillies, S. D., Morrison, S. L., Oi,V. T. and Tonegawa, S., Cell 1983. 33: 717. 18 Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, 1989. 2nd Edn., Cold Spring Habor Laboratory Press, New York 1989. 19 Maxam, A. M. and Gilbert, W., Methods Enzymol. 1980. 65: 499. 20 Singh, H., Sen, R., Baltimore, D. and Sharp, l? A . , Nature 1986. 319: 154. 21 McClary, J. A., Witney, E and Geisselsoder, J., BioTechniques 1986. 7: 282. 22 Sen. R. and Baltimore, D., Cell 1986. 46: 705. 23 Granelli-Piperno, A., Andrus, L. and Steinman, R. M., J. Exp. Med. 1986. 163: 922. 24 Kuwabara, M. D. and Sigman, D. S., Biochemistry 1987. 26: 7234. 25 Ptashne, M., Nature 1986. 322: 697.

2428

D. A. Brown, K. L. Kondo, S.-W. Wong and D. J. Diamond

26 Koga,Y., Kimura, N . , Minowada, J., Mak,T. W., Cancer Res. 1988. 48: 856. 27 Sangster, R. N., Minowada, J., Suciu-Foca, N., Minden, M. and Mak,T. W.. J. Exp. Med. 1986. 163: 1491. 28 Weiss, A. and Stobo, J. D., J. Exp. Med. 1984.160: 1284-1299. 29 Saito, T., Hochstenbach, F., Marusic-Galesic, S., Kruisbeek, A. M.. Brenner, M. and Germain, R. N., J. Exp. Med. 1988. 168: 1003. 30 Weiss, A., Newton, M. and Crommie, D., Proc. Nutl. Acad. Sci. U S A 1986. 83: 6998. 31 Acuto, O., Hussey, R. E., Fitzgerald, K. A., Protentis, J. F!, Meuer, S. C., Schlossman, S. F. and Reinherz, E., Cell 1983.34: 717.

Eur. J. Immunol. 1992. 22: 2419-2428

32 Minowada, J., Koshiba, H., Sagawa, K., Kubonishi, I . , Lok, M. S., Tatsumi, E., Han, T., Srivastava, B. I. S. and Ohnuma, T., J. Cancer Res. Clin. Oncol. 1981. 101: 91, 33 Hochstenbach, F., Parker, C., McLean, J., Gieselmann, V., Band, H., Bank, I., Chess, L., Spits, H., Strominger, J. L., Seidman, J. G. and Brenner, M. B., J. Exp. Med. 1988. 168: 761. 34 Benjamin,W. R., Steeg, F! S. andFarrar, J. J., Proc. Natl. Acad. Sci. USA 1982. 79: 5379. 35 Salahuddin, S. Z . , Markham, F! D.,Wong-Staal, F., Franchini, G., Kalyanaraman,V. S. and Gallo, R. C., Virology 1983. 129: 51.