JOURNAL OF BACTERIOLOGY,

Vol. 174, No. 14

July 1992, p. 4538-4548

0021-9193/92/144538-11$02.00/0

Characterization of Escherichia coli glnL Mutations Affecting Nitrogen Regulation MARIETl'E R. ATKINSON AND ALEXANDER J. NINFA* Department of Biochemistry, Wayne State University School of Medicine, Detroit, Michigan 48201 Received 4 November 1991/Accepted 5 May 1992

Nitrogen regulator II (NRII), the product of the Escherichia coli gInL (ntrB) gene, regulates the activation of transcription of ginA and the Ntr regulon by catalyzing the phosphorylation and dephosphorylation of the transcription factor NRI. Previous results have indicated that under conditions of nitrogen excess, transcriptional activation is prevented by an NRI-phosphate phosphatase activity that is observed when NRI, and another signal transduction protein known as PI, (the gInB product) interact. The availability of PI, for this interaction is controlled by a uridylyltransferase/uridylyl-removing enzyme, encoded by glnD, that reversibly modifies PI, in response to intracellular signals of nitrogen availability. Here we describe the isolation and characterization of missense mutations in glnL that suppress the Ntr- phenotype resulting from a leaky ginD mutation. The regulation of ginA expression in the pseudorevertants was found to vary from complete insensitivity to ammonia in some strains (GlnC phenotype) to nearly normal regulation by ammonia in other strains. Sequence analysis indicated that in 16 instances suppression was due to point mutations at 14 different sites; 10 different mutations resulting in a variety of phenotypes were identified in a cluster extending from codons 111 to 154 flanking the site of NRI, autophosphorylation at His-139. Complementation experiments with multicopy plasmids encoding NRII or P. showed that suppression by GlnC ginL alleles was eliminated upon introduction of the plasmid encoding NR11 but was not affected by introduction of the plasmid encoding PI,. Conversely, suppression by certain glnL alleles that resulted in regulated expression of gln4 was eliminated upon introduction of either the plasmid encoding NRI, or that encoding P,,. We hypothesize that mutants of the latter type result in a subtle perturbation of the NRII-PI, interaction and suggest two possible mechanisms for their effects.

and the product of the glnB gene, known as PI1 (6, 17, 28). The activity of PII is in turn regulated by its reversible uridylylation catalyzed by the product of ginD, a uridylyltransferase/uridylyl-removing enzyme (UT/UR) (1, 5, 9, 12, 13). Under conditions of nitrogen excess, PI, is kept in the unmodified form, and upon nitrogen starvation PI, is converted to the uridylylated form by the UT/UR. The most important small molecules sensed by the UT/UR seem to be glutamine, which stimulates the UR activity, and 2-ketoglutarate, which stimulates the UT activity (9, 12, 13). Thus, the UT/UR enzyme serves to continuously monitor the intracellular ratio of glutamine to 2-ketoglutarate, a measure of nitrogen status, and communicates this information to PI,. PI, is a central element of nitrogen regulation in bacteria: it interacts with the kinase-phosphatase NRI to elicit the phosphatase activity and thus control transcription of nitrogen-regulated genes, and it also interacts with an adenylyltransferase enzyme (ATase) to control the adenylylation and activity of the GS enzyme (5; reviewed in references 36, 40, and 41). When nitrogen is limiting, PI-UMP stimulates the deadenylylation (activation) of adenylylated (inactive) GS by the ATase, and when nitrogen is in excess PII stimulates the adenylylation of GS by the ATase. The UT/UR and PI, are therefore part of two bicyclic cascades: one, consisting of the UT/UR, PI,, ATase, and GS, is responsible for the control of GS activity; the other, consisting of the UT/UR, PII, NRII, and NRI, is responsible for the control of glnA and Ntr transcription. In both cases the unmodified form of PI, brings about the response that is appropriate for a condition of nitrogen excess, namely, the inactivation of GS and the inactivation of the transcriptional activator NRI-phosphate. It has been known for some time that glnD mutations decreasing the UT/UR activity prevent the efficient modification of PI, under conditions of nitrogen limitation and

A signal transduction pathway consisting of at least four gene products is responsible for the regulation of g1nA, encoding glutamine synthetase (GS), and the Ntr regulon in Escherichia coli and similar bacteria (Fig. 1) (reviewed in references 21, 22, and 41). The activation of transcription of glnA and the Ntr regulon in response to nitrogen starvation requires the phosphorylated form of the ginG (ntrC) gene product, nitrogen regulator I (NRI), and this phosphorylation is in turn catalyzed by the protein kinase activity of the ginL (ntrB) gene product, NRI, (17, 28, 44). NRI-phosphate stimulates the initiation of transcription from specialized promoters by RNA polymerase containing the alternative sigma factor r54 (15, 16, 28). The sensitivity of any given Ntr promoter to activation by NR,-phosphate is determined at least in part by the number, sequence, and position of NRI-P-binding sites, which are functionally analogous to enhancer sequences (27, 30, 33, 35). The glnAp2 promoter, endowed with two high-affinity NR1-binding sites ideally positioned 110 and 140 bp upstream from the site of transcript initiation, is exquisitely sensitive to activation by NR,-P, while other Ntr promoters, containing only a single NRI-P-binding site or multiple sites whose position is less than ideal, are less sensitive to activation by NRI-P (8, 14, 34, 45; reviewed in references 18 and 41). These differences in promoter architecture probably contribute to the temporal staging of the cellular response to a shift from nitrogen excess to nitrogen-limiting conditions (discussed in reference 41). Under conditions of nitrogen excess, the transcriptional activation of glnA and the Ntr regulon is prevented by a phosphatase activity that results from the interaction of NR11 *

Corresponding author. 4538

VOL. 174, 1992

.~ ~

E. COLI glnL MUTANTS SUPPRESSING glnD::TnlO

4539

, Transcriptional Activation

I Pll

+

NRI-P

IS

NRII

NRI

K>

gin

Pil

weu

UTP

m

ATP

UTase) C2KG GS-AMP ATase

UR

GS-

ppi

20

P1

PII-UIMP

ADP

I NRII

NRII-P ATP

1\1

ADPJ p;

1 Glutamate + NH+

ATP

glutamine ADP

FIG. 1. Signal transduction system that regulates GS activity and the transcription of glnA and the Ntr regulon in E. coli. Abbreviations are as follows: ATase, ginE product; GS, glnA product; PII, signal transduction protein PI, (glnB product); NRII, nitrogen regulator II bifunctional kinase-phosphatase (glnL or ntrB product); NRI, nitrogen regulator I transcription factor (glnG or ntrC product). The figure is modeled after a portion of Fig. 8 of reference 41.

