This article was downloaded by: [George Mason University] On: 08 January 2015, At: 14:32 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Animal Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/labt20
Characterization of hsp70 Gene Promoter for cis- Acting Elements in Indian Zebu Cattle of Hariana Breed a
a
a
a
Rahul Behl , Jyotsna Behl , D. K. Sadana , R. K. Vijh , M. S. a
Tantia & B. K. Joshi
a
a
National Bureau of Animal Genetic Resources , Karnal , Haryana , India Published online: 26 Mar 2014.
Click for updates To cite this article: Rahul Behl , Jyotsna Behl , D. K. Sadana , R. K. Vijh , M. S. Tantia & B. K. Joshi (2014) Characterization of hsp70 Gene Promoter for cis- Acting Elements in Indian Zebu Cattle of Hariana Breed, Animal Biotechnology, 25:3, 160-164, DOI: 10.1080/10495398.2013.844161 To link to this article: http://dx.doi.org/10.1080/10495398.2013.844161
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &
Downloaded by [George Mason University] at 14:32 08 January 2015
Conditions of access and use can be found at http://www.tandfonline.com/page/termsand-conditions
Animal Biotechnology, 25: 160–164, 2014 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495398.2013.844161
CHARACTERIZATION OF hsp70 GENE PROMOTER FOR cis- ACTING ELEMENTS IN INDIAN ZEBU CATTLE OF HARIANA BREED
Downloaded by [George Mason University] at 14:32 08 January 2015
Rahul Behl, Jyotsna Behl, D. K. Sadana, R. K. Vijh, M. S. Tantia, and B. K. Joshi National Bureau of Animal Genetic Resources, Karnal, Haryana, India The promoter region of hsp70 gene was characterized for cis-acting elements in zebu cattle of Hariana breed. The basal regulatory domain of CAAT box identified as CAAT/enhancer binding protein (C/EBP) and CAAT binding transcription factor (CTF) binding sites, as well as GC box identified as sp1 binding site, were localized in at least two regions in the hsp70 gene promoter. A highly conserved heat shock element was found between position 108 to 95, which exactly matched at all eight positions with the consensus sequence. These cis-acting elements were found to be conserved between Holstein-Friesian and studied zebu breed. Keywords: hsp70 gene; Promoter-elements; Hariana cattle
The Indian zebu cattle (Bos indicus) breed has been selected over centuries for their ability to survive in tropical heat conditions by natural factors as well as through human intervention (1–3). Additionally, altered physiological response, at elevated core body temperature, increased expression of heat shock proteins (hsp) genes, including hsp70, play a central role in heat stress regulation at cellular level (4, 5). The cis-acting promoter elements play a significant role in complex transcriptional regulation of basal expression of hsp genes at ambient conditions as well as elevated expression during stress conditions including heat stress (6–10). This complexity in transcriptional regulation is partly attributed to the multiplicity of these cis-acting promoter elements (9, 11–13). This study was undertaken to characterize the 5’ flanking region of hsp70 gene for cis-acting sites in zebu cattle of Hariana breed and compare them with Taurus cattle.
