JOURNAL OF BACTERIOLOGY, Dec. 1991,

p. 7887-7895

Vol. 173, No. 24

0021-9193/91/247887-09$02.00/0 Copyright © 1991, American Society for Microbiology

Characterization of Cytochromes c550 and c555 from Bradyrhizobium japonicum: Cloning, Mutagenesis, and Sequencing of the c555 Gene (cycC) RAYMOND E. TULLY,l* MICHAEL J. SADOWSKY,2 AND DONALD L. KEISTER1 Soybean and Alfalfa Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, Maryland 20705,1 and Department of Soil Science, University of Minnesota, St. Paul, Minnesota 551082 Received 1 July 1991/Accepted 7 October 1991

The major soluble c-type cytochromes in cultured cells of Bradyrhizobium japonicum USDA 110 comprised CO-reactive c555 (Mr, 15,500) and a non-CO-reactive c55o (Mr, -12,500). Levels of cytochrome per gram of soluble protein in aerobic, anaerobic, and symbiotic cells were 32, 21, and 30 nmol, respectively, for c5-5 and 31, 44, and 65 nmol, respectively, for c550. The midpoint redox potentials (Em 7) of the purified cytochromes were +236 mV for c555 and +277 mV for c550. The CO reactivity of c55. was pH dependent, with maximal reactivity at pH 10 or greater. Rabbit antiserum was produced against purified c555 and used to screen a B. japonicum USDA 110 genomic DNA expression library in Agtll for a downstream portion of the c555 gene (cycC). This sequence was then used to probe a cosmid library for the entire c555 locus. The nucleotide sequence shows an open reading frame of 149 amino acids, with an apparent signal sequence at the N terminus and a heme-binding site near the C terminus. The deduced amino acid sequence is similar to those of the cytochromes c556 of Rhodopseudomonas palustris and Agrobacterium tumefaciens. The cycC gene was mutagenized by insertion of a kanamycin resistance cassette and homologously recombined into the B. japonicum genome. The resulting mutant made no c555 but made normal amounts of c55*. The levels of membrane cytochromes were unaffected. The mutant and wild type exhibited identical phenotypes when used to nodulate plants of soybean (Glycine max L. Merr.), with no significant differences in nodule number, nodule mass, or total amount of N2 fixed. a

Soluble cytochromes c are produced in large amounts by bacteria with specialized systems of energy metabolism, such as those that fix N2 (2). Spectral analyses of whole cells or homogenates of Bradyrhizobium japonicum, the soybean microsymbiont, have demonstrated an array of cytochromes c. These include a c550 (4, 5), a CO-reactive c552 (Mr, :13,000) (7, 9, 14), a CO-reactive C554 (Mr, "-85,000) (14), and a CO-reactive c555 (Mr, 15,000) (8). O'Brian and Maier (36, 37) showed that a membrane-bound, CO-reactive c552 from bacteroids participates in H2 oxidation. Ranaweera and Nicholas (39) showed that although the c550 serves as an immediate reductant for nitrate and nitrite reductases, the c552 was less effective and the C554 was ineffective. The functions of these other c cytochromes remain to be demonstrated. Mutagenesis of cytochrome genes in B. japonicum has been accomplished with nitrosoguanidine (16) or transposon Tn5 (32, 35), followed by screening for oxidase-deficient phenotypes. These mutants, however, have all been pleiotropic, with none specifically mutated for a given cytochrome c. To inactivate a specific cytochrome c, one must identify its structural gene and then perform mutagenesis. This has already been done for C552 (cycB) (40). In this study we have targeted the c555 gene (cycC). We have isolated cytochrome c555 (and c55o) from free-living cells of B. japonicum USDA 110 and used antibodies prepared against c555 to screen an expression library for the cycC gene. The cycC gene was mutagenized and recombined into the B. japonicum genome, resulting in a c555-deficient mutant phenotype. We also report on the properties of the purified cy*

Corresponding author.

tochromes, the sequencing of the gene, and the preliminary characterization of the mutant strain. MATERIALS AND METHODS