consequently prevent the expression of the Ntr regulon (3, 4, 6, 10, 11, 19, 20). Suppressor mutations that restore expression of the Ntr regulon have been found in ginL, ginB, and ginG (6, 11, 19, 20, 33, 43). Previous results have suggested that the suppressor mutations in glnL and ginB affect the NRII-PI phosphatase activity, whereas the suppressor mutations in glnG result in altered NRI proteins that are able to activate glnA and Ntr expression in the absence of phosphorylation or that activate transcription much more efficiently than does wild-type NR,-phosphate after infrequent phosphorylation by other cross-talking cellular kinases (29). In this work we isolated and characterized missense mutations in ginL that can suppress the Ntr- phenotype resulting from a leaky ginD mutation. We found that the regulation of GS in the pseudorevertants ranged from complete insensitivity to ammonia (GlnC phenotype [21]) in certain strains to nearly normal regulation by ammonia in other strains. Suppression of the glnD mutation by certain GlnC glnL alleles was eliminated upon the introduction of a multicopy plasmid encoding NRI but was not eliminated upon introduction of a multicopy plasmid encoding PI,. In contrast, suppression of the glnD mutation by certain glnL alleles resulting in the regulated expression of GS was eliminated upon introduction of either the plasmid encoding NRI, or the plasmid encoding PII. MATERIALS AND METHODS Bacteriological techniques. Bacterial strains and plasmids used in this work are listed in Table 1. Defined W-salts-based media and rich media were as described previously (32). Transformation of CaCl2-treated cells with plasmid DNA and transduction using Plvir were as described previously (23, 38). GS assays. The harvesting of hexadecyltrimethylammonium bromide-treated cells and the gamma-glutamyl transferase assay procedure were as described previously (31). This assay measures the reverse GS reaction; in all cases we

performed the assay in the presence of Mn2", in which case adenylylated GS and nonadenylylated GS are equally active. The assay is thus indicative of the total amount of GS in the cells but not of the state of adenylylation of the enzyme. The method that we used for growing the cultures was a slight modification of that used previously (6). Cells were grown overnight in the indicated medium and subcultured into 20 ml of prewarmed fresh medium to an optical density at 600 nm of 0.02. Cultures were then grown at 30°C to an optical density at 600 nm of 1.00 and harvested. When cells were grown in this manner, the assay results were reproducible + 10%. We thus restrict our interpretation of the data to large differences in the levels of GS. In many of the experiments reported here, we included two strains with identical genotypes (WS5012 and WS5056), and comparison of the results with these strains will inform the reader as to the consistency of the results. In all experiments, the wild type and relevant controls were grown at the same time under identical conditions, and the level of GS is expressed as the fraction of the activity of the induced wild-type culture from the same experiment. The GS microassay was performed as described previously (20). Cloning of glnB and glnL. The glnB and ginL genes of E. coli and various mutant ginL alleles were cloned into vector pBR322 after amplification by the polymerase chain reaction (PCR) (37). The primers used for the amplification of glnL were (upstream) 5' GGCTGCAGGAAGCTTGGTAGGCC GGAGCAGGTGAGTCGC 3' and (downstream) 5' GG

GAATTCGAGCTCTGCGAGCGCACGTTCAAGCACCCA ACGG 3'. These primers anneal to nucleotides 167 to 144 upstream from the glnL gene (which is also upstream from the glnL promoter [42]) and nucleotides 56 to 82 downstream from the glnL coding sequence. Each primer contains a 15-nucleotide 5' extension containing the recognition sequence for restriction endonucleases: PstI and HindIII in the upstream primer and EcoRI and SacI in the downstream primer. For cloning of ginL alleles, PCR amplification products, obtained as described elsewhere (37), were phenol

4540

J. BACTERIOL.

ATKINSON AND NINFA TABLE 1. E. coli strains and plasmids

Strain or plasmid

Strains YMC1O RB9040 RB9132 YMC15 TH16 RB9060 YMC21 DD13 ALGD BA BA10 BA15

WS1002 WS1004 WS1007 wS1o11 WS1012 WS1015 WS1016 WS4021 WS4035 WS4042 WS5003 WS5012 WS5015 WS5038 WS5044 WS5056 WS5087

WS1O11B WS5003B WS5012B WS5015B WS5038B WS5044B WS5056B WS5087B WS2110L WS2115L

Relevant genotype Relevant Wild type glnD99::TnlO glnL2001 (internal deletion) glnL2302 glnA::Tn5 AglnB AglnALG glnD99::TnlO glnL2001 AgInALG glnD99::TnlO AglnB glnA::TnS AglnB AglnB glnL2302 glnD99::TnlO glnL1002 glnD99::TnlO glnL1004 glnD99::TnlO glnL1007 glnD99::TnlO glnLlOl1 glnD99::TnlO glnL1O12 glnD99::TnlO glnLIOl5 glnD99::TnlO glnL1004 glnD99::TnlO glnL4021 glnD99::TnlO glnL4035 glnD99::TnlO glnL4042 glnD99::TnlO glnL5003 glnD99::TnlO glnLS012

glnD99::TnJO glnLSOl5 glnD99::TnlO glnLS038 glnD99::TnlO glnLS044 glnD99::TnlO glnLS012 glnD99::TnlO glnLS087 AglnB glnLlOll AglnB glnL5003 AglnB glnL5012 AglnB glnLSOIS AglnB glnL5038 AglnB glnLS044 AglnB glnLS012 AglnB glnLS087 Wild type glnL2302

WS1O11L glnLlOll WS5003L WS5012L WS5015L WS5038L WS5044L WS5056L WS5087L

glnLS003 glnLS012 glnLSOIS glnLS038 glnLS044 glnLS012 glnLS087

Plasmids pBR322 pgln62

Ampr Tetr Ampr glnL+

p3Y10

Ampr glnL+

pglnB+

Amppr glnB

Construction, reference, description

or

6 6 6 7 35 6 16 RB9132 x RB9040 Plvir YMC21 x RB9040 Plvir RB9060 x TH16 Plvir BA x YMC10 Plvir BA x YMC15 Plvir RB9040--Garg+ RB9040--Garg+

RB9040-*Garg+ RB9040-*Garg+ RB9040--Garg+ RB9040--Garg+ RB9040--Garg+ RB9040- Garg+ RB9040- Garg+

RB9040-+Garg+ RB9040--Garg+

RB9040-*Garg+

RB9040--Garg+ RB9040-*Garg+ RB9040--Garg+ RB9040-*Garg+ RB9040--Garg+ BA x WS1011 Plvir BA x WS5003 Plvir BA x WS5012 Plvir BA x WS5015 Plvir BA x WS5038 Plvir BA x WS5044 Plvir BA x WS5056 Plvir BA x WS5087 Plvir YMC21 x YMC10 Plvir YMC21 x YMC15 Plvir YMC21 x WS1011 Plvir YMC21 x WS5003 Plvir YMC21 x WS5012 Plvir YMC21 x WS5015 Plvir YMC21 x WS5038 Plvir YMC21 x WS5044 Plvir YMC21 x WS5056 Plvir YMC21 x WS5087 Plvir

Cloning vector Portion of glnALG operon subcloned into pBR322 (43) glnL and natural promoter cloned into pBR322 glnB cloned into pBR322

extracted, ethanol precipitated, digested with HindIII and EcoRI, and purified on low-melting-point agarose gels. The purified fragments were then ligated into HindIll- and EcoRI-cleaved pBR322. For the cloning ofglnB, the primers were based on the sequence of Son and Rhee (39). The upstream primer was 5' GGCTGCAGGAAGCTTGGCG

