Proc. Natl. Acad. Sci. USA Vol. 89, pp. 5946-5950, July 1992 Biochemistry

Characterization of human androgen receptor overexpressed in the baculovirus system (dihydrotestosterone/anti-androgen receptor antibody/prostte)

CHAWNSHANG CHANG*t, CHIHUEI WANG*, HECTOR F. DELUCA*t, TROY K. Rossf, AND CHARLES C.-Y. SHIH§ *University of Wisconsin Comprehensive Cancer Center and tDepartment of Biochemistry, University of Wisconsin, 600 Highland Avenue, Madison, WI 53792; and §PharMingen, San Diego, CA 92121

Contributed by Hector F. DeLuca, April 3, 1992

and functional analyses, such as x-ray crystallography and NMR analysis. Three subdomains of hAR have been overexpressed in a prokaryotic system (12). However, the poor solubility and lack of posttranslational modification of eukaryotic proteins in bacterial cells limit their uses in the production of anti-AR poly- and monoclonal antibodies (12). The baculovirus expression system has become an effective method to overproduce functional receptors for glucocorticoid (13), estrogen (14), mineralocorticoid (15), and vitamin D (16). We describe the overproduction of a full-length hAR in Spodoptera frugiperda (Sf21) cells (17) that is indistinguishable from the bona fide hAR with respect to androgen binding specificity.

An essential step in the process of underABSTRACT standing the structure and function of the human androgen receptor (hAR) involves the production of large quantities of the hAR. For this purpose, the fuil-length hAR has been overproduced in insect cells by using a baculovirus genetic expression system. The recombinant hAR is produced in Sf21 insect cells at =7 pmol/mg of protein (1 x 10' AR molecules per cell), which is 70-150 times greater than levels detected in androgen target tissues. Androgen can bind to the baculovirusexpressed hAR with sdgh affinity (Kd = 0.46 nM), and the specificity of hormone binding in baculovirus-expressed hAR is essentially identical to that of bona fide hAR. An anti-AR monoclonal antibody can recognize the baculovirus-expressed hAR at 100 kDa upon Western blot analysis. Sucrose gradient analysis shows that baculovirus-expressed hAR complexes sediment at 4 S in a high salt medium and these complexes can interact with anti-AR monoclonal antibody to form complexes that sediment at 8-10 S. Therefore, production of recombinant hAR from the baculovirus expression system will provide an alternative source of biologically active hAR for studies on the molecular mechanisms of androgen action.

MATERIALS AND METHODS Materials. [3H]Methyltrienolone (R1881; 87 Ci/mmol; 1 Ci = 37 GBq) was purchased from NEN. Steroids were purchased from Sigma. The plasmid containing a full-length hAR coding sequence was constructed in our laboratory, as reported (8). The ANI-15 rat anti-AR monoclonal antibody used in this study was purified in our laboratory. ANI-15 was raised against an AR peptide (40% of the N-terminal domain and 25% of the DNA-binding domain)-bacterial TrpE fusion protein, and its specificity has been confirmed (12, 18-20). The modified and linearized baculovirus DNA, transfection buffer, and Sf21 insect cells were from the BaculoGold transfection kit provided by PharMingen. TA cloning kit and plasmid pVL1393 were purchased from Invitrogen (San Diego). The alkaline phosphatase conjugate substrate kit was from Bio-Rad. Construction of Recombinant Transfer Vector pVL1393AR. To increase the expression of the hAR in the baculovirus system, we chose to amplify a fragment of the DNA that encodes partial N-terminal portions of hAR including only 4 nucleotides of untranslated leader sequence proximal to the initial ATG codon. For this purpose, two oligonucleotide primers were synthesized and used to amplify the partial hAR (Fig. 1): primer 1 (AAGGATGGAAGTGCAGTTAG) and primer 2 (GTCCACCGGGTTCTCCAGCT). The amplified 1167-base-pair fragment of hAR was subcloned into pCR1000 plasmid. The recombinant transfer vector pVL1393-AR was then constructed from the transfer vector pVL1393 (17), plasmid pCR1000-AR, and the plasmid pSKAR, which contains the entire hAR DNA coding region. pCR1000-AR was digested with EcoRI and Afl II, and the fragment containing the partial N-terminal hAR coding sequences plus a 24-basepair 5' untranslated sequence was then ligated to the Aft II-Bgl II fragment that contains the hAR coding sequences. The entire hAR EcoRI-Bgl II fragment was then inserted into the EcoRI-Bgl II site of the transfer vector pVL1393. By using restriction enzyme digestions and nucleotide sequence

