IJC International Journal of Cancer
Characterization of functional domains in the Merkel cell polyoma virus Large T antigen Roland Houben1, Sabrina Angermeyer1, Sebastian Haferkamp1,2, Annemarie Aue1, Matthias Goebeler1, David Schrama3 and Sonja Hesbacher1 1
€rzburg, Germany Department of Dermatology, University Hospital, Wu €ner-Forschungskolleg, Wu €rzburg, Germany Else-Kro 3 Department of Dermatology, Medical University, Graz, Austria
Merkel cell polyomavirus (MCPyV)-positive Merkel cell carcinoma (MCC) tumor cell growth is dependent on the expression of a viral Large T antigen (LT) with an intact retinoblastoma protein (RB)-binding site. This RB-binding domain in MCPyV-LT is—in contrast to other polyomavirus LTs (e.g., SV40)—embedded between two large MCPyV unique regions (MUR1 and MUR2). To identify elements of the MCPyV-LT necessary for tumor cell growth, we analyzed the rescue activity of LT variants following knockdown of the endogenous LT in MCC cells. These experiments demonstrate that nuclear localization is essential for LT function, but that a motif previously described to be a nuclear localization sequence is neither required for nuclear accumulation of truncated MCPyV-LT nor for promotion of MCC cell proliferation. Furthermore, large parts of the MURs distal to the RB binding domain as well as ALTO—a second protein encoded by an alternative reading frame in the MCPyV-LT mRNA—are completely dispensable for MCPyV-driven tumor cell proliferation. Notably, even MCPyV-LTs in which the entire MURs have been removed are still able to promote MCC cellular growth although rescue activity is reduced which may be due to MUR1 being required for stable LT expression in MCC cells. Finally, we provide evidence implying that—while binding to Vam6p is not essential—HSC-70 interaction is significantly involved in mediating MCPyV-LT function in MCC cells including growth promotion and induction of E2F target genes.
Polyomaviruses are small DNA viruses with a circular double-stranded genome coding for 5–9 proteins.1 The genome is divided into an early and a late region. From the early region the T antigens (TA) are derived by differential splicing of a common transcript while the late region encodes for capsid proteins into which the viral genome is packaged.2 It has long been known that polyomaviruses—as the name indicates—can induce tumor formation.3 Until recently, however, this had only been observed in animal models while— despite extensive research and controversial discussion—no convincing evidence for a contribution of the Simian Virus 40 (SV40), a monkey polyomavirus that is also present in the human population, or the two well-studied human polyomaviruses JC and BK to human malignancies could be Key words: Merkel cell carcinoma, polyomavirus, Large T antigen Additional Supporting Information may be found in the online version of this article. Grant sponsor: Wilhem–Sander–Stiftung; Grant number: 2007.057.3; Grant sponsor: German Research Foundation; Grant number: HO5280/2-1 DOI: 10.1002/ijc.29200 History: Received 12 May 2014; Accepted 19 Aug 2014; Online 10 Sep 2014 Correspondence to: Roland Houben, Department of Dermatology, University Hospital W€ urzburg, Josef-Schneider-Str. 2, D-97080 W€ urzburg, Germany, Tel.: 149-931-20126756, Fax: 149-93120121752, E-mail: [email protected]
C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V
obtained.4,5 In contrast, one of the seven newly identified human polyomaviruses discovered during the last 6 years, the Merkel cell polyomavirus (MCPyV), is now well established as a causal factor of Merkel cell carcinoma (MCC).2,4,6 MCC is a rare but very aggressive skin cancer with high mortality rates. Immunosuppression, UV exposure and old age are risk factors for developing MCC.7 The molecular pathogenesis of MCC, however, remained enigmatic until MCPyV was discovered as monoclonally integrated into the genome of most MCCs indicating that integration occurred prior to clonal expansion of the tumor cells.8 In many different countries the presence of MCPyV in the vast majority of MCC tumors has been confirmed,9–12 and a recent publication suggests that MCPyV might be associated with virtually all MCC cases.13 In MCPyV-positive MCC cells, viral small and Large T antigen (sT and LT) are expressed.14 The two proteins have the N-terminal 78 amino acids in common, while the Cterminus is different. A large part of the LT-specific C-terminal part, however, is missing in the MCC-associated MCPyVLTs due to integration break points within the LT sequence or stop codon mutations.15,16 These LT proteins expressed in the tumor cells lack domains essential for viral replication while the binding motif for the retinoblastoma protein (RB) is always preserved. Recently, a further protein encoded in the MCPyV early region by an alternate frame in the Large T open reading frame (ALTO) has been identified.17 Without sharing much sequence homology, ALTO is evolutionarily related to the
Infectious Causes of Cancer
2
2
MCPyV large T antigen
Infectious Causes of Cancer
What’s new? The Merkel cell polyomavirus (MCPyV) is the first virus of the polyomavirus family to be established as a causal factor of a human cancer. Merkel cell carcinoma is a rare but very aggressive skin cancer with high mortality rates. Here, the authors describe experiments defining certain domains and molecular functions of the Large T antigen encoded by MCPyV, which are either essential or dispensable for its growth-promoting function in Merkel cell carcinoma cells.