GGGCGCAACCGGACAGA 3', and the downstream primer was 5' GGGAATTCGAGCTCTGCCGCGTCGTCCTCTT CACGG 3'. As in the case with the glnL primers, these primers contain 15-nucleotide extentions with recognition sequences for PstI and HindlIl (upstream) and EcoRI and SacI (downstream). The PCR products were cloned into pBR322 by using HindIII and EcoRI as described above. The upstream glnB PCR primer anneals to genomic DNA 136 to 116 nucleotides upstream from the glnB coding sequence. The downstream primer was designed to anneal to a 21-nucleotide stretch beginning with the penultimate codon (codon 103, CCG for proline) and including the TGA stop codon. We subsequently learned that because of a frameshift error in the published sequence, our amplification primer results in a mutagenesis of glnB (18a). Specifically, there is a replacement of the final 8 amino acids of PII (GGEDDAAI) with 11 different amino acids (VKRTTRQSSNS). Thus, the plasmid that we call pglnB+ in this work is not exactly the wild type. We have observed, however, that it in fact does encode a functional PII, and it has been quite useful in identifying glnB mutations in complementation experiments (2). DNA sequencing. Wild-type and mutant glnL alleles were sequenced directly from chromosomal DNA after asymmetric PCR amplification of each of the two single strands, as described previously (24), with the following modifications. Mineral oil overlays were omitted, as they were found to be unnecessary. The PCR products were phenol-chloroform extracted and ethanol precipitated, and the single-stranded products were purified on 1% low-melting-point agarose gels. Small slices of the gels containing the single-stranded DNA were excised and stored at 4°C. Sequencing reactions were performed directly on aliquots of the molten gel slices by using the Sequenase kit (U.S. Biochemicals) and following the recommendations of the manufacturer. A set of 13 internal primers (17-, 20-, or 21-mers) spaced approximately 200 bp apart on each strand were used to prime the reactions. We found that this method was reliable in that identical results were always obtained from independent amplifications and the two complementary DNA strands in any region displayed perfect complementarity. There were two exceptions to this latter statement: in two small portions of the sequence compressions rendered the sequence unreadable on one of the two strands; this was found in all of the samples including the wild-type allele. For all of the mutant alleles reported in this work, a clear single-stranded sequence of the entire gene was obtained, and the mutations were confirmed on both strands. RESULTS Isolation of spontaneous Ntr+ suppressors of the glnD99::TnlO mutation. TheglnD99::TnlO mutation is one of the original defining mutations for glnD in E. coli (4), caused by the insertion of TnlO. Although this mutation reduces uridylylation of PII and results in the Ntr- phenotype (inability to utilize arginine as the sole nitrogen source), PII purified from a strain containing glnD99::TnlO under conditions of nitrogen starvation was partially (8%) uridylylated (39), directly indicating that some of the UT activity is present. Furthermore, while strains containing this mutation are unable to activate the expression of Ntr genes and consequently grow very poorly on poor nitrogen sources, such as amino acids, they are able to partially activate glnA in response to nitrogen limitation (6). There are two possible explanations for these properties of the glnD99::TnlO strain:

VOL. 174, 1992

E. COLI glnL MUTANTS SUPPRESSING glnD::TnlO

either the glnD function is redundant or the TnlO insertion in glnD99::TnlO does not entirely inactivate the UT activity. We have observed that spontaneous pseudorevertants of the Ntr- phenotype are easily obtained from the glnD99::TnlO strain and that many of these are linked to the TnlO insertion (2). Some of these glnD-linked Ntr+ suppressors of the glnD99::TnlO mutation were observed to be approximately 90% linked to the TnlO element; that is, in backcrosses into the wild type the suppressor and TnlO were separated in 10% of the transductants. While these observations do not eliminate alternative explanations, the 90% linkage of the glnDlinked suppressors to the glnD99::TnlO mutation suggests that these suppressors may be in a separate gene. In any case, the leakiness of the glnD99: :TnlO mutation was used to our advantage; we isolated Ntr+ suppressors of this mutation in order to obtain mutations causing subtle perturbations in the NRII-PI interaction. Spontaneous Ntr+ pseudorevertants of the glnD99::TnlO mutant RB9040 (6) were selected on the basis of growth on defined solid medium containing glucose as the carbon source and arginine as the sole nitrogen source. The RB9040 strain grew very poorly on this medium, and after a 1-week incubation at 37°C a very faint lawn of bacteria was observed. Strains containing spontaneous suppressor mutations formed clearly observable colonies growing much better than the parental strain. Such colonies continued to appear upon continued incubation, suggesting that they resulted from mutations occurring during the slow growth of the parental RB9040 strain on this medium. The Ntr+ pseudorevertants so obtained were repurified to single colonies twice on glucose-arginine medium prior to storage. Approximately 1,000 independent Ntr+ pseudorevertants were obtained in five different experiments. Initial characterization of the regulation of GS by the microassay technique. It is possible to determine in a qualitative sense the level of expression of GS in a small aliquot of cells scraped directly from solid medium by a previously developed microassay technique (20). In order to discern the general pattern of regulation of GS in control strains and our Ntr+ pseudorevertants of the glnD::TnlO mutation, we examined the level of GS using the microassay and cells grown on three media: nitrogen-limiting glucose-glutamine medium, nitrogen excess glucose-ammonia-glutamine medium, and the very nitrogen-rich complex Luria-Bertani (LB)-glutamine medium (Fig. 2). We observed that as expected, GS was regulated in the wild-type strain and defective in the appropriate fashion in control strains. Strain YMC15 (glnL2302, encoding an altered NR,, that previous results suggest is insensitive to PII [28]) displayed elevated GS expression on glucose-ammonia-glutamine medium and slightly elevated GS expression on LB-glutamine medium (GlnC phenotype), as described previously (7). (As noted previously, apparently another negative regulatory element, in addition to P,,, is responsible for the low level of GS expression on the LB-glutamine medium [6]). We also observed that strain RB9132, containing an internal nonpolar deletion mutation in glnL inactivating NRI, (6), had a characteristic phenotype in the microassay. This strain had elevated GS expression on glucose-ammonia-glutamine medium and a very low level of expression of GS on LBglutamine medium. A double mutant containing this glnL allele and in addition containing the glnD99::TnlO mutation, DD13, displayed the same phenotype, as expected, since the UT/UR acts through NR11. (This strain should be identical to strain RB9133 of reference 6.) Finally, strain RB9040 containing only the glnD99::TnlO mutation displayed a slightly

lower level of GS on glucose-glutamine medium than did the wild type and very low levels of GS on the nitrogen-rich medium. We observed that our spontaneous glnD99::TnlO pseudorevertants displayed various degrees of regulation of GS (Fig. 2). Some of the strains displayed the GlnC phenotype or were even more constitutive, having greatly elevated GS expression on the LB-glutamine medium. Other pseudorevertants displayed a phenotype similar to that of strain RB9132 containing the glnL internal deletion. Finally, many pseudorevertants displayed various degrees of regulation of GS, ranging from quite poor regulation to nearly normal regulation of GS. Strains showing the constitutive or regulated phenotypes were chosen for further study. Thus, at this point in our work there was a human selection for the extreme examples from what may in reality be a continuous variation with regard to the ability of individual pseudorevertants to regulate GS synthesis. Expression of GS in strains containing the Ntr+ glnD99::TnlO-suppressing mutations. The levels of GS were measured in control and mutant strains grown in liquid cultures under nitrogen-limiting and nitrogen excess conditions. We observed that the patterns of regulation discerned in the microassay were observed in the quantitative GS assay, as shown in Table 2 for representative strains later shown to contain glnL mutations (see below). The quantitative GS assay indicated that those pseudorevertant strains identified as having the regulated phenotype in the microassay were indeed able to regulate the expression of GS, but in none of these strains was this regulation as effective as that found in the wild type (Table 2). Identification of glnD99::TnlO-suppressing mutations mapping in glnL. For the purposes of this study, we chose to focus on glnD::TnlO suppressors mapping in glnL. Since, as discussed above, we have observed that suppressing mutations 90 to 100% linked to the glnD99::TnlO mutation are obtained (2), we screened our collection for linkage of the suppressing mutations to glnD::TnlO. We observed that approximately 50% of the pseudorevertant strains displaying the regulated phenotype and all of the pseudorevertants with constitutive phenotypes contained mutations not linked to ginD (not shown). We mapped glnD suppressors to glnL in two ways. First, we grew generalized transducing phage Plvir on each pseudorevertant and used these phage lysates to transduce the glnALG region into strain ALGD, which is deleted for glnALG and contains in addition the glnD99::TnlO mutation. Transductants were selected for glutamine prototrophy (the glnD::TnlO mutation does not result in tight glutamine auxotrophy), and the Ntr character was examined by testing the ability of the transductants to grow on glucose-arginine medium. We observed that prototrophic transductants were obtained with phage grown on the wild-type strain but that these transductants formed small colonies and grew poorly on glucose-ammonia medium when repurified. These transductants obtained with phage grown on the wild type were Ntr- (unable to grow on glucose-arginine), as expected, since this cross essentially reconstructs the glnD99::TnJO strain. In contrast, the transductants obtained by using phage grown on the pseudorevertants shown in Table 2 formed large colonies and grew well when repurified on glucose-ammonia medium. In addition, these transductants were able to grow on glucose-arginine medium (Ntr+). This result indicates that suppression of the glnD99::TnlO mutation in these pseudorevertants was due to mutations linked toglnALG. This test does not distinguish between mutations