Androgens are essential for normal male development, differentiation, and function (1, 2). Androgen effects are mediated by the androgen receptor (AR), a member of the steroid receptor superfamily that modulates gene transcription through high-affinity and specific binding to hormones and hormone response elements (3-5). Mutations in the AR gene are thought to cause the abnormalities associated with various forms of the androgen-insensitivity syndrome, a disease characterized by failure of the male fetus to respond to androgens in utero and results in testes located in the abdominal or inguinal area (6, 7). The complete amino acid sequence of AR has been deduced from the nucleotide sequences of AR cDNA clones (8-10). The deduced amino acid sequence displays an oligo-(amino acid)-rich N-terminal domain, a highly conserved cysteine-rich DNA-binding domain, and a less-well-conserved C-terminal androgenbinding domain. The binding of androgen to the C-terminal domain of AR may introduce the conformational change in the DNA-binding domain that allows the receptor to interact with chromatin and trigger the expression of androgen target genes (3-10). The detailed molecular mechanism of androgen action mediated by AR is currently hindered by the very low abundance of AR in the androgen target tissues. For the rat ventral prostate, an androgen target tissue with relatively high abundance of AR, the average content of AR is =100 fmol/mg of protein (11). As most physical and biochemical methods may require microgram quantities of protein, overexpression of human (h) AR is essential for more structural The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Abbreviations: AR, androgen receptor; hAR, human AR. tTo whom reprint requests should be addressed.

5946

Biochemistry: Chang et al.

Proc. Natl. Acad. Sci. USA 89 (1992) .2.

1F~

5947

Bgl 11

An A111 RI N

ANDROGEN RECEPTOR

2 548

528

Primer 1

kAGGATGGAAGTGCAGTTAG

Digested with Art1ii and Bgl II

1675

1695

l

P 2 GTCCACCGGGTTCTCCAGCT Primer PCR

amplified,

subcloned

pCR

000

Into

Ati 11

Cut so by EcoR 1 and AtO 11

Bgl 11

EcoRl 4

Aflil I

I

Ligated with pVL1393 digested by EcoR 1 and BgI 11

FIG. 1. Construction of recombinant transfer vector pVL1393-AR. Two oligonucleotides (primers 1 and 2) were used as primers to amplify the partial N-terminal portion of hAR. The amplified 1167-base-pair fragment of hAR was subcloned into the pCR1000 plasmid. To prepare the transfer vector pVL1393-AR containing the full-length hAR coding region, an EcoRI-Afl II restriction fragment was cut from pCR1000-AR and ligated with another Afl II-Bgl II hAR fragment from pSKAR, and the entire EcoRI-Bgl II hAR fragment was then ligated to EcoRI/Bgl II-cut pVL1393 that had been treated with calf intestinal phosphatase. The resulting plasmid, pVL1393-AR, contains the entire hAR coding region and 24 additional untranslated nucleotides proximal to the hAR initiation codon. Kb, kilobases.

determination of initial 5' and 3' termini of potential positive clones, a recombinant was identified with the hAR DNA in the proper orientation to the polyhedrin gene transcription signals. The recombinant transfer vector was named pVL1393-AR. Isolation of Recombinant Baculovirus AR Virus (ARAcNPV). Recombinant plasmids were cotransfected into Sf21 cells with modified and linearized baculovirus DNA, by using the BaculoGold transfection kit. In vivo homologous recombination between the baculovirus DNA and the recombinant plasmid (pVL1393-AR) resulted in the generation of recombinant viruses at a frequency of >95% (results not shown). Several recombinant viruses were then plaque-purified by a one-step plaque assay. Confirmation that the recombinant virus AR-AcNPV encoded the full-length hAR was performed by Western blot analysis. Preparation of Protein Extracts from Infected Insect Cells. For the production of recombinant hAR protein extract, Sf21 cells infected with the recombinant virus AR-AcNPV were harvested routinely 72 h after infection. Cells were lysed by homogenization in 0.4 M KCI/AR buffer [25 mM sodium phosphate/1.5 mM EDTA/2 mM dithiothreitol/10 mM KF/ 10% (vol/vol) glycerol/1 mM phenylmethylsulfonyl fluoride/ 0.1 mM bacitracin/10 mM Na2MoO4, pH 7.2]. The cell lysate was centrifuged for 60 min at 45,000 rpm in a Beckman 70.1 Ti rotor. The supernatant was used as protein extracts for the further studies.