MATERIALS AND METHODS The blood samples were collected from twenty-four unrelated animals of Hariana breed of Indian zebu cattle from Shri Krishan Goshala, Nissing, Karnal, India. The genomic DNA was isolated from collected samples by standard procedure of digestion with proteinase-K, separation with phenol=chloroform, and extraction Address correspondence to Rahul Behl, National Bureau of Animal Genetic Resources, P.O. Box 129, GT By-Pass Road, Karnal 132001, Haryana, India. E-mail: [email protected] 160
Downloaded by [George Mason University] at 14:32 08 January 2015
hsp70 GENE PROMOTER FOR cis-ACTING ELEMENTS
161
with ethanol. The isolated DNA samples were stored at 20 C and working dilutions were stored at 4 C. Three primer pairs, covering overlapping DNA segments, were designed for 5’ flanking region of hsp70 (hspa1b) gene using the sequence of Taurus cattle (AY149618.1), available at National Center for Biotechnology Information (NCBI) Gene Bank using Primer3 computer program (14). The primers covered a total region covering 1027 bases from 620 of flanking region to þ407 of 5’ UTR and exon 1. The sequences of the three primers were: 50 TCTCCTTTTCCTTCCCATTTT30 and 50 TTCTAGGATTCGCTGGAGGA30 , 50 AACTACTTGGCTGGCTGGTC30 and 5 0 CGGAACCCGAAAACTGAAC3 0 , and 5 0 AGCCGCCTGAGGAGAAAC3 0 and 5 0 ACCGTGTTCTGCGGGTTC3 0 . The genomic DNA was amplified by a polymerase chain reaction (PCR) using these primers. Each 25-mL reaction consisted of DNA (about 100 ng), dNTP’s (40 mM each), 10X buffer (10 mM tris-HCl, 50 mM KCl, 01% gelatin, pH 8.4)(2.5 mL), MgCl2 (1.5 mM), and Taq DNA polymerase (0.75 units). The thermocyclic conditions were 94 C for 2 minutes followed by 30 cycles of 92 C for 45 seconds, annealing at optimum temperature for 45 seconds and extension at 72 C for 15 minutes. The amplified product was treated with exonuclease I and shrimp alkaline phosphatase to remove unused primers and dNTPs. The treated product was sequenced on Avant 3100 (Applied Biosystems) automated DNA sequencer. The multipass sequences with forward and reverse primers for each animal were aligned and compared to the sequence of Bos taurus using MegAlign option of DNAstar computer program (version 4.0). The putative cis-acting sites were identified using TESS (http:==www.cbil. upenn.edu/cgi-bin/tess/tess) and ALIBABA2.1 (http://www.gene-regulation.com/ pub/programs.html) computer programs. On the basis of overlapping hits revealed by both programs and the literature data (9, 12, 15), we manually selected potentially important cis-acting sites in the promoter region of hsp70. RESULTS AND DISCUSSION The consensus sequence for 5’ flanking region of hsp70 gene of Hariana breed of Indian zebu cattle obtained after aligning the sequences across three primers and animals was submitted to NCBI gene bank (EU872051.1). In comparison to the sequence available for Bos taurus (AY149618.1), no insertions or deletions were observed in the nucleotide sequence of 50 flanking region of hsp70 gene obtained in the studied animals of Hariana breed. In all, eight single nucleotide changes were observed with varying degrees of occurrence, two were transitions, whereas six were transversions. Four of the observed changes were in the promoter region and four were in the 50 UTR region. The transversion G=C at position 159 in the promoter region had the highest frequency of 0.75, whereas transition C=T at position 188 also in the promoter region showed the highest frequency of 0.875 (Table 1). The putative cis-acting elements identified in the consensus sequence obtained for zebu cattle of Hariana breed are given in Table 2. The TATA signal or the binding site for transcription factor II D is located in the region 30 to 20 bp upstream of the transcription start site. The basal regulatory domain of CAAT box identified as
162
R. BEHL ET AL.
Downloaded by [George Mason University] at 14:32 08 January 2015
Table 1 Frequencies of sequence variation in the hsp70 gene promoter in Indian Zebu cattle of Hariana breed in comparison to Taurus cattle Locus
Variation
Region
Type
Frequency
486 327 188 159 þ4 þ60 þ124 þ189
T=A A=G C=T G=C C=G G=T A=C G=C
5’ Flanking Promoter Promoter Promoter 5’ UTR 5’ UTR 5’ UTR 5’ UTR
Transversion Transition Transition Transversion Transversion Transversion Transversion Transversion
0.208 0.292 0.875 0.750 0.167 0.667 0.208 0.167
CAAT=enhancer binding protein (C=EBP) and CAAT binding transcription factor (CTF) binding sites, as well as the GC box identified as sp1 binding site, were localized in at least two regulatory regions. In earlier studies in humans and other mammalian species, the role of a proximal and a distal regulatory region in the 5’ upstream region of hsp70 gene has been envisaged in the basal expression of this gene at ambient conditions of cell growth and differentiation (11, 15–17). In the sequence obtained for Hariana cattle, proximal domain was observed containing a CTF binding site between 73 to 64 and a sp1 binding site between the 55 to 44 positions. The distal domain with sites for CTF binding and sp1 binding, located between 156 to 147 and 179 to 169, respectively, was also observed in the consensus sequence obtained for zebu cattle. The small region of promoter that extends from upstream of 70 position to about 40–50 bases, has been implicated in the elevated expression of hsp70 gene during stress conditions such as heat stress (18–20). This region also contains a heat Table 2 Major putative cis-acting sites in hsp70 promoter in Zebu cattle of Hariana breed Position of putaive cis-acting sites As per NCBI Gene Bank Relative to the sequence EU872051.1 transcription start site 60 365 388 390 408 436 471 474 489 514 519
to to to to to to to to to to to
69 375 395 399 421 449 480 488 498 523 524
484 to 475 179 to 169 156 to 147 154 to 145 136 to 123 108 to 95 73 to 64 70 to 56 55 to 44 30 to 21 25 to 20
Characteristic of cis-acting site C=EBP binding site sp1 binding site CTF binding site C=EBP binding site sp1 binding site Heat shock element CTF binding site C=EBP binding site sp1 binding site TFII D binding site TATA signal
C=EBP, CAAT=enhancer binding protein; CTF, CAAT binding transcription factor; TFII D, transcription factor II D.