4541

4542

~

J. BACTERIOL.

ATKINSON AND NINFA

( )-

U,

00

4

c

C4C4

CUJ

e o ° E 04

Cl a, S

CUJ

CUl

0 000

D

00

CUlgO

CUl

CU

co

co co coEc) CO

t

E E0 80E: E E E

9

0

E rr

C00-0 mu....i00

0

0

0s7

0;

V~~ 0

0

0;

e

0

0

eA

.5 0~~~~~~~~~~~~~~~~~~~~~~~~~0 0

0

Er E E E EE_ E_EE

C

t-

CsC °~~~~' X

X

CXS

0

Xb CU

Q ct 2 X D~~rA

t

tV

CU CU CU X CU

CU

C CU

-0

CA

t

XC E E 3X~~~~~~~~U4,

U0 u, l 8-

815

-E

cnDcn0 cn =J

E E E

=J

o

O

cn

4) C-4) CM

0)

-

0

4)

E

E

en

0)_ J °L

E

E

c

CO Cl (1) (1)

°

0)

___

-

*,_

U,

E E 2 (1) Cl) C O ,, j.oE E

CZ

o)

VOL. 174, 1992

E. COLI glnL MUTANTS SUPPRESSING glnD::TnlO

4543

TABLE 2. GS expression in pseudorevertants of glnD99::TnlO GS activity' on: Strain

YMC1O RB9040 RB9060 Pseudorevertants of RB9040 WS1002 WS1004 WS1007 WS1012 WS1015 WS1016 WS4021 WS4035 WS4042

WS5044 WS1o11

WS5003 WS5012 WS5015 WS5038 WS5056 WS5087 '

Genotype

Glucoseglutamine

Glucose-ammoniaglutamine

LB-glutamine

Wild type glnD99::TnlO glnB

1.00 0.34 0.96

0.09 0.04 0.43

0.05 0.04 0.22

glnD99::TnlO glnL1002 glnD99::TnlO glnL1004 glnD99::TnlO glnL1007 glnD99::TnlO glnL1012 glnD99::TnlO glnL1015 glnD99::TnlO glnL1004 glnD99::TnlO glnL4021 glnD99::TnlO glnL4035 glnD99::TnlO glnL4042 glnD99::TnlO glnL5044 glnD99::TnlO glnLlOl glnD99::TnlO glnL5003 glnD99::TnlO glnL5012 glnD99::TnlO glnLS015 glnD99::TnlO glnL5038 glnD99::TnlO glnLS012 glnD99::TnlO glnL5087

0.65 0.73 0.96 0.75 1.02 0.67 1.28 3.85 0.94 1.06 0.72 0.83 0.87 0.77 1.09 0.95 1.01

0.86 0.61 1.02 0.70 0.69 0.66 1.11 3.61 0.53 0.57 0.26 0.28 0.25 0.19 0.30 0.28 0.26

0.58 0.28 0.43 0.27 0.33 0.35 0.59 0.67 0.23 0.30 0.08 0.12 0.10 0.09 0.24 0.12 0.16

By the transferase assay; expressed as fraction of the activity found in the wild-type glucose-glutamine culture.

in glnL and mutations in ginG, nor does it ensure that the phenotypes of the pseudorevertants are not due to multiple mutations linked to glnALG. To further define the site of the glnALG-linked mutations suppressing glnD99::TnlO, we used the PCR technique to amplify the glnL gene from control and test strains and cloned the glnL alleles into pBR322. The recombinant glnL plasmids were then introduced into strain DD13, which contains an inactivating internal deletion in glnL as well as glnD99::TnlO. The level of GS in the resulting transformants was then assessed on nitrogen-rich and nitrogen-limiting media by the microassay (not shown); to ensure that these results were not biased by mutagenesis during the PCR amplification, four clones were examined for each glnL allele. These experiments revealed that the multicopy wildtype plasmid p3Y10 resulted in a slight constitutivity (probably owing to a slight overproduction of NRI, resulting in essentially a PI, limitation). In contrast, multicopy plasmids containing glnL alleles from constitutive strains caused a strong constitutivity when introduced into the DD13 double mutant. The analogous plasmids containingglnL alleles from mutant strains with the regulated phenotype were indistinguishable from p3Y10. Since the recombinant plasmids did not contain the glnG gene, which is tightly linked toglnL and thus difficult to distinguish in transductional mapping, this test allowed the facile identification of glnL alleles resulting in constitutivity. This test did not distinguish between wildtype glnL and mutant glnL alleles resulting in the regulated phenotype; however, these were identified by DNA sequencing of the glnL gene, presented below, and by virtue of the results of complementation experiments, presented in the following section. Nucleotide sequence of mutant glnL alleles. The glnL alleles resulting in the GlnC phenotype from 10 independent pseudorevertants and glnL alleles from 7 independent pseudorevertants with the regulated phenotype (where the mutation had been shown to map near glnA and could have been in either glnL or glnG) were subjected to sequencing as de-

scribed in Materials and Methods. In each case, a singlestranded DNA sequence for the entire glnL gene was obtained, and the mutations were confirmed on both strands. We also determined the nucleotide sequence for the previously isolated GlnC glnL2302 allele (7, 28) and as a control confirmed the wild-type glnL sequence. The mutations that we identified are summarized in Table 3, and the positions of the alterations in NRI are illustrated in Fig. 3. The 11 independent mutations resulting in the GlnC phenotype (including glnL2302) included 10 different mutations, with one mutation found twice (Table 3). In 10 of the 11, the mutation was due to alteration of a single nucleotide, resulting in an amino acid substitution. Two of these mutations were well separated from the others, causing alterations at codons 35 and 83 of glnL. The remaining eight point mutations (seven different) were clustered, in codons 115, 120, 122, 129, 133, 138 (occurring twice), and 154 of glnL. Finally, one of the GlnC glnL alleles was found to result from the insertion of IS2 into codon 16 of glnL. This insertion produced a gene fusion in which 9 IS2-encoded amino acids are fused to codons 16 to 349 of glnL. The seven independent mutants with the regulated phenotype were all due to point mutations, resulting in six different alterations. These were located at codons 41, 111, 116, 136 (occurring twice), 149, and 188. It is noteworthy that the mutations at codons 111, 116, 136, and 149 map within the cluster of GlnC mutations discussed above. Complementation analysis using multicopy pglnL+ and pglnB+. In order to gain some insight into the mechanism by which mutations in glnL can restore nitrogen regulation in the glnD99::TnlO background, we examined the effect of the introduction of multicopy pglnB+ and pglnL+ into strains containing glnD99::TnlO and suppressing mutations in glnL. For these experiments we used the previously described pBR322-derived glnL+ plasmid pgln62 (42) and a multicopy pBR322-derived glnB+ clone obtained as described in Materials and Methods. It should be pointed out that the pglnB+ plasmid contains an alteration of the PII amino acid sequence