Androgen Binding Assays. Androgen binding was determined by incubation of protein extracts with 10 nM [3H]R1881 in the presence or absence of a 500-fold excess of nonradioactive R1881 on ice for 16 h. Specific androgen binding was determined by the hydroxylapatite filter assay method, as described (21). For the assay of steroid and nonsteroidal antiandrogen binding specificities, the protein extracts were incubated at 0C for 16 h with 5 nM [3H]R1881 in the presence or absence of the nonradioactive test compound at 100 nM or 500 nM. Protein content of the extracts was measured by the Bradford method (22). Western Blot Analysis. Total cellular protein extracts were prepared by harvesting the insect cells 72 h after infection. The cells were washed and collected by centrifugation. The pellets were lysed in 4% (vol/vol) SDS electrophoresis sample buffer (23), boiled for 5 min, and then separated by SDS/PAGE in 10% polyacrylamide gels (24). Protein species were transferred to nitrocellulose filters for Western blot analysis. The nitrocellulose filters were blocked with Trisbuffered saline/Tween 20 (TBST) containing 10% (wt/vol) nonfat dry milk and incubated with primary antibody (rat anti-AR monoclonal antibody) for 90 min. The nitrocellulose filters were washed extensively in TBST and then incubated with a secondary alkaline phosphatase-conjugated goat antirat IgG antibody. The color was developed using the alkaline phosphatase conjugate substrate kit (Bio-Rad).

5948

Proc. Natl. Acad. Sci. USA 89 (1992)

Biochemistry: Chang et al.

RESULTS Expression of the hAR. The strategy used to construct the recombinant baculovirus encoding the full-length hAR is outlined in Fig. 1. Fig. 2 shows a time course of expression of AR in cells infected with AR-AcNPV. Androgen binding activity began to increase 24 h after infection, and peak levels were observed between 60 and 72 h after transfection. The results were further confirmed by the Western blot analysis with a monoclonal antibody against AR (Fig. 3). A distinct band of 100 kDa was evident in the extract from cells infected with AR-AcNPV (Fig. 3, lanes 3-5) and was not present in the extract from Sf21 cells (Fig. 3, lane 2) or the extract from Sf21 cells infected with wild-type AcNPV (Fig. 3, lane 1). Several faint bands at 68 kDa may represent degradation of the AR protein. The level of hAR in infected insect cells was determined using the hydroxylapatite ligand binding assay (21). About 7 pmol of the androgen binding form of the receptor per mg of protein was measured by the hydroxylapatite filter assay (Fig. 2). This level of AR is 70-150 times greater in the baculovirus system than in androgen target tissues (11). Baculovirus-Expressed AR Steroid-Binding Affinity and Specificity. To study the steroid-binding activity of the recombinant hAR, we incubated the cell extract containing baculovirus-expressed hAR with [3H]R1881, a synthetic androgen that binds AR with a high affinity. Using a hydroxylapatite filter assay method (21), we observed that baculovirus-expressed hAR had very high apparent binding affinity for R1881. By Scatchard plot analysis (25), the apparent dissociation constant (Kd) was 0.46 nM (Fig. 4), which is very close to our previous report for authentic hARs and rat ARs

(8, 9).