Downloaded by [George Mason University] at 14:32 08 January 2015
hsp70 GENE PROMOTER FOR cis-ACTING ELEMENTS
163
shock element (HSE) that is a binding site for the heat shock transcription factor-1 (4, 5). Within this region, a highly conserved HSE was found between position 108 to 95, which exactly matched all eight positions with the consensus sequence of HSE, CNNGAANNTTCNNG. It overlapped with a weak HSE between position 98 to 85, in which four out of eight positions matched with consensus sequence. These two were flanked by two more weak HSE’s located at position 118 to 105 and 92 to 79 with five and four out of eight nucleotides matching the consensus sequence. However, the HSE between positions 108 to 95 with all eight positions matching with the consensus sequence is more likely to play a major role in in vivo conditions. It argues that the cattle hsp70 promoter contains two domains for basic level expression and the domain for elevated expression containing HSE is localized between these two basal domains. Furthermore, analysis of the available sequence at NCBI (AY149618.1) for 5’ flanking region of hsp70 gene revealed conservation of observed HSE in Holstein-Friesian and studied zebu breed. In fact, none of the observed changes in the hsp70 promoter in zebu cattle of Hariana breed compared to Holstein-Friesian led to gain or loss of any putative cis-acting site (Table 2), suggesting that the promoter variation may not be the source of the difference in expression level of hsp70 in zebu and Taurine cattle types. ACKNOWLEDGMENTS We gratefully acknowledge the Shri Krishan Goshala, Nissing, Karnal (Haryana) for providing samples, and Mr. Rakesh Kumar and Mr. Sewa Ram for their help during blood sample collection. REFERENCES 1. Williams JS, Shrode RE, Leighton RE, Rupel WI. A study of the influence of solar radiation on physiological response of dairy cattle. J Dairy Sci 1960; 43:1245–1254. 2. Schleger AV, Turner HG. Sweating rates of cattle in the field and their reaction to diurnal and seasonal changes. Aust J Agri Res 1965; 16:92–106. 3. Yeats NTM, Murray DM. Walking trials with cattle – a breed comparison in moderate heat. J Agri Sci 1966; 67:353–358. 4. Williams GT, Morimoto RI. Maximal stress induced transcription from the human hsp70 promoter requires interactions with the basal promoter elements independent of rotational alignment. Mol Cell Biol 1990; 10:3125–3126. 5. Collier RJ, Collier JL, Rhoads RP, Baumgard LH. Genes involved in bovine heat shock response. J Dairy Sci 2008; 91:445–454. 6. Kao H-T, Capasso O, Heintz N, Nevins JR. Cell cycle control of the human HSP70 gene: implications for the role of a cellular ElA-like function. Mol Cell Biol 1985; 5:628–633. 7. Milarski KL, Morimoto RI. Expression of human hsp70 during the synthetic phase of the cell cycle. Proc Natl Acad Sci USA 1986; 83:9517–9521. 8. Wu BJ, Morimoto RI. Transcription of the human hsp70 gene is induced by serum stimulation. Proc Natl Acad Sci USA 1985; 82:6070–6074. 9. Wu BJ, Kingston RE, Morimoto RI. Human hsp70 promoter contains at least two distinct regulatory domains. Proc Natl Acad Sci USA 1986; 83:629–633. 10. Watowich SS, Morimoto RI. Complex regulation of heat shock- and glucose response genes in human cells. Mol Cell Biol 1988; 8:393–405.