4544

J. BACTERIOL.

ATKINSON AND NINFA TABLE 3. Summary of sequenced glnL alleles

Strain

glnL allele

Phenotype

Codon

WS4042 WS5038 WS1002 WS5015 WS5044 WS1o11 WS1015 WS1007 YMC15 WS1012 WS5012 WS5056 WS1004 WS1016 WS5087 WS4021 WS5003 WS4035

4042 5038 1002 5015 5044 1011 1015 1007 2302 1012 5012 5012 1004 1004 5087 4021 5003 4035

GlnC Regulated GlnC Regulated GlnC Regulated GlnC GlnC GlnC GlnC Regulated Regulated GlnC GlnC Regulated GlnC

35 41 83 111 115 116 120 122 129 133 136 136 138 138 149 154 188 16

Regulated GlnC

DNA change

changea

GCC--GTC GCC- GAC CTG-*CCG ATG-*AGG CGC--TGC CGC-*CTC GAA--AAA CTA-*CCA GCT--ACT TTA-*ATA GGC-GTC GGC-*GTC GCA--GTA GCA-*GTA CGT-*GGT CTG-*CCG CCG-*CAG IS2 insertionb

AV A-*D LP M R R--C R--L E-*K LP A-+T L--d GV G 3V A-WV A--V R--G LP

P->Q

a In the standard single-letter symbols. b Resulting in the fusion of 9 IS2-encoded amino acids to codons 16 to 349 of glnL.

glnD99::TnlO mutation, is phenotypically Ntr-, and as discussed above, suppressor mutations were obtained after selection for the Ntr+ phenotype. After the introduction of pglnL+ or pglnB+, we scored complementation as the restoration of the Ntr- phenotype characteristic of the unsuppressed RB9040 parental strain. Prior to performing this experiment, we expected that mutations in glnL would be complemented only by glnL+ and that mutations in glnB would be complemented only by glnB+. In fact, we have used this test to identify mutations that are complemented only by pglnB+ in a screen of a small portion of our collection of glnD99::TnlO pseudorevertants (2); presumably these strains contain glnD99::TnlO suppressors inglnB. We observed that, as expected, all of the suppressed strains displaying the GlnC phenotype or more complete constitutivity were complemented by pglnL+ but were not comple-

at the C-terminal end of the protein as described in Materials and Methods but that this alteration does not apparently affect its behavior in complementation experiments (2). The pgln62 plasmid differs from p3Y10 in that it contains about half of the glnA gene and a small portion of ginG. We observed that as described previously (42) and unlike p3Y10, pgln62 results in the restoration of normal nitrogen regulation when introduced into the glnL null strain RB9132 and prevents the expression of GS when crossed into the DD13 double mutant containing the glnL null mutation and glnD99::TnlO (not shown). Neither pgln62 (hereafter referred to as pglnL+) nor pglnB+ had any significant effect on the regulation of GS when introduced into the wild type

(Table 4). The complementation experiment that we performed is somewhat atypical. Strain RB9040, containing the H139

11--

-'K. I/

I

'

'I

. .

35 41 83 16 INS A->V A->D L->P C R C C

111

115

M->R

R->C

R

C

116

I

I

-

188 P->Q

R

120

122

129

133

136

138

149

154

R->L

E->K

L->P

A->T

L->I

G->V

A->V

R->G

L->P

R

C

C

C

C

R

C

R

C

FIG. 3. Distribution of mutations affecting the phosphatase activity of NRII. The 348-amino-acid NR11 monomer is depicted as consisting of a nonconserved N-terminal domain (thin line) and a conserved kinase-phosphatase domain (thick line) homologous to that found in other two-component system kinases. The position of the site of autophosphorylation, His-139, is indicated above the line. Codons that were mutated are indicated, and the amino acid changes are shown in the standard single letter code. INS refers to an insertion of IS2. Mutations resulting in the GlnC phenotype are indicated with a C; those resulting in the regulated phenotype in the glnD99::TnJO background are indicated with an R.

VOL. 174, 1992

E. COLI glnL MUTANTS SUPPRESSING glnD::TnlO

TABLE 4. Expression of GS in pseudorevertants containing pglnL+ or pglnB+ Strain

YMC10 YMC10 YMC10 YMC10 RB9060 RB9060 RB9060 WS1011 WS1011 WS1011 WS5003 WS5003 WS5003 WS5012 WS5012 WS5012 WS5015 WS5015 WS5015 WS5038 WS5038 WS5038 WS5087 WS5087 WS5087 WS1002 WS1002 WS1002 WS4021 WS4021 WS4021 WS4035 WS4035 WS4035

Plasmid

None pBR322 pglnB+ pglnL+ pBR322 pglnB+ pglnL+ pBR322 pglnB+ pglnL+ pBR322

pglnB+ pglnL+ pBR322 pglnB+ pglnL+ pBR322 pglnB+ pglnL+ pBR322

pglnB+ pglnL+ pBR322 pglnB+ pglnL + pBR322 pglnB+ pglnL+ pBR322 pglnB+ pglnL+ pBR322 pglnB+ pglnL+

Glucose-

GS activity' on: Glucose-ammonia-

glutamine

glutamine

LB-glutamine

1.00 0.97 0.89 0.94 0.95 0.44 1.06 0.97 0.46 0.41 0.84 0.25 0.23 0.95 0.26 0.19 0.87 0.23 0.26 0.99 0.41 0.25 1.61 0.50 0.40 0.99 0.98 0.43 1.26 1.28 0.40 2.69 2.28 0.19

0.07 0.07 0.03 0.06 0.59 0.03 1.05 0.28 0.08 0.16 0.17 0.06 0.04 0.18 0.06 0.04 0.12 0.05 0.04 0.35 0.12 0.04 0.23 0.13 0.04 1.23 0.85 0.05 1.08 1.13 0.06 2.20 1.96 0.05

0.05 0.04 0.04 0.07 0.38 0.06 0.37 0.09 0.05 0.06 0.06 0.04 0.04 0.06 0.03 0.05 0.04 0.04 0.06 0.10 0.05 0.06 0.07 0.04 0.01 0.29 0.26 0.06 0.51 0.61 0.10 0.57 0.33 0.07

4545

TABLE 5. Expression of GS in double mutants containing a deletion of glnB and various glnL alleles GS activity' on:

a Expressed as a fraction of the activity found in the wild-type glucoseglutamine culture.

mented by pglnB+ or by the vector pBR322. We examined the level of GS in transformants of the wild type and three representatives of this class of the suppressed strains, and the results conformed to our expectations: complementation by pglnL+ (restoring the Ntr- phenotype) resulted in a diminished level of GS characteristic of the original glnD99::TnlO parent (Table 4). Quite a different result was obtained when the complementation analysis was performed on suppressed strains containing glnL alleles resulting in the regulated phenotype in the presence of glnD99::TnlO. For each of these strains, we observed that complementation occurred when either pglnL+ or pglnB+ was introduced but not when the vector pBR322 was introduced. The regulation of GS in transformants of six representative strains of this class was examined in liquid cultures (Table 4). As shown, the introduction of either multicopy pglnL+ or multicopy pglnB+ into these strains eliminated the suppression of the deleterious effects of the glnD99::TnlO mutation. Signalling in the regulated pseudorevertants still involves Pll. The results of the complementation analysis suggested that the glnL mutations resulting in the restoration of regulation in the glnD::TnlO background might affect the interaction of NR,, with PII and that this effect can be offset by