Middle T antigen (MT) of the murine polyomavirus (MPyV). MPyV encodes also sT and LT, but MT exerts most of the transforming activity of this virus.18 In contrast, in case of SV40, which does not code for an ALTO/MT, LT seems to be the driving oncogene while sT acts supportive.19,20 For MCPyV the picture is again different as only MCPyV sT cDNA is able to transform fibroblasts while MCPyV-LT cDNA is inactive in this type of assays.14,21 In contrast, in established MCPyV-positive MCC cells the relative ability of sT and LT to support cellular growth is inverse compared to their transforming capacity in fibroblast assays. Knockdown of TA expression using shRNAs targeting both TAs induces cell cycle arrest and cell death of MCPyV-positive MCC cell lines in vitro, and regression of established xenograft tumors.22,23 TA-shRNA-induced growth inhibition is rescued by re-expression of shRNA-insensitive MCPyV-TA. However, introducing a mutation affecting RB binding by LT completely abolishes the rescue activity demonstrating that LT is essential.23 Moreover, re-expression of only MCPyV-LT is sufficient for a complete rescue of the TA-shRNA- induced growth inhibition suggesting that MCPyV sT is dispensable for established MCC cells.21 This issue, however, is discussed controversially.24 Here, we investigate the rescue activity of a set of LT variants following MCPyV-TA knockdown in MCC cells to determine the impact of various domains for LT’s function.
Material and Methods Cell culture
The MCPyV-positive MCC cell lines WaGa,22 LoKe,25 MKL126 and MKL-227 as well as NIH3T3 fibroblasts and HEK293T cells were grown in RPMI 1640 supplemented with 10 % FCS, 100 U ml21 penicillin and 0.1 mg ml21 streptomycin. To establish pure populations of cells with integrated retroviral pIH expression vectors 100 mg ml21 Hygromycin B was added to the culture medium for 2 weeks. shRNA and ectopic TA or LT expression
The lentiviral shRNA vector pGreenPuro (System Biosciences), which drives constitutive co-expression of an shRNA and GFP was used to achieve knockdown of MCPyV-TAs. The vector contained either a scrambled control shRNA or an shRNA sequence (sense strand 50 -ATCCACAAGCTCAGAAGTGA CTTCTCTATTCA AGAGATAGAGAAGTCACTTCTGAG CTTGTGGATTTTTTT-30 ) designed to target the nucleotides 391–419 (accession number: EU375803) present in all
MCPyV-TA mRNAs. In some experiments the same TA shRNA was expressed from the lentiviral tetracycline- inducible expression vector TA.shRNA.tet.23 For generation of MCC cell lines stably expressing ectopic shRNA-insensitive MCPyV-TA, LT or SV40-TA, the respective genes or cDNAs were cloned into the retroviral vector pIH containing a hygromycin resistance gene.23 TA expression constructs contain a T antigen gene coding for sT and LT while LT expression constructs contain only an LTcDNA. The ectopically expressed MCPyV mRNAs were made insensitive to the TA-shRNA by introduction of six silent mutations in the TA-shRNA target sequence using the quick change mutagenesis kit (Stratagene).23 All the point mutants, deletion variants and chimeric hybrids described in the results section (see also Fig. 1) were derived from these pIH constructs by in vitro mutagenesis and other PCR techniques. In some experiments LT or TA cloned into the lentiviral vector pCDH (System Biosciences) were used. Properness of the intended constructs was confirmed by sequencing the complete coding sequence. Retro- and lentivirus-containing supernatants were generated by transient transfection of HEK293T and infection of target cells was carried out as previously described.23 GFP assay
GFP expression of pGreenPuro-infected cells was used to compare the growth behavior of infected and uninfected cells: infected cells were mixed with 20% of uninfected cells. Changes in the frequency of GFP-positive cells in this mixture were determined by flow cytometry over time. Immunoblotting