Downloaded by [George Mason University] at 14:32 08 January 2015
164
R. BEHL ET AL.
11. Greene JM, Larin Z, Taylor ICA, Prentice H, Gwinn KA, Kingston RE. Multiple basal elements of a human hsp70 promoter function differently in human and rodent cell lines. Mol Cell Biol 1987; 7:3646–3655. 12. Morgan WD, Williams GT, Morimoto RI, Greene J, Kingston RE, Tjian R. 1987. Two transcriptional activators, CCAAT-box-binding transcription factor and heat shock transcription factor, interact with a human hsp70 gene promoter Mol Cell Biol 1987; 7:1129–1138. 13. Wu C, Wilson S, Walker B, Dawid I, Paisley V, Zimarino V, Ueda H. Purification and properties of Drosophila heat shock activator protein. Science 1987; 238:1247–1253. 14. Rozen S, Skaletsky HJ. Bioinfromatics Methods and Protocols - Methods in Molecular Biology. Totowa: Humana Press. 2000:365–386. http://frodo.wi.mit.edu/primer3/ input.htm. Accessed July 2007. 15. Morgan WD. Transcription factor spl binds to and activates a human hsp70 gene promoter. Mol Cell Biol 1989; 9:4099–4104. 16. Hunt C, Morimoto RI. Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70. Proc Natl Acad Sci USA 1985; 82:6455–6459. 17. Williams GT, McClanahan TK, Morimoto RI. E1A transactivation of the human hsp70 promoter is mediated through the basal transcriptional complex. Mol Cell Biol 1989; 9:2574–2587. 18. Lindquist S. The heat shock response. Annu Rev Biochem 1986; 55:1151–1191. 19. Amin J, Mestril R, Schiller P, Dreano M, Voellmy R. Organization of the Drosophila melongaster hsp70 heat shock regulation unit. Mol Cell Biol 1987; 7:1055–1062. 20. Xiao H, Lis JT. Germline transformation used to define key features of heat shock response elements. Science 1988; 239:1139–1142.
Animal Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/labt20
Characterization of hsp70 Gene Promoter for cis- Acting Elements in Indian Zebu Cattle of Hariana Breed a
a
a
a
Rahul Behl , Jyotsna Behl , D. K. Sadana , R. K. Vijh , M. S. a
Tantia & B. K. Joshi
a
a
National Bureau of Animal Genetic Resources , Karnal , Haryana , India Published online: 26 Mar 2014.
Click for updates To cite this article: Rahul Behl , Jyotsna Behl , D. K. Sadana , R. K. Vijh , M. S. Tantia & B. K. Joshi (2014) Characterization of hsp70 Gene Promoter for cis- Acting Elements in Indian Zebu Cattle of Hariana Breed, Animal Biotechnology, 25:3, 160-164, DOI: 10.1080/10495398.2013.844161 To link to this article: http://dx.doi.org/10.1080/10495398.2013.844161
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &
Downloaded by [George Mason University] at 14:32 08 January 2015
Conditions of access and use can be found at http://www.tandfonline.com/page/termsand-conditions
Animal Biotechnology, 25: 160–164, 2014 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495398.2013.844161
CHARACTERIZATION OF hsp70 GENE PROMOTER FOR cis- ACTING ELEMENTS IN INDIAN ZEBU CATTLE OF HARIANA BREED
Downloaded by [George Mason University] at 14:32 08 January 2015
Rahul Behl, Jyotsna Behl, D. K. Sadana, R. K. Vijh, M. S. Tantia, and B. K. Joshi National Bureau of Animal Genetic Resources, Karnal, Haryana, India The promoter region of hsp70 gene was characterized for cis-acting elements in zebu cattle of Hariana breed. The basal regulatory domain of CAAT box identified as CAAT/enhancer binding protein (C/EBP) and CAAT binding transcription factor (CTF) binding sites, as well as GC box identified as sp1 binding site, were localized in at least two regions in the hsp70 gene promoter. A highly conserved heat shock element was found between position 108 to 95, which exactly matched at all eight positions with the consensus sequence. These cis-acting elements were found to be conserved between Holstein-Friesian and studied zebu breed. Keywords: hsp70 gene; Promoter-elements; Hariana cattle
The Indian zebu cattle (Bos indicus) breed has been selected over centuries for their ability to survive in tropical heat conditions by natural factors as well as through human intervention (1–3). Additionally, altered physiological response, at elevated core body temperature, increased expression of heat shock proteins (hsp) genes, including hsp70, play a central role in heat stress regulation at cellular level (4, 5). The cis-acting promoter elements play a significant role in complex transcriptional regulation of basal expression of hsp genes at ambient conditions as well as elevated expression during stress conditions including heat stress (6–10). This complexity in transcriptional regulation is partly attributed to the multiplicity of these cis-acting promoter elements (9, 11–13). This study was undertaken to characterize the 5’ flanking region of hsp70 gene for cis-acting sites in zebu cattle of Hariana breed and compare them with Taurus cattle.