Strain

YMC1O RB9060 BA10 BA15 WS5003B WS5012B WS5015B WS5038B WS5044B WSSOS6B WS5087B

Genotype

Wild type

AglnB

AglnB AglnB glnL2302 AglnB glnL5003 AglnB glnL5012 AglnB glnL5015 AglnB glnL5038 AglnB glnL5044 AglnB glnL5012 AglnB glnL5087

Glucoseglutamine

Glucoseammoniaglutamine

1.00 0.92 1.00 0.94 0.94 1.04 0.94 0.99

0.09 0.66 0.71 0.79 0.75 0.78 0.64 0.77 0.83 0.85 1.00

1.02 1.10 1.03

LB-glutamine 0.07 0.43 0.49 0.59 0.54 0.61 0.52 0.63 0.35

0.60 0.66

' Expressed as a fraction of the activity found in the wild-type glucoseglutamine culture.

increasing the intracellular concentration of PI1. If this hypothesis is correct, we would expect that the regulation of GS in these strains still depends on a functional glnB gene. Alternatively, if the regulation is due to a signal other than PI,, then we would expect that deletion of the glnB gene would have little or no effect. We tested these alternatives by constructing double mutants containing various glnL alleles and deleted for glnB. The double mutants were constructed in two steps as follows. First, we introduced the previously described glnA::TnS mutation (35) into strain RB9060 (containing a deletion of glnB), with selection for kanamycin resistance. A kanamycin-resistant glutamine auxotroph resulting from this cross, strain BA, was then transduced to glutamine prototrophy with phage grown on either the wild type or various glnL mutants. The regulation of GS was then examined in the transductants. Because glnL is about 95% linked to the selected glnA + gene, we initially examined four transductants from each cross by using the microassay technique and cells grown on solid media. We observed that in each case the regulation of GS in all four transductants was the same and that the GlnC phenotype characteristic of the glnB deletion strain was obtained (not shown). This result indicated that regulation in the pseudorevertants containing the mutantglnL alleles depends on PI,. We examined the regulation of GS in one transductant from each cross by the quantitative GS assay, confirming that the phenotype is similar to that of the original glnB deletion strain (Table 5). We also examined whether the regulation of GS in the regulated pseudorevertants depended on the glnD::TnlO allele and its characteristic (weak) capacity to interconvert PII between its modified and unmodified forms. The mutant glnL alleles we tested were moved into a glnD+ background by transducing the glnALG region from the pseudorevertants into strain YMC21, which is ginD+ and deleted for glnALG, with selection for glutamine prototrophy. The regulation of GS in one transductant from each cross was then examined by the standard GS assay (Table 6). We also examined the result when glnL5044, a GlnC allele, was moved into the glnD+ background. In the glnD+ background, the mutant glnL alleles for the most part resulted in a very slight constitutivity (compare Tables 2 and 5), essentially similar to many of the strains containing GlnC alleles. In strains containing some of the glnL alleles, for example, glnL5O15 and glnL5012, the presence of the glnD+ allele had

4546

ATKINSON AND NINFA

J. BACTERIOL.

TABLE 6. Expression of GS in strains containing various glnL alleles in a wild-type background Strain

Genotype

Glucoseglutamine

WS2110L WS2115L WS1O11L WS5003L WS5012L WS5OSL WS5038L WS5044L WS5056L WS5087L

Wild type glnL2302 glnLlOll glnL5003 glnL5012 glnL5015 glnL5038 glnL5044 glnL5012 glnL5087

1.00 1.20 0.76 0.76 1.20 0.93 0.83 0.73 1.40 1.02

GS activitya on: Glucose-ammoniaglutamine LB-glutamme

0.08 0.59 0.40 0.42 0.30 0.23 0.51 0.50 0.26 0.33

a Expressed as a fraction of the activity found in the glutamine culture.

0.10 0.51 0.18 0.14 0.14 0.13 0.33 0.36 0.18 0.26

wild-type glucose-

little effect on the regulation of GS. A more pronounced effect of the glnD+ allele on the regulation of GS was, however, observed in the strains containing glnL5038 and glnL5003. DISCUSSION We have isolated and characterized missense mutations in glnL that suppress the Ntr- phenotype of the leaky glnD mutation, glnD99: :TnlO. The ability of the suppressed strains to regulate the expression of ginA in response to ammonia ranged from complete insensitivity to ammonia (GlnC phenotype) to nearly normal regulation in response to ammonia. We observed that the glnL missense mutations could be grouped into two classes with regard to their behavior in complementation experiments. The suppression resulting from glnL alleles of the GlnC phenotype (or certain incompletely constitutive alleles) was eliminated upon the introduction of multicopy pglnL+ but was not eliminated upon introduction of multicopy pglnB+. In contrast, the suppression afforded by the glnL alleles resulting regulated glnA expression was eliminated upon introduction of either pglnL+ or pglnB+. It should be noted that we initially screened the regulatory properties of the pseudorevertants and selected for further study pseudorevertants that clearly were able to regulate GS in response to ammonia and other pseudorevertants that clearly were unresponsive to ammonia. Thus, the possibility that the two distinct classes seen in our complementation experiments will merge when additional strains with less distinctive phenotypes are examined remains. It is clear from the phenotype of the strain lacking PI, that PI, is not the only negative regulatory signal affecting GS expression (6). For example, GS expression is quite low on the very nitrogen rich complex LB-glutamine medium, even in the glnB deletion mutant. Furthermore, the strain containing an inactivating internal deletion in ginL (RB9132) is similarly able to reduce the expression of GS on LBglutamine medium. Thus, it seems that there must exist another regulatory mechanism, independent of PI, and NR11, that is responsible for the regulation of GS on LB-glutamine medium. The role of the NRII-PI phosphatase in regulating GS expression is most obvious on defined medium containing ammonia and glutamine. On that medium, loss-of-function mutations in either glnB or glnL result in a significant derepression of GS expression.

Two lines of evidence suggest that our glnD99::TnlO pseudorevertants mapping in glnL, which cause the GlnC phenotype, result in altered NR,,s that either are insensitive to PII or have elevated kinase activity. First, the phenotype of these strains is reminiscent of that seen with the strain deleted for ginB; that is, they have elevated GS on defined medium containing ammonia and glutamine yet respond (to various extents) to the unknown negative signal formed on LB-glutamine medium. Second, the slight overproduction of PII brought about by the introduction of a multicopy pglnB+ plasmid has a negligible effect on the phenotype. In principle, a variety of defects in NR,, could result in the GlnC phenotype. For example, these glnL mutations could result in altered NR11s that are completely unable to bind to PII. Alternatively, the binding to PI, may be unaffected but unproductive in bringing about a conformational change responsible for the conversion of NRI, into a phosphatase. A site in NRI that is essential for the catalysis of the dephosphorylation reaction may be destroyed. Finally, the kinase activity of NR,, may be so greatly elevated in these strains that the normal intracellular level of the phosphatase activity is formed but is unable to quench the phosphorylation of NR1. Our experiments do not distinguish between these possibilities, and it is quite possible that more than one of these subclasses are present in our collection. The second class ofglnD99::TnlO pseudorevertants result in the regulation of GS in the presence of the glnD::TnlO mutation. This regulation, while not as tight as that found in the wild-type strain, is dependent on the presence of glnB+, as shown by the phenotype of the appropriate double mutants, and in two cases was at least partially dependent on the presence of the ginD99::TnlO allele. For example, in a background lacking PI,, the regulation was lost and the GlnC phenotype was observed. In the background containing glnD+, this class of glnL alleles resulted in various (slight) degrees of constitutivity. These findings indicate that in the pseudorevertants containing these glnL alleles and ginD99::TnlO, signalling still involves PII. Most importantly, we demonstrated that the modest overproduction of PII resulting from the introduction of multicopy pglnB+ eliminated the suppression of the glnD99::TnlO mutation by these ginL alleles. Such results strongly suggest that the glnL mutations of this class result in altered NRI, that are altered in their interaction with PII. We can envision two possible mechanisms that are not in conflict with the data. The altered NR11 of this class may simply bind PI, less well than does wild-type NRII. Alternatively, these altered NRIIs might bind PII just as effectively as does wild-type NR11, but PII is less efficient in bringing about a conformational change resulting in the phosphatase activity. In either case, increasing the intracellular concentration of PI, would have the effect of restoring the phosphatase activity. Previous work had indicated that the glnD99::TnlO mutation is leaky, resulting in a diminished UT activity that is unable to completely modify PI, under conditions of nitrogen starvation (39). Either the TnlO insertion does not completely inactivate the glnD-encoded UT or the ginD function may be redundant. In either case, our identification of suppressors in glnL resulting in regulated glnA expression and our demonstration that this regulation involves signalling through PII strongly suggests that the residual UT activity in theglnD99::TnlO strain is nitrogen regulated. This is in agreement with previous observations, repeated in this paper, that glnA expression is partially nitrogen regulated in the ginD99::TnlO strain (6). We expect that a considerable difference in the extent of modification of PII exists in the