Immunoblotting was performed as previously described23 with total cell lysates harvested on day 5 following shRNA infection. The antibodies used in this study were directed against MCPyV-LT (CM2B4; Santa Cruz Biotechnologies), the V5 tag (SV5-Pk1; Abcam) or b-tubulin (TUB 2.1; Sigma–Aldrich). Real time PCR
Total RNA was isolated with Qiagen RNAeasy columns and reverse transcribed using the Superscript II RT First Strand Kit (Invitrogen). Real time PCR was conducted in the ABI 7500 Fast Real-Time PCR cycler (Applied Biosystems) using a SybrGreen I Low Rox Mastermix (Eurogentec GmbH). The following primers were applied: C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V
Figure 1. Schematic illustration of different Large T proteins analyzed in this study. The two MCPyV unique regions (MUR-1 and MUR-2) flanking the retinoblastoma protein (RB) binding motif (LxCxE), and distinguishing MCPyV-LT from all other LT proteins exemplified by Simian virus 40 (SV40) are marked by green boxes. Further domains and elements are marked by red boxes: The J-domain is found in many HSP70-interacting proteins. The Psycho motif (including an YGT sequence) is conserved in many RB-binding proteins and is considered to modulate the interaction with RB. The LxCxE motif is essential for RB binding. Two nuclear localization sequences (NLS) are marked, one present in SV40 and other LT proteins but not well conserved in MCPyV and a second (RKRK) unique for MCPyV-LT. MKL-1, WaGa, LoKe and AlDo are four cell lines which naturally express the respective MCPyV-LTs. Several further modifications (deletion 102–207, stop codon 232 or addition of a nuclear export signal (NES)) were introduced artificially. Numbers indicate the amino acid positions. The MCPyV-LT mRNA contains a coding sequence for a further protein named ALTO (alternative frame in the Large T open reading frame). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
MYB: TCCACACTGCCCAAGTCTCT; AGCAAGCTGTT GTCTTCTTTGA; CDC6: CCTGTTCTCCTCGTGTAAAAG; GTGTTGCA TAGGTTGTCATCG; CCNB1: CGCCTGAGCCTATTT TGGT; GCACATCC AGATGTTTCCATT; PLK1: AAGATCTGGAGGTGAAAATAGGG; AGGAG TCCCACACAGGGTCT; GAPDH: GCCCAATACGACCAAATCC; AGCCACAT CGCTCAGACAC; SV40-LT: CTGGGATGCAACTGAGATTC; CATTAA AGGCATTCCACCACTG; Ectopically expressed MCPyV-LT with modified shRNA target site23: GCAAAATATTCATAAACTCAGGAGC; GGGGCCTCG TCAACCTC; Relative expression levels were determined applying the comparative DD2CT method and given as percent relative to the vector control.
thrombin clots were fixed with formalin and embedded in paraffin before immunocytochemistry was carried out on 5 mm sections as previously described.23 For immunofluorescence, either cytospins of MCC cells or NIH3T3 cells cultured on chamber slides were fixed with 4% paraformaldehyde in PBS. Permeabilization, washes, actin staining with Alexa Fluor rhodamin phalloidin, staining with the primary antibody (CM2B4) and staining of the nucleus with DAPI was performed as described.28 A FITC-tagged secondary anti-mouse IgG antibody was applied to visualize the CM2B4 antibody bound to MCPyV-LT. Transformation assay
After flow cytometry confirmed successful infection of 2 3 105 NIH3T3 cells with lentiviral TA or LT expression constructs, cells were plated in T75 flasks. On day 25 after infection, focus formation was monitored by crystal violet staining. Statistics
Immunocytochemistry and immunofluorescence
The CM2B4 antibody (Santa Cruz Biotechnologies) was used as primary antibody to detect MCPyV-LT by immunocytochemistry and immunofluorescence. Cells immobilized in C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V
Statistical analysis was performed with GraphPad Prism 5.03 software, STATA 11 and SPSS. We first calculated the area under the curve (AUC) for each curve derived by the GFP assay. Next, we confirmed the equality of variances between
Infectious Causes of Cancer
3
Houben et al.