Bacterial strains, vectors, and growth. The strains, plasmids, and phages used are listed in Table 1. The B. japonicum strains were grown in AlE-gluconate medium (26). Escherichia coli was grown in LB medium or M9 minimal medium (29), with ampicillin, nfampin (50 ,ug/ml), tetracycline, streptomycin, or kanamycin (each at 25 ,ug/ml) added to maintain plasmids. Media were supplemented with 40 ,ug of X-Gal (5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside) per ml when needed to indicate expression of lacZ reporter genes. Phage lambda was maintained and cultured as described before (23). The E. coli plasmid transformations were done by the method of Hanahan (20). Bacteroids for cytochrome extraction were isolated from nodules of field-grown soybean (Glycine max L. Merr. cv. Williams). Seeds were sown in a Bradyrhizobium-free field plot and inoculated with B. japonicum USDA 110. Nodules were harvested 51 days after sowing. Bacteroids were isolated by grinding nodules in the buffer of Ching et al. (13), centrifuging at 10,000 x g for 10 min, and recovering by separating the upper layer of bacteroids from the lower layer of debris in the pellet. The bacteroids were resuspended in several pellet volumes of 0.2 M Tris, pH 8.0, and recentrifuged. Cytochrome isolation. For cytochrome isolation, B. japonicum USDA 110 was grown aerobically to stationary phase in 22 liters of medium, yielding 60 g (wet mass) of cells. Cells were resuspended in 120 ml of 0.2 M Tris, pH 8.0, supplemented with 20 mM p-mercaptoethanol, 0.5 mM phenyl7887

7888

J. BACTERIOL.

TULLY ET AL. TABLE 1. Bacterial strains, plasmids, and phages used in this work

or plasmid

E. coli DH5a

HB101

LE392 RT1015 MC4100

Y1089 Y1090 B. japonicum USDA 110 BJ1001 BJ1004

Reference or source

Description

Strain, phage,

Bethesda Research Laboratories, Inc.

Plasmid host for lacZ expression; F- A- 480d lacZ M15 A(lacZYAargF)U169 endAl hsdR17 supE44 thi-1 recAl gyrA96 relAl Plasmid host; F- A- hsdS20 recA13 ara-14 proA2 lacYI galK2 strA xyl-5 leu mtl-l supE44 Plasmid host; F- A- hsdR514 supE44 supF58 lacYI galK2 galT22 metBI trpR55 Rif' derivative of LE392 recA+ plasmid host; F- araD139 A(argF-lac)U169 rpsL150 relAl flbBS301 deoCI ptsF25 rbsR Host for Xgtll lysogens; lacU169 proA+ Alon araD139 strA hflA150

(Gaithersburg, Md.) 11

38

This study 38 Promega Corp. (Madison, Wis.)

(chr::TnlO) (pMC9) Host for Xgtll; AlacUl69 proA Alon araDI39 strA supF (trpC22::TnlO) (pMC9)

Promega Corp.

Wild-type strain USDA 110 c55_::Kmr (pPH1JI) USDA 110 c555::Kmr

USDA-ARS Rhizobium collection This study This study

Phages

Xgtll Xgtll.36B Plasmids pLAFRl pLAFR3

Alac5 ninS c1857 S100 Xgtll with in-frame fusion to

c555

gene

Promega Corp. This study

from USDA 110

pRK2073 pSUP202 pUC-4K pUC18 lOA5

Mobilizable cosmid vector; Tcr pLAFRl with lacZ reporter gene and multiple cloning site; Tcr Mobilizable; Spr Smr Gmr Helper plasmid containing tra genes for transfer of mobilizable plasmids; Spr Mobilizable suicide vector; Apr Cmr Tcr Source of Kmr cassette; Apr Kmr Cloning vector with lacZ reporter gene containing multiple cloning site; Apr pLAFRl clone from USDA 110 genomic library with 19-kbp insert containing

16 40 19 10 39 43 29 This study

pRET27

the c555 gene pUC18 clone of 4.5-kbp Xgtll.36B insert, containing downstream portion of

This study

pPH1JI

C555 gene

pRET30

pRET32 pRET41 pRET42 pRET43

pRET51

8.2-kbp pUC18 subclone of cosmid lOA5 containing the entire flanking sequences 3.0-kbp Sanl subclone of pRET30 in pUC18 pRET32 with Kmr cassette in XhoI site of c555 gene As per pRET30, but in pLAFR3 pRET42 with c555::Kmr; mobilizable BamHI subclone of pRET43 in pSUP202

methylsulfonyl fluoride, and 1 mM EDTA. Cells were disrupted by three passages through a French pressure cell at 18,000 lb/in2. Cell debris was removed by centrifugation for 1 h at 43,000 x g. An ammonium sulfate fraction (45 to 90% saturation) was collected, dissolved in a minimal volume of 0.2 M Tris, pH 8.0, and desalted on a Bio-Gel P-6 column (2.5 by 58 cm) in 10 mM Tris adjusted to pH 7.5 with MES (2-[N-morpholino]-ethanesulfonic acid). The extract was passed through a DEAE-cellulose column (55-ml bed volume) in the same buffer, and the pink cytochrome-containing effluent was collected. The solution was adjusted to pH 6.0 with MES and passed through a carboxymethyl cellulose column (50-ml bed volume) in 10 mM Tris-MES, pH 6.0. Elution with a 0 to 0.2 M linear NaCl gradient (300-ml total volume) resolved two cytochrome c fractions, c555 and c550, which were further individually purified. The cytochromes were adsorbed to a hydroxyapatite column (10-ml bed volume) in 10 mM phosphate buffer, pH 7.0, and eluted with a 0 to 0.4 M linear NaCl gradient (100-ml total volume). The