Sa-Dihydrotestosterone, an active natural androgen in the prostate, competed well with [3H]R1881 binding. Testosterone was also able to compete with [3H]R1881 for binding to the AR (Fig. 5). Estradiol and synthetic progesterone (R5020) compete for [3H]R1881 binding with 55-85% inhibition at a 100-fold molar excess of unlabeled hormone. The antiandrogens hydroxyflutamide and cyproterone acetate inhibited binding by -70% and 30%o, respectively, at a 100-fold molar excess (Fig. 5). The binding affinity and specificity of baculovirus-expressed AR and endogenous AR, therefore, were very similar (26-28). In AR buffer containing 0.4 M KCl, [3H]R1881-AR complexes made from AR-AcNPV sedimented as a 4S form (Fig. 6). As expected, the [3H]R1881-AR complexes interacted 15

FIG. 3. Western blot analysis of Sf21 cell extracts with anti-AR monoclonal antibody. Cell extract proteins (36 ,ug) from Sf21 cells infected with wild-type baculovirus (lane 1) or infected with recombinant AR baculovirus 30 h (lane 3), 48 h (lane 4), or 60 h (lane 5) after infection, and uninfected Sf21 cells (lane 2) were analyzed by SDS/PAGE in a 10% polyacrylamide gel, blotted to a nitrocellulose filter, and detected with anti-AR monoclonal antibody. Positions of molecular mass markers (kDa) are indicated on the left.

with anti-AR monoclonal antibody and the complexes formed sedimented at 8-10 S.

DISCUSSION Several steroid receptors have been expressed using the baculovirus expression system (13-16). We report here that biologically functional hAR can be overproduced in recombinant baculovirus-infected Sf21 cells. The recombination efficiency in our BaculoGold transfection system is >95% and greatly simplifies plaque assays. The performance of a plaque assay is sufficient to identify a single plaque for large-scale amplification (31 out of 32 randomly selected plaques from plaque assays expressed hAR as shown by Western blot analysis). The principle ofthis method lies in the construction of a modified type of baculovirus that contains a lethal deletion. Only cotransfection of the viral DNA with a complementing plasmid construct reconstitutes viable virus inside insect cells (29). The level of hAR expression (7 pmol/mg of protein) is 70-150 times greater than that expressed normally in androgen target tissues (11) and compares favorably with other reports for the overexpression of steroid receptors in baculovirus expression systems (13-15). It has been reported that 2.-

0

x

E 10 Q0 -o C

_60 5 c:

In. 0

60 20 40 Time after infection, h

80

FIG. 2. Time course of hAR expression in insect cells infected with recombinant hAR virus (AR-AcNPV). Cells were washed and lysed 24 h, 30 h, 48 h, 60 h, and 72 h after infection. Androgen-specific binding of cell lysates was determined by the hydroxylapatite filter assay method (21).

0

1

2

3

4

5

6

7

R1881, pM FIG. 4. Scatchard analysis of androgen binding to Sf21 cell extracts prepared 72 h after infection with AR recombinant baculovirus. The cell extracts were incubated with various concentrations of [3H]R1881 in the presence or absence of a 500-fold excess of nonradioactive R1881 for 16 h at 0°C. B, bound; F, free.

Proc. Natl. Acad. Sci. USA 89 (1992)

Biochemistry: Chang et al. 120100-

o5

80-

C

D 60co I 40

20

C

L

~~0

0

0

0

0

00

Lo -

LO W

F-F c

a)

0

c

0

0 (N

o

o

0

uAP

4) C

4()

0

0

-

C

{

0 0

to

0

0

cO

CA

D

CM CN o

o

0 0

0

-

E _

o

00

E E xc X cu wS

(

43

)

x

x

x

Co

X CO

00

FIG. 5. Steroid binding specificity of baculovirus-expressed hAR. The cell extracts prepared 72 h after infection with AR-AcNPV were incubated with 5 nM [3H]R1881 in the absence (as control) or presence of various nonradioactive steroid or nonsteroidal antiandrogens (20- and 100-fold excess) for 16 h at 0C. Steroid binding was determined by a hydroxylapatite filter assay as described (21). The control is shown as 100%. DHT, dihydrotestosterone.

much as a 3-fold increase of baculovirus-expressed glucocorticoid receptor can be produced when insect cells were infected in suspension culture instead of grown in monolayers (13). Based on the above information, we estimate that our baculovirus expression system may be able to produce 3 x 106 ARs per insect cell, which should allow the recovery of sufficient amounts of hAR for the further functional and structural studies.

as

3-

x

2

E

0L

co

co

0

5

10

15

Fraction

FIG. 6. Sucrose gradient profiles of hAR expressed in the baculovirus system. [3H]R1881-AR (20,000 dpm) alone (open square) or with 40 ,ug of ANI-15 anti-AR monoclonal antibody (solid square) in 0.2 ml was incubated at 40C for 2 h, layered on the top of sucrose

gradients (5-20%o) containing 0.4 M KCI/AR buffer, and centrifuged at 45,000 rpm for 22 h at 40C in a Beckman SW 50.1 rotor. Fractions were collected (numbered from the bottom) and measured for the androgen-binding activity by the hydroxylapatite filter assay method (21).