VOL. 174, 1992

E. COLI glnL MUTANTS SUPPRESSING glnD::TnlO

glnD99::TnlO strain grown under nitrogen-limiting and nitrogen excess conditions, and it is this difference in the extent

map within the nonconserved N-terminal domain, at the juncture of the two domains near to the active site His-139, and in the conserved kinase-phosphatase domain. Although we have not yet directly demonstrated that the N-terminal domain of NRI regulates the activities of the kinase-phosphatase domain, the small size of NRI and the occurrence of many signal transduction mutations within this domain certainly support this hypothesis.

of modification of PI, that is measured by the altered NRI, proteins and results in the regulation of GS. The glnL mutations restoring regulation have the effect of preventing the effective formation of the PI-NRII phosphatase at the low intracellular concentration of unmodified PI, present under conditions of nitrogen starvation but do not prevent the formation of this phosphatase at the much higher concentrations of unmodified PII that we propose are present under conditions of nitrogen excess. These effects are apparently brought about simply by the acquisition of mutations altering NR,, that diminish slightly the affinity of NRI, for unmodified PII or the effectiveness of PI, in eliciting the phosphatase activity. Experimental tests of this model are straightforward: a true null mutation eliminating all UT activity, such as a deletion of the glnD gene (if it proves to be the sole enzyme responsible for this activity), should not be suppressed by this class of glnL mutations, for in that case there should always be present a high intracellular concentration of unmodified PI,. Furthermore, experiments with purified components should indicate that a higher concentration of PII is required to elicit the phosphatase activity from these altered NRIs than from wild-type NRII. If our model is correct, then the occurrence of the regulated class of mutations serves to illustrate one mechanism by which bicyclic cascades can be mutationally optimized to achieve a desired regulatory function. Previous work has indicated that NRI catalyzes the phosphorylation of NR, via an autophosphorylated NRi,phosphate intermediate, in which NR,, is phosphorylated on a histidine residue (44). We recently demonstrated that the site of autophosphorylation is contained within a small peptide composed of residues encoded by codons 136 to 142 of glnL (26). This peptide contains a single histidine residue (His-139). It is interesting to note that many of the mutations reported here map in the vicinity of His-139. NRI, and NR, are related to a number of other bacterial regulatory proteins that function to control other adaptive responses to environmental stimuli, and this collection of regulatory systems has come to be known as the twocomponent systems (reviewed in references 25 and 41). The proteins related to NRI, each share a conserved domain that roughly corresponds to the C-terminal 60% of NRI, (encoded by codons 130 to 349 of glnL, illustrated by a wide line in Fig. 3), typically found at the C terminus, and additional nonconserved domains. Our cluster of mutations extending from codon 111 to codon 154, containing both regulated and GlnC alleles, span the C-terminal end of the nonconserved domain, the junction of this domain to the conserved kinasephosphatase domain, and the beginning of the conserved kinase-phosphatase domain. Previous work with several of the related two-component system kinases has resulted in the identification of mutations affecting signal transduction, and in a number of cases these mutations were found to map in the nonconserved N-terminal domains of these proteins. The existence of these mutations affecting signal transduction has led to the hypothesis that the nonconserved N-terminal domains in these proteins are responsible for the assimilation of information and the regulation of the activities of the C-terminal kinase-phosphatase domain (reviewed in reference 25). In addition, mutations affecting the kinase or phosphatase activities that map near the highly conserved histidine corresponding to His-139 of NR,, have been observed (reviewed in reference 25). In the case of NR,,, we have now shown that mutations affecting signal transduction

4547

ACKNOWLEDGMENTS

This work was supported by a grant from the National Science Foundation (DMB9004048). We thank Barry Wanner, Lawrence Reitzer, Rowena Matthews, Felix Claverie-Martin, and Boris Magasanik for helpful discussions and for providing bacterial strains. We thank J. Liu and Boris Magasanik for communicating unpublished data, Tom Silhavy and Frank Russo for advice on the sequencing, and Boris Magasanik, Barry Wanner, Rowena Matthews, Liz Ninfa, and Barry Rosen for reading the manuscript. REFERENCES 1. Adler, S. P., D. Purich, and E. R. Stadtman. 1975. Cascade control of Escherichia coli glutamine synthetase. Properties of the P,, regulatory protein and the uridylytransferase-uridylylremoving enzyme. J. Biol. Chem. 250:6264-6272. 2. Atkinson, M. R., and A. J. Ninfa. Unpublished data. 3. Bancroft, S., S. G. Rhee, C. Neumann, and S. Kustu. 1978. Mutations that alter the covalent modification of glutamine synthetase in Salmonella typhimurium. J. Bacteriol. 134:1046-

1055. 4. Bloom, F. R., M. C. Levin, F. Foor, and B. Tyler. 1978. Regulation of glutamine synthetase formation in Escherichia coli: characterization of mutants lacking the uridylyltransferase. J. Bacteriol. 134:569-577. 5. Brown, M. S., A. Segal, and E. R. Stadtman. 1971. Modulation of glutamine synthetase adenylylation and deadenylylation is mediated by metabolic transformation of the P,,-regulatory protein. Proc. Natl. Acad. Sci. USA 68:2949-2953. 6. Bueno, R., G. Pahel, and B. Magasanik. 1985. Role of glnB and glnD gene products in the regulation of the glnALG operon of Escherichia coli. J. Bacteriol. 164:816-822. 7. Chen, Y.-M., K. Backman, and B. Magasanik. 1982. Characterization of a gene, glnL, the product of which is involved in the regulation of nitrogen utilization in Escherichia coli. J. Bacteriol. 150:214-220. 8. Claverie-Martin, F., and B. Magasanik. 1991. Role of integration host factor in the regulation of the glnHp2 promoter of Escherichia coli. Proc. Natl. Acad. Sci. USA 88:1631-1635. 9. Engleman, E. G., and S. H. Francis. 1978. Cascade control of glutamine synthetase. II. Metabolic regulation of the enzymes in the cascade. Arch. Biochem. Biophys. 191:602-612. 10. Foor, F., R. J. Cedergren, S. L. Streicher, S. G. Rhee, and B. Magasanik. 1978. Glutamine synthetase of Klebsiella aerogenes: properties of glnD mutants lacking uridylyltransferase. J. Bacteriol. 134:562-568. 11. Foor, F., Z. Reuveny, and B. Magasanik. 1980. Regulation of the synthesis of glutamine synthetase by the Pll protein in Klebsiella aerogenes. Proc. Natl. Acad. Sci. USA 77:2636-2640. 12. Francis, S. H., and E. G. Engleman. 1978. Cascade control of glutamine synthetase. I. Studies on the uridylyltransferase and uridylyl removing enzyme(s) from E. coli. Arch. Biochem.