MATERIALS AND METHODS The blood samples were collected from twenty-four unrelated animals of Hariana breed of Indian zebu cattle from Shri Krishan Goshala, Nissing, Karnal, India. The genomic DNA was isolated from collected samples by standard procedure of digestion with proteinase-K, separation with phenol=chloroform, and extraction Address correspondence to Rahul Behl, National Bureau of Animal Genetic Resources, P.O. Box 129, GT By-Pass Road, Karnal 132001, Haryana, India. E-mail: [email protected] 160
Downloaded by [George Mason University] at 14:32 08 January 2015
hsp70 GENE PROMOTER FOR cis-ACTING ELEMENTS
161
with ethanol. The isolated DNA samples were stored at 20 C and working dilutions were stored at 4 C. Three primer pairs, covering overlapping DNA segments, were designed for 5’ flanking region of hsp70 (hspa1b) gene using the sequence of Taurus cattle (AY149618.1), available at National Center for Biotechnology Information (NCBI) Gene Bank using Primer3 computer program (14). The primers covered a total region covering 1027 bases from 620 of flanking region to þ407 of 5’ UTR and exon 1. The sequences of the three primers were: 50 TCTCCTTTTCCTTCCCATTTT30 and 50 TTCTAGGATTCGCTGGAGGA30 , 50 AACTACTTGGCTGGCTGGTC30 and 5 0 CGGAACCCGAAAACTGAAC3 0 , and 5 0 AGCCGCCTGAGGAGAAAC3 0 and 5 0 ACCGTGTTCTGCGGGTTC3 0 . The genomic DNA was amplified by a polymerase chain reaction (PCR) using these primers. Each 25-mL reaction consisted of DNA (about 100 ng), dNTP’s (40 mM each), 10X buffer (10 mM tris-HCl, 50 mM KCl, 01% gelatin, pH 8.4)(2.5 mL), MgCl2 (1.5 mM), and Taq DNA polymerase (0.75 units). The thermocyclic conditions were 94 C for 2 minutes followed by 30 cycles of 92 C for 45 seconds, annealing at optimum temperature for 45 seconds and extension at 72 C for 15 minutes. The amplified product was treated with exonuclease I and shrimp alkaline phosphatase to remove unused primers and dNTPs. The treated product was sequenced on Avant 3100 (Applied Biosystems) automated DNA sequencer. The multipass sequences with forward and reverse primers for each animal were aligned and compared to the sequence of Bos taurus using MegAlign option of DNAstar computer program (version 4.0). The putative cis-acting sites were identified using TESS (http:==www.cbil. upenn.edu/cgi-bin/tess/tess) and ALIBABA2.1 (http://www.gene-regulation.com/ pub/programs.html) computer programs. On the basis of overlapping hits revealed by both programs and the literature data (9, 12, 15), we manually selected potentially important cis-acting sites in the promoter region of hsp70. RESULTS AND DISCUSSION The consensus sequence for 5’ flanking region of hsp70 gene of Hariana breed of Indian zebu cattle obtained after aligning the sequences across three primers and animals was submitted to NCBI gene bank (EU872051.1). In comparison to the sequence available for Bos taurus (AY149618.1), no insertions or deletions were observed in the nucleotide sequence of 50 flanking region of hsp70 gene obtained in the studied animals of Hariana breed. In all, eight single nucleotide changes were observed with varying degrees of occurrence, two were transitions, whereas six were transversions. Four of the observed changes were in the promoter region and four were in the 50 UTR region. The transversion G=C at position 159 in the promoter region had the highest frequency of 0.75, whereas transition C=T at position 188 also in the promoter region showed the highest frequency of 0.875 (Table 1). The putative cis-acting elements identified in the consensus sequence obtained for zebu cattle of Hariana breed are given in Table 2. The TATA signal or the binding site for transcription factor II D is located in the region 30 to 20 bp upstream of the transcription start site. The basal regulatory domain of CAAT box identified as