c555

gene

This study

plus

This This This This This

study study study study study

cytochromes were passed through a column of Fractogel TSK HW-55 (0.9 by 162 cm) in the 10 mM phosphate (pH 7.0) buffer. In each step of purification, the cytochrome c-containing pink fractions were collected and pooled. Spectra were recorded with a Shimadzu UV-3000 dualwavelength, dual-beam spectrophotometer. Estimated extinction coefficients were calculated from the spectra of purified preparations whose concentrations were measured by the reduced pyridine hemochrome assay (6), assuming an Es50 of 31.18 mM-1 for the hemochrome (10). Redox titrations. The midpoint potentials of the cytochromes c were determined by potentiometric titrations (15) with an Ingold platinum electrode with AgCl-KCl electrolyte. The redox mediators were potassium ferricyanide (Em7, +430 mV), phenazine ethosulfate (Em7, +55 mV), and diaminodurol (Em +240 mV), each at 0.1 mM in 0.1 M sodium phosphate buffer, pH 7.0. Sodium ascorbate was used as the reductant and potassium ferricyanide as the oxidant in the titrations. 7,

VOL. 173, 1991

Reaction with CO. Twenty micrograms of C555 in 100 ,ul of buffer containing 0.1 M MOPSO (3-[N-morpholino]-2-hydroxypropanesulfonic acid), 0.1 M boric acid, and 0.1 M Tris, adjusted to several different pHs with NaOH or HCI, was added to 900 pAl of CO-saturated H20, and the initial rate of increase in A416 was measured. The rate of reaction increased with pH through pH 10, with only a slight reaction at pH 7 (data not shown). Thus, all assays for CO reactivity presented in this work were performed at pH 9 or greater. DNA isolation, digestion, and library construction. E. coli plasmids were isolated, digested with restriction enzymes, and used for cloning by standard procedures (29). The B. japonicum genomic DNA was isolated as described before (41). For cloning into expression vector Xgtll, genomic DNA was partially digested with HaeIII, and fragments in the 4- to 7-kbp range were isolated on continuous sucrose density gradients (19). Internal EcoRI sites were protected by methylating with EcoRI methylase, and EcoRI linkers in three reading frames (8-, 10-, and 12-mers; New England BioLabs) were phosphorylated with polynucleotide kinase and ligated to the sized DNA with T4 ligase. Enzyme reactions were carried out according to the manufacturers' instructions. The linkered ends were digested with EcoRI, and DNA was separated from the linker fragments with a Sepharose 4B column (0.8 by 18 cm). The linkered DNA was ligated onto dephosphorylated Xgtll arms and packaged into phage according to the manufacturer's instructions (Promega). A cosmid library in pLAFR1 containing fragments of B. japonicum USDA 110 genomic DNA greater than 15 kbp was prepared by Barry Chelm (1). DNA hybridizations. DNA was blotted from agarose gels onto nitrocellulose or nylon filters by capillary Southern transfer (29). DNA from the B. japonicum cosmid library in E. coli was transferred to filters by first growing the colonies on top of filters underlaid with LB medium and then lysing the bacteria and washing the filters (49). DNA probes were labeled with [32P]dCTP, and the filters were hybridized, washed, and autoradiographed by standard procedures (29). Immunological procedures. Polyclonal antiserum against c555 was produced in young New Zealand White female rabbits. The first injection was given as 250 ,ug subcutaneously and 500 ,ug intramuscularly, followed at weekly intervals by two 250-jig booster injections. Subcutaneous injections contained 50% (vol/vol) Freund's complete adjuvant. Blood was collected 1 week after the final injection, and the serum was separated after clotting. Non-immunoglobulincontaining contaminants were removed by caprylic acid precipitation, followed by precipitation of the immunoglobulin with ammonium sulfate at 50% saturation (45). Plaque lifts from the Xgtll library were prepared as described before (23). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed on cell extracts or purified cytochromes by the method of Laemmli (27) on discontinuous slab gels. Gels were electroblotted (for Western immunoblots) onto nitrocellulose membranes with a Bio-Rad Trans-Blot Cell according to the manufacturer's instructions. Plaque lifts and electroblots were treated with the primary antiserum (1:1,000 dilution) for at least 2 h, followed by goat anti-rabbit immunoglobulinalkaline phosphatase conjugate (Sigma or Bio-Rad; 1:3,000) for 1 h. The alkaline phosphatase color reaction was developed by published procedures (30). Antigen-producing plaques were identified on filters, and the corresponding plaques on the agar plates were picked and purified. DNA sequence analysis of the cycC gene. Overlapping restriction fragments of the cycC region (Fig. 1) were sub-

BRAD YRHIZOBIUM JAPONICUM CYTOCHROMES c

7889

100 bp

R

v

N

X V

--- _

R

-_

-.