Infectious Causes of Cancer
4
MCPyV large T antigen
Figure 2. The RKRK motif is not required for nuclear localization and the growth- promoting activity of MCPyV-LT. MKL-1 cells naturally express an MCPyV-LT consisting of 330 amino acids including the proposed nuclear localization sequence RKRK (see Fig. 1). (a and b) MKL1 cells were stably transduced with empty vector, or with expression constructs coding for the MCPyV-TAs (sT and LT) with the indicated LT proteins characterized by different truncations and deletions (see Fig. 1). Six nucleotide exchanges in the shRNA target sequence rendered the ectopic TA-mRNAs insensitive to the TA-shRNA. Subsequently, the cells carrying these constructs were infected with the lentiviral TAshRNA expression construct coding also for GFP. (a) Expression of endogenous and ectopically expressed LT (antibody: CM2B4) was measured by immunoblot in cell lysates harvested 5 days after shRNA infection. Note that due to the deletion in LTAlDo eliminating the epitope targeted by CM2B4 it cannot be detected. Tubulin served as loading control. (b) The ratios of a mixed population of green fluorescent shRNA-infected cells with uninfected, non-fluorescent cells were determined over time. Relative ratios based in each case on the measurement of the first time point were calculated and mean values (6 SD) of at least three independent experiments are depicted. Black and red star indicate a statistically significant difference (p < 0.05) relative to vector and TAWaGa, respectively. (c) Endogenous MCPyV-LT was visualized in the indicated cell lines by applying the CM2B4 antibody in immunocytochemistry on sections of formalin fixed and paraffin embedded cells or by immunofluorescence on cytospins. (green: MCPyV-LT, red: actin [phalloidin]; blue: DAPI). LT of MKL-1 contains the RKRK motif while this motif is partially or completely deleted in WaGa and LoKe, respectively (Fig. 1). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
the groups by the Levene’s robust test statistic. The AUC of each group was then compared by one-way-ANOVA followed by Gabriel post hoc testing where each curve was compared once to vector control and once to TAWaGa. A p value
Characterization of functional domains in the Merkel cell polyoma virus Large T antigen Roland Houben1, Sabrina Angermeyer1, Sebastian Haferkamp1,2, Annemarie Aue1, Matthias Goebeler1, David Schrama3 and Sonja Hesbacher1 1
€rzburg, Germany Department of Dermatology, University Hospital, Wu €ner-Forschungskolleg, Wu €rzburg, Germany Else-Kro 3 Department of Dermatology, Medical University, Graz, Austria
Merkel cell polyomavirus (MCPyV)-positive Merkel cell carcinoma (MCC) tumor cell growth is dependent on the expression of a viral Large T antigen (LT) with an intact retinoblastoma protein (RB)-binding site. This RB-binding domain in MCPyV-LT is—in contrast to other polyomavirus LTs (e.g., SV40)—embedded between two large MCPyV unique regions (MUR1 and MUR2). To identify elements of the MCPyV-LT necessary for tumor cell growth, we analyzed the rescue activity of LT variants following knockdown of the endogenous LT in MCC cells. These experiments demonstrate that nuclear localization is essential for LT function, but that a motif previously described to be a nuclear localization sequence is neither required for nuclear accumulation of truncated MCPyV-LT nor for promotion of MCC cell proliferation. Furthermore, large parts of the MURs distal to the RB binding domain as well as ALTO—a second protein encoded by an alternative reading frame in the MCPyV-LT mRNA—are completely dispensable for MCPyV-driven tumor cell proliferation. Notably, even MCPyV-LTs in which the entire MURs have been removed are still able to promote MCC cellular growth although rescue activity is reduced which may be due to MUR1 being required for stable LT expression in MCC cells. Finally, we provide evidence implying that—while binding to Vam6p is not essential—HSC-70 interaction is significantly involved in mediating MCPyV-LT function in MCC cells including growth promotion and induction of E2F target genes.