5949

The recombinant hAR expressed in insect cells is capable of binding androgens with high affinity (Kd = 0.46 nM) and specificity. High concentrations of antiandrogens, hydroxyfluoramide and cyproterone acetate, can also partially inhibit the androgen binding to the baculovirus-expressed hAR. These results are similar to other mammalian cell systems (28) and prove that baculovirus expression systems may be a useful model to study the interaction of androgens and/or antiandrogens with the hAR. An ideal antiandrogen should have no agonist or other hormonal activity and should be specific for the AR (30). Currently available steroidal antiandrogens for the treatment of prostate cancer include megestrol acetate (31), chlormadinone acetate (32), and cyproterone acetate (33). All of these antiandrogens are also potent progestogens (30). A threedimensional structure analysis of the hAR, with and without androgens and/or antiandrogens, may allow the elucidation of the detailed molecular mechanism of androgen actions and help to design such an "ideal antiandrogen." The overproduced baculovirus system may provide enough hAR for such studies. When analyzed in a sucrose gradient containing 0.4 M KC1, baculovirus-expressed hAR sedimented at 4 S. After incubation with ANI-15 anti-AR monoclonal antibody, the baculovirus-expressed hAR complex was shifted to 8-10 S. This clearly demonstrates that ANI-15 anti-AR monoclonal antibody can recognize the native form of baculovirus-expressed hAR when complexed with AR and the denatured form of baculovirus-expressed hAR on a Western blot. The ANI-15 anti-AR monoclonal antibody, therefore, may prove to be a powerful tool (immunoaffinity column) for the large-scale purification of hAR in the baculovirus expression system. The ability of baculovirus hAR to form AR complexes in Sf21 cells also indicates that insect cells may have necessary factors for hAR complexes formation and may allow one to study the interaction of hAR with the androgen response elements (AREs). Some groups have described the existence of potential AREs from several androgen target genes (3436), but none of them were able to identify a consensus sequence of a well-described regulatory element and demonstrate the positive band shift in their system (34-36). The baculovirus expression system may be able to provide enough enriched or purified hAR to search for the AREs by the "cyclic immunopurification method" or "protein protection of DNA sequences method" (37). Our analysis of the recombinant vitamin D receptor from the baculovirus system indicates that a mammalian-derived nuclear accessory factor(s) is necessary for receptor-vitamin D response element interaction (38). It will be interesting to examine the possible requirements of such a nuclear accessory factor(s) for hARARE interaction. In conclusion, the expression of hAR in insect cells by the baculovirus system results in the production of large quantities of the receptor whose tested biochemical properties are essentially identical to the authentic hAR. This system may, therefore, prove to be an ideal resource for the large-scale production of hAR for the detailed physiochemical analysis and functional studies. We thank Mr. Han-Jung Lee for his expert technical assistance. This work was supported by Grant CA 55639 from the National Institutes of Health and Grants BE 78 and JFRA 304 from the American Cancer Society. 1. Jost, A. (1965) in Organogenesis, eds. Haan, R. L. & Ursprung, H. (Holt, Rinehart & Wilson, New York), pp. 611-628. 2. Mooradinn, A. D., Morley, J. E. & Korenman, S. G. (1987) Endocr. Rev. 8, 1-28. 3. Yamamoto, K. R. (1985) Annu. Rev. Genet. 19, 209-252. 4. Evan, R. M. (1988) Science 240, 889-895. 5. Bento, M. (1988) Cell 56, 335-344.