FIG. 1. Restriction map and sequencing strategy of C555 locus. Arrows indicate direction and extent of sequencing of individual clones. Direction of transcription of cycC ORF (shaded box, determined from Fig. 6) is right to left. The XhoI site (X) is the insertion point of the Kmr cassette in the c555 mutants. Other sites: R, RsaI; V, EcoRV; N, Not.

cloned into the M13 vectors mpl8 and mpl9 (51), and single-stranded templates were isolated (31). Nucleotide sequences were determined with a Sequenase 2.0 kit and a universal 17-mer M13 sequencing primer (United States Biochemical Corp.). Rather than including radiolabeled dATP in the reactions, the primer itself was end labeled with 32P by using [_y-32P]ATP (Amersham; >5,000 Ci/mmol) plus T4 polynucleotide kinase. Sequencing reactions were run with both dGTP and dITP labeling mixes to resolve regions of compression on the gels. Sequencing gels were made by using the HydroLink DNA sequencing system (AT Biochem, Malvern, Pa.). Plant tests. Seeds of soybean (G. max L. Merr. cv. Williams) were surface sterilized with acidified HgCI2 (48) and sown in modified Leonard jars (28) filled with vermiculite. Jars were moistened with N-free nutrient solution (34) and autoclaved before use. Each jar contained two plants and was inoculated at sowing with 5 ml of a B. japonicum stationary-phase culture (greater than 109 cells per ml). Uninoculated control jars were also prepared. Plants were grown for the first 19 days in a growth chamber set at day and night cycles of 25 and 20°C and 17 and 7 h, respectively. Jars were then transferred to a greenhouse for an additional 15 days of growth under natural sunlight, using low-pressure Na illumination to extend the photoperiod to 20 h. Plants were harvested, and shoots were analyzed for dry mass and N content (46). Nodule number and mass were also determined. Nucleotide sequence accession numbers. The nucleotide sequence of the cycC gene region has been deposited in the GenBank library as accession number M77796 and will also appear in the EMBL and DDBJ data banks. RESULTS Cytochrome purification and characterization. Table 2 shows the recoveries of cytochromes at each step of a typical isolation. The purified c555 exhibited a single band upon SDS-PAGE with an Mr of -15,500, and c550 exhibited a major band with an Mr of -12,400 (plus several minor contaminants) (Fig. 2). The same Mrs also were shown by the native cytochromes during the Fractogel column chromatography (not shown). The heme/protein molar ratio of c555 was calculated from the heme content (obtained by pyridine hemochrome assay) of a known weight of c555 dried in vacuo over P205. A value of 0.7 was obtained, suggesting a true ratio of 1 heme per protein molecule. This was verified by DNA sequence analysis (see below). Both C555 and c550 had absorption spectra typical of c-type cytochromes (Fig. 3A and C). The pyridine hemochrome

7890

TULLY ET AL.

J. BACTERIOL.

TABLE 2. Purification of soluble cytochromes c from B. japonicum Estimated aVol Cytochrome Recoveryc Procedure

total protein' (ml)

cb

(mg)

(%)

(mg) Initial French press supernatant 8,478 45-90o ammonium 1,570 sulfate DEAE-cellulose column 264 C555

CM-cellulosee column Fractogel column Hydroxyapatite column

C550

CM-cellulose column Hydroxyapatite column Fractogel column

43.1 5.29 0.916

159 3.73 1.66

108 50

1.67

79

1.46

87.4

41 5.5 24

0.67 0.38 0.44

40.1 22.8 26.3

100 5.1 7.4

0.99 0.71 0.53

59.3 42.5 31.7

_d 100

a Assuming an A280 of 1.0 for 1 mg of protein per ml. b Based on an es5 of 16.8 mM for reduced c555 and an S of 21.5 mM-1 for reduced c5.5 or an 8569-555 of 20.7 mM-1 for c555 ± the CO difference spectrum. Calculations through the DEAE chromatography step are based on the extinction coefficient of C550. c As a percentage of total cytochrome c in the ammonium sulfate fraction. d Soluble cytochromes were not assayed in the crude extract. CM-cellulose, carboxymethyl cellulose.

spectra were identical to those of heme c (not shown). Cytochrome c555 but not c550 showed a reaction with CO when reduced (Fig. 3B and D). Redox titrations. The Em,7 values obtained in the redox titrations were +236 mV for c555 and +277 mV for c550. These compare to a value of + 250 mV for horseheart mitochondrial cytochrome c measured under the same conditions. Amount of c5S, and c__o in cultured cells and bacteroids. Cells of USDA 110 were grown aerobically (open flasks), anaerobically (sealed flasks), and symbiotically (bacteroids). Cytochromes c were extracted and partially purified through the carboxymethyl cellulose step. The c555 and c550 were assayed in the carboxymethyl cellulose retentate and eluate, respectively. The amounts of c555 per gram of soluble protein in aerobic, anaerobic, and symbiotic cells were 32, 21, and 30 nmol, respectively, for c555 and 31, 44, and 65 nmol, respectively, for c550. Screening for the c555 gene (cycC). Plaque lifts from 40 petri