Polyomaviruses are small DNA viruses with a circular double-stranded genome coding for 5–9 proteins.1 The genome is divided into an early and a late region. From the early region the T antigens (TA) are derived by differential splicing of a common transcript while the late region encodes for capsid proteins into which the viral genome is packaged.2 It has long been known that polyomaviruses—as the name indicates—can induce tumor formation.3 Until recently, however, this had only been observed in animal models while— despite extensive research and controversial discussion—no convincing evidence for a contribution of the Simian Virus 40 (SV40), a monkey polyomavirus that is also present in the human population, or the two well-studied human polyomaviruses JC and BK to human malignancies could be Key words: Merkel cell carcinoma, polyomavirus, Large T antigen Additional Supporting Information may be found in the online version of this article. Grant sponsor: Wilhem–Sander–Stiftung; Grant number: 2007.057.3; Grant sponsor: German Research Foundation; Grant number: HO5280/2-1 DOI: 10.1002/ijc.29200 History: Received 12 May 2014; Accepted 19 Aug 2014; Online 10 Sep 2014 Correspondence to: Roland Houben, Department of Dermatology, University Hospital W€ urzburg, Josef-Schneider-Str. 2, D-97080 W€ urzburg, Germany, Tel.: 149-931-20126756, Fax: 149-93120121752, E-mail: [email protected]
C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V
obtained.4,5 In contrast, one of the seven newly identified human polyomaviruses discovered during the last 6 years, the Merkel cell polyomavirus (MCPyV), is now well established as a causal factor of Merkel cell carcinoma (MCC).2,4,6 MCC is a rare but very aggressive skin cancer with high mortality rates. Immunosuppression, UV exposure and old age are risk factors for developing MCC.7 The molecular pathogenesis of MCC, however, remained enigmatic until MCPyV was discovered as monoclonally integrated into the genome of most MCCs indicating that integration occurred prior to clonal expansion of the tumor cells.8 In many different countries the presence of MCPyV in the vast majority of MCC tumors has been confirmed,9–12 and a recent publication suggests that MCPyV might be associated with virtually all MCC cases.13 In MCPyV-positive MCC cells, viral small and Large T antigen (sT and LT) are expressed.14 The two proteins have the N-terminal 78 amino acids in common, while the Cterminus is different. A large part of the LT-specific C-terminal part, however, is missing in the MCC-associated MCPyVLTs due to integration break points within the LT sequence or stop codon mutations.15,16 These LT proteins expressed in the tumor cells lack domains essential for viral replication while the binding motif for the retinoblastoma protein (RB) is always preserved. Recently, a further protein encoded in the MCPyV early region by an alternate frame in the Large T open reading frame (ALTO) has been identified.17 Without sharing much sequence homology, ALTO is evolutionarily related to the
Infectious Causes of Cancer
2
2
MCPyV large T antigen
Infectious Causes of Cancer
What’s new? The Merkel cell polyomavirus (MCPyV) is the first virus of the polyomavirus family to be established as a causal factor of a human cancer. Merkel cell carcinoma is a rare but very aggressive skin cancer with high mortality rates. Here, the authors describe experiments defining certain domains and molecular functions of the Large T antigen encoded by MCPyV, which are either essential or dispensable for its growth-promoting function in Merkel cell carcinoma cells.
Middle T antigen (MT) of the murine polyomavirus (MPyV). MPyV encodes also sT and LT, but MT exerts most of the transforming activity of this virus.18 In contrast, in case of SV40, which does not code for an ALTO/MT, LT seems to be the driving oncogene while sT acts supportive.19,20 For MCPyV the picture is again different as only MCPyV sT cDNA is able to transform fibroblasts while MCPyV-LT cDNA is inactive in this type of assays.14,21 In contrast, in established MCPyV-positive MCC cells the relative ability of sT and LT to support cellular growth is inverse compared to their transforming capacity in fibroblast assays. Knockdown of TA expression using shRNAs targeting both TAs induces cell cycle arrest and cell death of MCPyV-positive MCC cell lines in vitro, and regression of established xenograft tumors.22,23 TA-shRNA-induced growth inhibition is rescued by re-expression of shRNA-insensitive MCPyV-TA. However, introducing a mutation affecting RB binding by LT completely abolishes the rescue activity demonstrating that LT is essential.23 Moreover, re-expression of only MCPyV-LT is sufficient for a complete rescue of the TA-shRNA- induced growth inhibition suggesting that MCPyV sT is dispensable for established MCC cells.21 This issue, however, is discussed controversially.24 Here, we investigate the rescue activity of a set of LT variants following MCPyV-TA knockdown in MCC cells to determine the impact of various domains for LT’s function.