162
R. BEHL ET AL.
Downloaded by [George Mason University] at 14:32 08 January 2015
Table 1 Frequencies of sequence variation in the hsp70 gene promoter in Indian Zebu cattle of Hariana breed in comparison to Taurus cattle Locus
Variation
Region
Type
Frequency
486 327 188 159 þ4 þ60 þ124 þ189
T=A A=G C=T G=C C=G G=T A=C G=C
5’ Flanking Promoter Promoter Promoter 5’ UTR 5’ UTR 5’ UTR 5’ UTR
Transversion Transition Transition Transversion Transversion Transversion Transversion Transversion
0.208 0.292 0.875 0.750 0.167 0.667 0.208 0.167
CAAT=enhancer binding protein (C=EBP) and CAAT binding transcription factor (CTF) binding sites, as well as the GC box identified as sp1 binding site, were localized in at least two regulatory regions. In earlier studies in humans and other mammalian species, the role of a proximal and a distal regulatory region in the 5’ upstream region of hsp70 gene has been envisaged in the basal expression of this gene at ambient conditions of cell growth and differentiation (11, 15–17). In the sequence obtained for Hariana cattle, proximal domain was observed containing a CTF binding site between 73 to 64 and a sp1 binding site between the 55 to 44 positions. The distal domain with sites for CTF binding and sp1 binding, located between 156 to 147 and 179 to 169, respectively, was also observed in the consensus sequence obtained for zebu cattle. The small region of promoter that extends from upstream of 70 position to about 40–50 bases, has been implicated in the elevated expression of hsp70 gene during stress conditions such as heat stress (18–20). This region also contains a heat Table 2 Major putative cis-acting sites in hsp70 promoter in Zebu cattle of Hariana breed Position of putaive cis-acting sites As per NCBI Gene Bank Relative to the sequence EU872051.1 transcription start site 60 365 388 390 408 436 471 474 489 514 519
to to to to to to to to to to to
69 375 395 399 421 449 480 488 498 523 524
484 to 475 179 to 169 156 to 147 154 to 145 136 to 123 108 to 95 73 to 64 70 to 56 55 to 44 30 to 21 25 to 20
Characteristic of cis-acting site C=EBP binding site sp1 binding site CTF binding site C=EBP binding site sp1 binding site Heat shock element CTF binding site C=EBP binding site sp1 binding site TFII D binding site TATA signal
C=EBP, CAAT=enhancer binding protein; CTF, CAAT binding transcription factor; TFII D, transcription factor II D.