FIG. 2. SDS-PAGE of purified cytochromes c stained with Coomassie blue. Numbers refer to positions of size standards, in kilodaltons.

dishes, each plated to confluency with Xgtll library clones, were screened with the anti-c555 antiserum. The purified C555 reacted with the anti-c555 antibody in a Western blot, but c550 showed no reaction (not shown). Thirteen strongly positive plaques were picked, and the phage were purified and lysogenized into E. coli Y1089. One clone, Xgtll.36B (Fig. 4), produced a fusion protein with an Mr on an SDS-PAGE/ Western blot corresponding to that predicted for a protein of 16,000 molecular weight (i.e., the actual measured size of 130,000 for the chimeric protein equals 114,000 for the truncated ,3-galactosidase portion plus 16,000 for the unknown polypeptide). The 4.5-kbp EcoRI insert from Xgtll was cloned into pUC18, producing plasmid pRET27 (Fig. 4). Plasmid pRET27 was subsequently used for restriction endonuclease mapping of the c555 region and as a labeled probe for screening the cosmid library. The USDA 110 cosmid library was screened for hybridization homology with 32P-labeled pRET27, and three positive colonies with overlapping sequences were detected. One of the positive clones, 10A5, contained the putative c555 region with several kilobase pairs of flanking DNA and was selected for further study (Fig. 4). Subcloning and mutagenesis of the cycC gene. The 8.5-kbp EcoRI fragment from 10A5, containing the putative c555 region, was subcloned into pUC18 and pLAFR1, creating pRET30 and pRET42, respectively (Fig. 4). It was desired to mutagenize the prospective cycC gene by insertion of a kanamycin resistance (Km') cassette into the XhoI site. However, the presence of several other XhoI sites in the clone made this difficult. Thus, a 3.0-kbp SalI fragment containing the cycC gene and its internal XhoI site but no flanking XhoI sites was cloned into pUC18 (pRET32; Fig. 4). A 1.2-kbp Kmr cassette, excised from pUC-4K with SalI, was ligated into this XhoI site, creating plasmid pRET41 (Fig. 4). Since plasmid pRET41 lacked sufficient DNA upstream of the Kmr cassette to allow efficient homologous exchange if introduced into B. japonicum, the cycC region with the Kmr cassette insertion was introduced back into the larger clone pRET42 through homologous exchange in E. coli. To accomplish this, E. coli MC4100, a RecA+ strain, was transformed with both pRET41 and pRET42. The transformant was selected on LB medium with tetracycline, kanamycin, and ampicillin to maintain both of the plasmids plus the Kmr cassette insertion. The double transformant was mated on LB agar with RT1015 overnight by using helper strain HB101(pRK2073). The mating mix was plated onto LB plus kanamycin, tetracycline, and rifampin to select a mobilized double crossover of the Kmr cassette region from pRET41 into plasmid pRET42. Plasmid pRET43, which was thus obtained, was used to introduce the mutagenized gene into B. japonicum through plate matings. E. coli DH5at(pRET43) was mixed with B. japonicum USDA 110 plus helper strain HB101(pRK2073) on A1E agar for 2 days, and the mix was diluted with H20 and plated onto A1E plus kanamycin and tetracycline to select for mobilization of pRET43 into USDA 110. The resulting transconjugant was similarly mated with HB101(pPHlJI), and transconjugants were selected with kanamycin plus spectinomycin. Since pPH1JI and pLAFR3 are both IncP plasmids, this selection forced the loss of pLAFR3 and retention of the Kmr cassette in the chromosome as a double recombinant (BJ1001). Strain BJ1001 is sensitive to tetracycline, verifying the loss of pLAFR3. Genomic DNA cut with BamHI and subjected to Southern hybridization with a probe from pRET32 showed that the 4.8-kbp BamHI fragment from USDA 110 (see map of 10A5, Fig. 4) had increased in size in BJ1001 to 6.1 kbp,

VOL. 173, 1991

BRADYRHIZOBIUM JAPONICUM CYTOCHROMES c

0

0

_

0s ,4yt
560

1 kbp

A

552-

c-555::bcZ

X gtl1.36B

X

P

0.010

X gt 1l

X

Subclone EcoRI fragment

0.005

c-555 -

pRET27

@tN

pUC18

E

,- 1 \

603

E

Probe cosmid library

4)

L)

0

c

0

1 OAS

....1

,

,

X

, Bep

,I

.