Material and Methods Cell culture
The MCPyV-positive MCC cell lines WaGa,22 LoKe,25 MKL126 and MKL-227 as well as NIH3T3 fibroblasts and HEK293T cells were grown in RPMI 1640 supplemented with 10 % FCS, 100 U ml21 penicillin and 0.1 mg ml21 streptomycin. To establish pure populations of cells with integrated retroviral pIH expression vectors 100 mg ml21 Hygromycin B was added to the culture medium for 2 weeks. shRNA and ectopic TA or LT expression
The lentiviral shRNA vector pGreenPuro (System Biosciences), which drives constitutive co-expression of an shRNA and GFP was used to achieve knockdown of MCPyV-TAs. The vector contained either a scrambled control shRNA or an shRNA sequence (sense strand 50 -ATCCACAAGCTCAGAAGTGA CTTCTCTATTCA AGAGATAGAGAAGTCACTTCTGAG CTTGTGGATTTTTTT-30 ) designed to target the nucleotides 391–419 (accession number: EU375803) present in all
MCPyV-TA mRNAs. In some experiments the same TA shRNA was expressed from the lentiviral tetracycline- inducible expression vector TA.shRNA.tet.23 For generation of MCC cell lines stably expressing ectopic shRNA-insensitive MCPyV-TA, LT or SV40-TA, the respective genes or cDNAs were cloned into the retroviral vector pIH containing a hygromycin resistance gene.23 TA expression constructs contain a T antigen gene coding for sT and LT while LT expression constructs contain only an LTcDNA. The ectopically expressed MCPyV mRNAs were made insensitive to the TA-shRNA by introduction of six silent mutations in the TA-shRNA target sequence using the quick change mutagenesis kit (Stratagene).23 All the point mutants, deletion variants and chimeric hybrids described in the results section (see also Fig. 1) were derived from these pIH constructs by in vitro mutagenesis and other PCR techniques. In some experiments LT or TA cloned into the lentiviral vector pCDH (System Biosciences) were used. Properness of the intended constructs was confirmed by sequencing the complete coding sequence. Retro- and lentivirus-containing supernatants were generated by transient transfection of HEK293T and infection of target cells was carried out as previously described.23 GFP assay
GFP expression of pGreenPuro-infected cells was used to compare the growth behavior of infected and uninfected cells: infected cells were mixed with 20% of uninfected cells. Changes in the frequency of GFP-positive cells in this mixture were determined by flow cytometry over time. Immunoblotting
Immunoblotting was performed as previously described23 with total cell lysates harvested on day 5 following shRNA infection. The antibodies used in this study were directed against MCPyV-LT (CM2B4; Santa Cruz Biotechnologies), the V5 tag (SV5-Pk1; Abcam) or b-tubulin (TUB 2.1; Sigma–Aldrich). Real time PCR
Total RNA was isolated with Qiagen RNAeasy columns and reverse transcribed using the Superscript II RT First Strand Kit (Invitrogen). Real time PCR was conducted in the ABI 7500 Fast Real-Time PCR cycler (Applied Biosystems) using a SybrGreen I Low Rox Mastermix (Eurogentec GmbH). The following primers were applied: C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V
Figure 1. Schematic illustration of different Large T proteins analyzed in this study. The two MCPyV unique regions (MUR-1 and MUR-2) flanking the retinoblastoma protein (RB) binding motif (LxCxE), and distinguishing MCPyV-LT from all other LT proteins exemplified by Simian virus 40 (SV40) are marked by green boxes. Further domains and elements are marked by red boxes: The J-domain is found in many HSP70-interacting proteins. The Psycho motif (including an YGT sequence) is conserved in many RB-binding proteins and is considered to modulate the interaction with RB. The LxCxE motif is essential for RB binding. Two nuclear localization sequences (NLS) are marked, one present in SV40 and other LT proteins but not well conserved in MCPyV and a second (RKRK) unique for MCPyV-LT. MKL-1, WaGa, LoKe and AlDo are four cell lines which naturally express the respective MCPyV-LTs. Several further modifications (deletion 102–207, stop codon 232 or addition of a nuclear export signal (NES)) were introduced artificially. Numbers indicate the amino acid positions. The MCPyV-LT mRNA contains a coding sequence for a further protein named ALTO (alternative frame in the Large T open reading frame). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
MYB: TCCACACTGCCCAAGTCTCT; AGCAAGCTGTT GTCTTCTTTGA; CDC6: CCTGTTCTCCTCGTGTAAAAG; GTGTTGCA TAGGTTGTCATCG; CCNB1: CGCCTGAGCCTATTT TGGT; GCACATCC AGATGTTTCCATT; PLK1: AAGATCTGGAGGTGAAAATAGGG; AGGAG TCCCACACAGGGTCT; GAPDH: GCCCAATACGACCAAATCC; AGCCACAT CGCTCAGACAC; SV40-LT: CTGGGATGCAACTGAGATTC; CATTAA AGGCATTCCACCACTG; Ectopically expressed MCPyV-LT with modified shRNA target site23: GCAAAATATTCATAAACTCAGGAGC; GGGGCCTCG TCAACCTC; Relative expression levels were determined applying the comparative DD2CT method and given as percent relative to the vector control.