Downloaded by [George Mason University] at 14:32 08 January 2015
hsp70 GENE PROMOTER FOR cis-ACTING ELEMENTS
163
shock element (HSE) that is a binding site for the heat shock transcription factor-1 (4, 5). Within this region, a highly conserved HSE was found between position 108 to 95, which exactly matched all eight positions with the consensus sequence of HSE, CNNGAANNTTCNNG. It overlapped with a weak HSE between position 98 to 85, in which four out of eight positions matched with consensus sequence. These two were flanked by two more weak HSE’s located at position 118 to 105 and 92 to 79 with five and four out of eight nucleotides matching the consensus sequence. However, the HSE between positions 108 to 95 with all eight positions matching with the consensus sequence is more likely to play a major role in in vivo conditions. It argues that the cattle hsp70 promoter contains two domains for basic level expression and the domain for elevated expression containing HSE is localized between these two basal domains. Furthermore, analysis of the available sequence at NCBI (AY149618.1) for 5’ flanking region of hsp70 gene revealed conservation of observed HSE in Holstein-Friesian and studied zebu breed. In fact, none of the observed changes in the hsp70 promoter in zebu cattle of Hariana breed compared to Holstein-Friesian led to gain or loss of any putative cis-acting site (Table 2), suggesting that the promoter variation may not be the source of the difference in expression level of hsp70 in zebu and Taurine cattle types. ACKNOWLEDGMENTS We gratefully acknowledge the Shri Krishan Goshala, Nissing, Karnal (Haryana) for providing samples, and Mr. Rakesh Kumar and Mr. Sewa Ram for their help during blood sample collection. REFERENCES 1. Williams JS, Shrode RE, Leighton RE, Rupel WI. A study of the influence of solar radiation on physiological response of dairy cattle. J Dairy Sci 1960; 43:1245–1254. 2. Schleger AV, Turner HG. Sweating rates of cattle in the field and their reaction to diurnal and seasonal changes. Aust J Agri Res 1965; 16:92–106. 3. Yeats NTM, Murray DM. Walking trials with cattle – a breed comparison in moderate heat. J Agri Sci 1966; 67:353–358. 4. Williams GT, Morimoto RI. Maximal stress induced transcription from the human hsp70 promoter requires interactions with the basal promoter elements independent of rotational alignment. Mol Cell Biol 1990; 10:3125–3126. 5. Collier RJ, Collier JL, Rhoads RP, Baumgard LH. Genes involved in bovine heat shock response. J Dairy Sci 2008; 91:445–454. 6. Kao H-T, Capasso O, Heintz N, Nevins JR. Cell cycle control of the human HSP70 gene: implications for the role of a cellular ElA-like function. Mol Cell Biol 1985; 5:628–633. 7. Milarski KL, Morimoto RI. Expression of human hsp70 during the synthetic phase of the cell cycle. Proc Natl Acad Sci USA 1986; 83:9517–9521. 8. Wu BJ, Morimoto RI. Transcription of the human hsp70 gene is induced by serum stimulation. Proc Natl Acad Sci USA 1985; 82:6070–6074. 9. Wu BJ, Kingston RE, Morimoto RI. Human hsp70 promoter contains at least two distinct regulatory domains. Proc Natl Acad Sci USA 1986; 83:629–633. 10. Watowich SS, Morimoto RI. Complex regulation of heat shock- and glucose response genes in human cells. Mol Cell Biol 1988; 8:393–405.
Downloaded by [George Mason University] at 14:32 08 January 2015
164
R. BEHL ET AL.
11. Greene JM, Larin Z, Taylor ICA, Prentice H, Gwinn KA, Kingston RE. Multiple basal elements of a human hsp70 promoter function differently in human and rodent cell lines. Mol Cell Biol 1987; 7:3646–3655. 12. Morgan WD, Williams GT, Morimoto RI, Greene J, Kingston RE, Tjian R. 1987. Two transcriptional activators, CCAAT-box-binding transcription factor and heat shock transcription factor, interact with a human hsp70 gene promoter Mol Cell Biol 1987; 7:1129–1138. 13. Wu C, Wilson S, Walker B, Dawid I, Paisley V, Zimarino V, Ueda H. Purification and properties of Drosophila heat shock activator protein. Science 1987; 238:1247–1253. 14. Rozen S, Skaletsky HJ. Bioinfromatics Methods and Protocols - Methods in Molecular Biology. Totowa: Humana Press. 2000:365–386. http://frodo.wi.mit.edu/primer3/ input.htm. Accessed July 2007. 15. Morgan WD. Transcription factor spl binds to and activates a human hsp70 gene promoter. Mol Cell Biol 1989; 9:4099–4104. 16. Hunt C, Morimoto RI. Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70. Proc Natl Acad Sci USA 1985; 82:6455–6459. 17. Williams GT, McClanahan TK, Morimoto RI. E1A transactivation of the human hsp70 promoter is mediated through the basal transcriptional complex. Mol Cell Biol 1989; 9:2574–2587. 18. Lindquist S. The heat shock response. Annu Rev Biochem 1986; 55:1151–1191. 19. Amin J, Mestril R, Schiller P, Dreano M, Voellmy R. Organization of the Drosophila melongaster hsp70 heat shock regulation unit. Mol Cell Biol 1987; 7:1055–1062. 20. Xiao H, Lis JT. Germline transformation used to define key features of heat shock response elements. Science 1988; 239:1139–1142.