,

X

X

.....

pLAFR1

B E

X

.0

cg0.0 0)

B

.0

Subclone EcoRI fragment pRET30/ pRET42

pUC1 8/

pLAFR3

0

1 Subclone Sail fragment pUC18

pRET32 S

a

Insert Kan cassette / + Inaer Homoiogoua K/ exchange of Kan [ 8 /r-I

pRET41

500

pRET51

1

Kan

B

B Kan

FIG. 4. Restriction endonuclease maps of recombinant DNA constructions generated in the cloning and mutagenesis of the c555 gene (X, XhoI; B, BamHI; P, PstI; E, EcoRI; S, Sail). In Xgtll.36B, only a portion of the vector's lacZ gene is shown (shaded box), with the arrow indicating the direction of transcription of the fusion with the c555 gene. The arrows in the remaining constructions indicate the approximate location and direction of transcription of the c555 gene. The triangles in pRET41 and pRET43 indicate the insertion point of the Kmr cassette (Kan) (see also Fig. 1). The EcoRI sites at the boundaries of pRET27, which was derived from Xgtll.36B, were artificially generated at HaeIII sites during construction of the Xgtll library. Only a portion of the B. japonicum DNA in cosmid clone 10A5 is shown.

palustris, 34.9% matched exactly and 21.7% (Fig. 7).

600

550

650

Wavelength,

500

550

600

650

nm

FIG. 5. Spectra of membrane (A and B) and soluble (C and D) preparations from B. japonicum USDA 110 (-) and BJ1001 (-. -- -). Spectra are oxidized minus reduced difference (A and C) and reduced + CO minus reduced (B and D). Protein levels, based on the A280, were 12.8 mg/ml for USDA 110 membranes, 11.4 for BJ1001 membranes, 1.16 mg/ml for USDA 110 soluble; and 1.20 mg/ml for BJ1001 soluble.

~

Subclone BamHI ftragment

L560

pUC1 8

Kan

pRET43

552

-0.0051

were

similar

DISCUSSION In soluble extracts of aerobically grown B. japonicum USDA 110 cells, the only'c-type cytochromes observed in significant quantities' were c550 and c555, both being present in roughly equal amounts. Though we have not examined other strains for c-type cytochromes, C. A. Appleby (8) has isolated from bacteroids of B. japonicum CC705 (Wisconsin 505) a cytochrome C555 of Mr 15,000 which appears to be identical to the c555 described in this work but is present in much lower amounts than in USDA 110. Also present in strain CC705 soluble extracts are CO-reactive c552 (Mm n13',000) and C5s4 (Mr, -85,000), though both are present at much lower levels than c550 (14). Both c550 and cs55 were present in USDA 110 under all growth conditions tested-aerobic, anaerobic, and in planta. Thus, it is unlikely that either cytochrome performs a function specific to the symbiotic state. It is interesting that the level of c550 in bacteroids was about twice that in free-living aerobic cells; this may reflect the increased demand for energy by N2 fixation. This increase in C550

concentration under symbiotic conditions has been shown previously in strains USDA 110 (24, 25) and CC705 (14) and also in strain CC705 grown anaerobically (14) or semianaerobically (39) with NOR. The cytochromes c550 and c555 possess rather low apparent molecular weights (M, -12,400 and 15,500, 'respectively) and are monomeric, exhibiting the same apparent molecular weights either on denaturing SDS gels or on size exclusion chromatography of the native proteins. They also possess high-midpoint redox potentials (+277 and +236 mV for c550 and c555, respectively). They thus appear similar to the small, single-heme bacterial cytochromes c, which have positive midpoint redox potentials and which function as electron donors to a terminal oxidase (38). The fact that c555 has a single heme-binding site near the' C terminus (Fig. 6) places it in Ambler's class II (38). The presence of a presumptive signal sequence at the N terminus of the deduced cycC translation product (Fig. 7) is consistent with a periplasmic localization of c.55. The calculated molecular mass of the remaining 129-amino-acid polypeptide, presumTABLE 3. Soybean plant growth and nodulationa Inoculum

No. No.

USDA 110 BJ1004 Controlb

76.0 71.3 1.3

Nodules Wet mass

~

(g) 3.09 2.77 0.01

Plant top Dry mass Total N

(g) 8.13 8.19 1.84

L.S.D.C 15.3 1.07 0.45 a All values are means for four jars, with two plants per jar. b Uninoculated plants. c L.S.D., least significant difference at 0.05 level.