thrombin clots were fixed with formalin and embedded in paraffin before immunocytochemistry was carried out on 5 mm sections as previously described.23 For immunofluorescence, either cytospins of MCC cells or NIH3T3 cells cultured on chamber slides were fixed with 4% paraformaldehyde in PBS. Permeabilization, washes, actin staining with Alexa Fluor rhodamin phalloidin, staining with the primary antibody (CM2B4) and staining of the nucleus with DAPI was performed as described.28 A FITC-tagged secondary anti-mouse IgG antibody was applied to visualize the CM2B4 antibody bound to MCPyV-LT. Transformation assay
After flow cytometry confirmed successful infection of 2 3 105 NIH3T3 cells with lentiviral TA or LT expression constructs, cells were plated in T75 flasks. On day 25 after infection, focus formation was monitored by crystal violet staining. Statistics
Immunocytochemistry and immunofluorescence
The CM2B4 antibody (Santa Cruz Biotechnologies) was used as primary antibody to detect MCPyV-LT by immunocytochemistry and immunofluorescence. Cells immobilized in C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V
Statistical analysis was performed with GraphPad Prism 5.03 software, STATA 11 and SPSS. We first calculated the area under the curve (AUC) for each curve derived by the GFP assay. Next, we confirmed the equality of variances between
Infectious Causes of Cancer
3
Houben et al.
Infectious Causes of Cancer
4
MCPyV large T antigen
Figure 2. The RKRK motif is not required for nuclear localization and the growth- promoting activity of MCPyV-LT. MKL-1 cells naturally express an MCPyV-LT consisting of 330 amino acids including the proposed nuclear localization sequence RKRK (see Fig. 1). (a and b) MKL1 cells were stably transduced with empty vector, or with expression constructs coding for the MCPyV-TAs (sT and LT) with the indicated LT proteins characterized by different truncations and deletions (see Fig. 1). Six nucleotide exchanges in the shRNA target sequence rendered the ectopic TA-mRNAs insensitive to the TA-shRNA. Subsequently, the cells carrying these constructs were infected with the lentiviral TAshRNA expression construct coding also for GFP. (a) Expression of endogenous and ectopically expressed LT (antibody: CM2B4) was measured by immunoblot in cell lysates harvested 5 days after shRNA infection. Note that due to the deletion in LTAlDo eliminating the epitope targeted by CM2B4 it cannot be detected. Tubulin served as loading control. (b) The ratios of a mixed population of green fluorescent shRNA-infected cells with uninfected, non-fluorescent cells were determined over time. Relative ratios based in each case on the measurement of the first time point were calculated and mean values (6 SD) of at least three independent experiments are depicted. Black and red star indicate a statistically significant difference (p < 0.05) relative to vector and TAWaGa, respectively. (c) Endogenous MCPyV-LT was visualized in the indicated cell lines by applying the CM2B4 antibody in immunocytochemistry on sections of formalin fixed and paraffin embedded cells or by immunofluorescence on cytospins. (green: MCPyV-LT, red: actin [phalloidin]; blue: DAPI). LT of MKL-1 contains the RKRK motif while this motif is partially or completely deleted in WaGa and LoKe, respectively (Fig. 1). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
the groups by the Levene’s robust test statistic. The AUC of each group was then compared by one-way-ANOVA followed by Gabriel post hoc testing where each curve was compared once to vector control and once to TAWaGa. A p value