5950

Biochemistry: Chang et A

6. Imperato-McGinley, J., Ip, N. Y., Gautier, T., Neuweiler, J., Gruenspan, H., Liao, S., Chang, C. & Blazs, I. (1990) Am. J. Med. Genet. 36, 104-108. 7. Sai, T., Seino, S., Chang, C., Trifiro, M., Pinsky, L., Mhatre, A., Kaufman, M., Lambert, B., Trapman, J., Brinkman, A. O., Rosenfield, R. L. & Liao, S. (1990) Am. J. Hum. Genet. 46, 1095-1100. 8. Chang, C., Kokontis, J. & Liao, S. (1988) Proc. Nati. Acad. Sci. USA 85, 7211-7215. 9. Chang, C., Kokontis, J. & Liao, S. (1988) Science 240,324-326. 10. Lubahn, D. B., Joseph, D. R., Sullivan, P. M., Willard, H. F., French, F. S. & Wilson, E. M. (1988) Science 240, 327-330. 11. Gustafsson, J. A. & Ponsette, A. (1975) Biochemistry 14, 3094-3101. 12. Chang, C., Whelen, C., Popovich, T., Kokontis, J. & Liao, S. (1988) Endocrinology 125, 1097-1099. 13. Alnemri, E. S., Maksymowych, A. B., Robertson, N. M. & Litwack, G. (1991) J. Biol. Chem. 266, 3925-3936. 14. Brown, M. & Sharp, P. A. (1990) J. Biol. Chem. 265, 1123811243. 15. Binart, N., Lombes, M., Rafestin-Oblin, M. E. & Baulieu, E. E. (1991) Proc. Nati. Acad. Sci. USA 88, 10681-10685. 16. Ross, T. K., Prahl, J. M. & DeLuca, H. F. (1991) Proc. Nati. Acad. Sci. USA 88, 6555-6559. 17. Luckow, V. A. & Summers, M. D. (1989) Virology 167, 31-39. 18. Takeda, H., Chodak, G. W., Mutchnik, S. E., Nakamoto, T. & Chang, C. (1990) J. Endocrinol. 126, 17-25. 19. Takeda, H., Nakamoto, T., Kokontis, J., Chodak, G. W. & Chang, C. (1991) Biochem. Biophys. Res. Commun. 177, 488496. 20. Takeda, H. & Chang, C. (1991) J. Endocrinol. 129, 83-88.

Proc. Natl. Acad. Sci. USA 89 (1992) 21. Chang, C. & Liao, S. (1987) 1. Steroid Biochem. 27, 123-131. 22. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254. 23. Vialand, T., Laumiere, N., Vernet, T., Briedis, D., Alkhatib, G., Henning, D., Levin, D. & Richardson, C. (1990) J. Virol. 64, 37-50. 24. Laemmli, U. K. (1970) Nature (London) 227, 680-685. 25. Scatchard, G. (1949) Ann. N. Y. Acad. Sci. 51, 660-672. 26. Ojasoo, T. & Raynaud, J. P. (1978) Cancer Res. 38, 4186-4198. 27. Wilson, E. M. & French, F. S. (1976) J. Biol. Chem. 251, 5620-5629. 28. Kemppainen, J. A., Lane, M. V., Sar, M. & Wilson, E. M. (1992) J. Biol. Chem. 267, 968-974. 29. Kitts, P. A., Ayres, M. D. & Possee, R. D. (1991) Nucleic Acids Res. 18, 5667-5672. 30. Gaillard-Moguilewsky, M. (1981) Urology 37, 5-12. 31. Gieller, T., Albert, J., Yen, S. S. C., Geller, S. & Loza, D. (1981) J. Clin. Endocrinol. Methods 52, 576-580. 32. Nishimura, R. & Shida, K. (1981) Prostate 1, 27-34. 33. Neumann, F. (1977) Horm. Met. Res. 9, 1-13. 34. Riegman, P. H. J., Vliestra, R. J., Van der Korput, J. A. G. M., Brinkmann, A. 0. & Trapman, J. (1992) Mol. Endocrinol. 5, 1921-1930. 35. Vos de P., Claessens, F., Windericky, T., PNck, P., Van Celis, L., Peeters, B., Rombauts, W., Heyns, W. & Verhoeven, G. (1991) J. Biol. Chem. 266, 3438-3443. 36. Rushmere, N. K., Parker, M. G. & Davies, P. (1987) Mol. Cell. Endocrinol. 51, 259-265. 37. Somnayrac, L. & Danna, K. J. (1990) Proc. Natl. Acad. Sci. USA 87, 3274-3278. 38. Ross, T. K., Moss, V. E., Prahl, J. M. & DeLuca, H. F. (1992) Proc. Natl. Acad. Sci. USA 89, 256-260.