(g) 0.242 0.234 0.019 0.049

VOL. 173, 1991

BRADYRHIZOBIUM JAPONICUM CYTOCHROMES c

7893

CAAGGCATCTGCGAGTC GGAGJAAACTAACCAATGAAACGGACGATGATTGTCGTGACGACCCTG

1

MetLysArgThrMetIleValValThrThrLeu 65

CTATTGGGCGCGGGGGCCGTGATGGCGCAGCAGGAGGTCGCGGTTCAACAGGATAATCTGATGCGC

LeuLeuGlyAlaGLyAlaVaLMetALaGlnGLnGluVaLAIaValGlnGlnAspAsnLeuMetArg EcoRV

131

TCGCAGGCCAGGAGCCTCTATACGGTCATCCTGAAGATGACCAAGGGCGATATCCCCTACGACCAG SerGlnALaArgSerLeuTyrThrValIleLeuLysMetThrLysGLyAspIleProTyrAspGln HaeIII Xhol

197

AAGGCCGCCGACGAGGCGATCGCCAATCTCGAGACCGACGTCGCCAAGATCGCCAAGACCTTCGAG

LysALaAlaAspGLuAlaIleAlaAsnLeuGluThrAspVaLAlaLysIleAlaLysThrPheGLu 263

GTCAATCCCAAGCAGGACGTGGTGAACGCGACCTATGGGGCCTCGCCGAAGGTCTGGAAGAACAAC

ValAsnProLysGLnAspValVaLAsnALaThrTyrGlyAlaSerProLysValTrpLysAsnAsn 329

GGCGATTTCGACTCCAAGATCCCGCCGGTGCAGAAGGCGATCGCGCAGGTCAAGGGCAAGATCACC

GlyAspPheAspSerLysIleProProValGlnLysAlaIleALaGLnVaLLysGlyLysILeThr 395

N ruI GACGTCGCGAGCCTCAAGGCCGCCTATACCGCGATCAACGATCGTTGCACCGACTGCCACGAGACG

AspValALaSerLeuLysAlaAlaTyrThrAlalLeAsnAspArgCysThrAspCysHisGLuThr 461

TATCGGCTGAAGTTGAAGTAGCCACCTGAATTTTTTCCACGCTCGACCTCGTAGCCCGGATGAGCG

527

TyrArgLeuLysLeuLys * EcoRV CAATGATATCCGGGGAAGGCGACCCCGCATGTCGCTTCGCTCATGCGGCTCCGAGCGTTGCTTCAA

593 659

Rsa I TCAGCACGGCCTGCCGGACCTGGTAATTGCGGCAGGTGCGCAGGTCAGCTAGGTTGTACTTCACGA AGAGCCTCCGTGCTCATTCGTCCTATCGCGCGACTGGCGAGCTAA

FIG. 6. Nucleotide sequence of cycC region and deduced amino acid sequence of c555 ORF. The box at bases 18 to 21 indicates a putative Shine-Dalgarno sequence. The box beginning at base 440 indicates the heme-binding site. An asterisk marks the stop codon. Arrows indicate similar direct and inverted sequences. The HaeIII site is the position of the Xgtll.36B fusion.

ably the c555 apoprotein, is 14,160 Da, or 14,780 Da with a heme attached. The reactivity of a cytochrome with CO is often indicative of an oxidase function, though with microbial c-type cytochromes this is usually not true (38). That the reaction of C555 with CO proceeds only at alkaline pH, and then rather slowly, suggests that this may be a nonphysiological feature. The absorption spectra of reduced c550 and c555 (Fig. 3) are typical of cytochromes with low-spin heme (50) in that they each possess a sharp a-band, a definite P-band, a strong Soret band, and no significant absorption in the 600- to 650-nm region. Also, the CO difference spectrum of c555 (Fig. 3B) is typical of a low-spin reduced state. As discussed by Wood (50), low-spin cytochromes generally act as electron carriers; any CO binding may be due to a labile sixth

ligand of the heme that may be important for the protein's electron transfer function, or it may be fortuitous. Insertion of a Kmr cassette into the cycC ORF resulted in a c555 mutant phenotype when introduced into B. japonicum. It is clear from Fig. 5 that loss of the ability to produce cs55 is specific, with no noticeable effect on the spectra of other membrane or soluble cytochromes. Also, attempts to isolate c555 from mutants BJ1001 and BJ1004 have failed, although normal amounts of c550 were isolated (data not shown). The cycC mutant BJ1004 displayed a normal plant phenotype, with no significant difference between it and the wild type in nodule mass, nodule number, plant top mass, or total plant top N. This indicates that cytochrome C555 does not play a critical role in nodulation or N2 fixation. The mutant also showed no defect in growth on complex media, with

---A sG E VEKRE MK IG AM SLAAIS GEK 29 A. tum [ LKIMTIKGIDI 1 51 MKRTM I VV TTL L LGAGAVMAfQE I c-555 NLM LS qA 9 D NGR - NMM V L G AIIAKGEK 30 --qD V ID TK R. palus