Biophys. 191:590-601. 13. Garcia, E., and S. G. Rhee. 1983. Cascade control of Eschenichia coli glutamine synthetase. Purification and properties of Pll uridylyltransferase and uridylyl-removing enzyme. J. Biol. Chem. 258:2246-2253. 14. Goss, T., J. Feng, A. J. Ninfa, and R. Bender. Unpublished data. 15. Hirschman, J., P.-K. Wong, K. Sei, J. Keener, and S. Kustu. 1985. Products of nitrogen regulatory genes ntrA and ntrC of enteric bacteria activate glnA transcription in vitro: evidence that the ntrA product is a sigma factor. Proc. Natl. Acad. Sci.

4548

ATKINSON AND NINFA

USA 82:7525-7529. 16. Hunt, T. P., and B. MagasaniL 1985. Transcription of ginA by purified bacterial components: core RNA polymerase and the products of ginF, glnG, and glnL. Proc. Natl. Acad. Sci. USA 82:8453-8457. 17. Keener, J., and S. Kustu. 1988. Protein kinase and phosphoprotein phosphatase activities of nitrogen regulatory proteins NTRB and NTRC of enteric bacteria: roles of conserved amino terminal domain of NTRC. Proc. Natl. Acad. Sci. USA 85:

4976-4980. 18. Kustu, S., E. Santero, J. Keener, D. Popham, and D. Weiss. 1989. Expression of o14 (ntrA)-dependent genes is probably united by a common mechanism. Microbiol. Rev. 53:367-376. 18a.Liu, J., and B. Magasanik. Personal communication. 19. MacNeil, T., D. MacNeil, and B. Tyler. 1982. Fine-structure deletion map and complementation analysis of the glnA-ginG region in Escherichia-coli. J. Bacteriol. 150:1302-1313. 20. MacNeil, T., G. P. Roberts, D. MacNeil, and B. Tyler. 1982. The products of glnL and glnG are bifunctional regulatory proteins. Mol. Gen. Genet. 188:325-333. 21. Magasanik, B. 1982. Genetic control of nitrogen assimilation in bacteria. Annu. Rev. Genet. 16:135-168. 22. Magasanik, B., and F. C. Neidhardt. 1987. The regulation of carbon and nitrogen utilization, p. 1318-1325. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Eschenchia coli and Salmonella typhimunum: cellular and molecular biology. American Society for Microbiology, Washington, D.C. 23. Maniatis, T., E. F. Fritsch, and J. Sambrook 1982. Molecular cloning: a laboratory manual, p. 250. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 24. McCabe, P. C. 1990. Production of single-stranded DNA by assymmetric PCR, p. 76-83. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols, a guide to methods and applications. Academic Press, San Diego, Calif. 25. Ninfa, A. J. 1991. Protein phosphorylation and the regulation of cellular processes by the homologous two-component regulatory systems of bacteria. Genet. Eng. 13:39-72. 26. Ninfa, A. J., and R. L. Bennett. 1991. Identification of the site of autophosphoxylation of the bacterial protein kinase/phosphatase NRII. J. Biol. Chem. 266:6888-6893. 27. Ninfa, A. J., E. Brodsky, and B. Magasanik. 1989. The role of NRI-phosphate in the activation of transcription from the nitrogen-regulated promoter glnAp2. UCLA Symp. Mol. Cell. Biol. 95:43-52. 28. Ninfa, A. J., and B. Magasanik 1986. Covalent modification of the glnG product, NRI, by the glnL product, NRII, regulates the transcription of the glnALG operon in Eschenchia coli. Proc. Natl. Acad. Sci. USA 83:5909-5913. 29. Ninfa, A. J., E. G. Ninfa, A. Lupas, A. Stock, B. Magasanik, and J. Stock. 1988. Crosstalk between bacterial chemotaxis signal transduction proteins and the regulators of transcription of the Ntr regulon: evidence that nitrogen assimilation and chemotaxis are controlled by a common phosphotransfer mechanism. Proc. Natl. Acad. Sci. USA 85:5492-5496.

J. BAcTERIOL. 30. Ninfa, A. J., L. J. Reitzer, and B. Magasanik. 1987. Initiation of transcription at the bacterialglnAp2 promoter by purified E. coli components is facilitated by enhancers. Cell 50:1039-1046. 31. Pahel, G., D. M. Rothstein, and B. Magasanik. 1982. Complex glnA-glnL-glnG operon of Escherichia coli. J. Bacteriol. 150: 202-213. 32. Pahel, G., A. D. Zelentz, and B. M. Tyler. 1978. gltB gene and regulation of nitrogen metabolism by glutamine synthetase in Escherichia coli. J. Bacteriol. 133:139-148. 33. Popham, D. L., D. Szeto, J. Keener, and S. Kustu. 1989. Function of a bacterial activator protein that binds to transcriptional enhancers. Science 243:629-635. 34. Reitzer, L. J., and B. Magasanilk 1985. Expression of glnA in Escherichia coli is regulated at tandem promoters. Proc. Natl. Acad. Sci. USA 82:1979-1983. 35. Reitzer, L. J., and B. Magasanik. 1986. Transcription of glnA in E. coli is stimulated by activator bound to sites far from the promoter. Cell 45:785-792. 36. Rhee, S. G., S. C. Park, and J. H. Koo. 1985. The role of adenylyltransferase and uridylyltransferase in the regulation of glutamine synthetase in Escherichia coli. Curr. Top. Cell. Regul. 27:221-232. 37. Saiki, R. K. 1990. Amplification of genomic DNA, p. 13-20. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols, a guide to methods and applications. Academic Press, San Diego, Calif. 38. Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions, p. 107-111. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 39. Son, H. S., and S. G. Rhee. 1987. Cascade control of glutamine synthetase. Purification and properties of PII protein and nucleotide sequence of its structural gene. J. Biol. Chem. 262:86908695. 40. Stadtman, E. R., E. Mura, P. B. Chock, and S. G. Rhee. 1980. The interconvertable enzyme cascade that regulates glutamine synthetase activity, p. 41-59. In J. Mora and R. Palacios (ed.), Glutamine: metabolism, enzymology, and regulation. Academic Press, Inc., New York. 41. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53:450-490. 42. Ueno-Nishio, S., S. Mango, L. J. Reitzer, and B. Magasanik. 1984. Identification and regulation of the glnL operator-promoter of the complex glnALG operon of Escherichia coli. J. Bacteriol. 160:379-384. 43. Weglenski, P., A. J. Ninfa, S. Ueno-Nishio, and B. Magasanik. 1989. Mutations in the glnG gene of Eschenichia coli resulting in increased activity of nitrogen regulator I. J. Bacteriol. 171:44794485. 44. Weiss, V., and B. Magasanik. 1988. Phosphorylation of nitrogen regulator I (NRI) of Escherichia coli. Proc. Natl. Acad. Sci. USA 85:8919-8923. 45. Wong, P.-K, D. Popham, J. Keener, and S. Kustu. 1987. In vitro transcription of the nitrogen fixation regulatory operon nifLA of KIebsiella pneumoniae. J. Bacteriol. 169:2876-2880.