[ASJLY .1VIl

A. tum

F ADTVK A

TTNAKJA PA

PAG

ETG-N--

EVNP QDVVNA PYDQK A E IANLETDVAKIA ETAKD P r. PDSV GLKPFD PYOQAAV D

A. tum

HK

K

GTD ADI

JI E

FE

SPKVK YS SI K 1 R MKTGAD PGA F0JTYWULK GQTl DVMAs ;LKAAYT A[NDR ITECHETYRRDL K LK

c-555 R. palus

74

101 K 81 122

149 c-555 FDSK I PP qKA 129 EG L KAAMGK I -DV R. palus FT EL A D F AKAVDG A FIG. 7. Alignment and comparison of amino acid sequence of B. japonicum cs55 with cytochromes c556 from R. palustris and A. tumefaciens (A. tum) (3). Open boxes indicate identities with c555; shaded boxes indicate amino acid similarities as defined by Hoekstra et al. (22). Gaps have been inserted to aid alignment.

7894

TULLY ET AL.

cultures reaching the same final density of 3.3 g (fresh mass) per liter of AlE-gluconate broth. Because of this lack of a mutant phenotype, we cannot yet assign a specific function to C555; indeed, c555 and c55o may be equally available for a variety of reactions that generate reducing equivalents. Future work involving growth on specific compounds, performed with single or multiple mutations in these and other cytochrome genes, will help clarify the roles of the various cytochromes. REFERENCES 1. Adams, T. H., C. R. McClung, and B. K. Chelm. 1984. Physical organization of the Bradyrhizobiumjaponicum nitrogenase gene region. J. Bacteriol. 159:857-862. 2. Ambler, R. P. 1982. The structure and classification of cytochromes c, p. 263-280. In N. 0. Kaplan and A. Robinson (ed.), From cyclotrons to cytochromes. A'cademic Press, Inc., New York. 3. Ambler, R. P., R. G. Bartsch, M. Daniel, M. D. Kamen, L. McLellan, T. E. Meyer, and J. Van Beeumen. 1981. Amino acid sequences of bacterial cytochromes c' and c-556. Proc. Natl. Acad. Sci. USA 78:6854-6857. 4. Appleby, C. A. 1969. Electron transport systems of Rhizobium japonicum. I. Haemoprotein P-450, other CO-reactive pigments, cytochromes and oxidases in bacteroids from N2-fixing root nodules. Biochim. Biophys. Acta 172:71-87. 5. Appleby, C. A. 1969. Electron transport systems of Rhizobium japonicum. II. Rhizobium haemoglobin, cytochrome and oxidases in free-living (cultured) cells. Biochim. Biophys. Acta 172:88-105. 6. Appleby, C. A. 1969. Properties of leghemoglobin in vivo, and its isolation as ferrous oxyleghemoglobin. Biochim. Biophys. Acta

188:222-229. 7. Appleby, C. A. 1978. Function of P-450 and other cytochromes in Rhizobium respiration, p. 11-20. In H. Degn, D. Lloyd, and

8. 9. 10. 11. 12.

13. 14.

15.

16. 17.

18.

19.

G. C. Hill (ed.), Functions of alternative terminal oxidases. Pergamon Press, Oxford. Appleby, C. A. 1991. Personal communication. Avissar, Y. J., and K. D. Nadler. 1978. Stimulation of tetrapyrrole formation in Rhizobium japonicum by restricted aeration. J. Bacteriol. 135:782-789. Bartsch, R. G. 1971. Bacterial cytochromes. Methods Enzymol. 23:344-363. Bolton, E., P. Glynn, and F. O'Gara. 1984. Site specific transposition of Tn7 into a Rhizobium meliloti megaplasmid. Mol. Gen. Genet. 193:153-157. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41:459-472. Ching, T. M., S. Hedtke, and W. Newcomb. 1977. Isolation of bacteria, transforming bacteria, and bacteroids from soybean nodules. Plant Physiol. 60:771-774. Daniel, R. M., and C. A. Appleby. 1972. Anaerobic-nitrate, symbiotic and aerobic growth of Rhizobium japonicum: effects on cytochrome P450, other haemoproteins, nitrate and nitrite reductases. Biochim. Biophys. Acta 275:347-354. Dutton, P. L. 1978. Redox potentiometry: determination of midpoint potentials of oxidation-reduction components of biological electron-transfer systems. Methods Enzymol. 54:411435. El Mokadem, M. T., and D. L. Keister. 1982. Electron transport in Rhizobium japonicum. Isolation of cytochrome c-deficient mutants. Isr. J. Bot. 31:102-111. Emr, S. D., M. N. Hall, and T. J. Silhavy. 1980. A mechanism of protein localization: the signal hypothesis and bacteria. J. Cell Biol. 86:701-711. Friedman, A. M., S. R. Long, S. E. Brown, W. J. Buikema, and F. M. Ausubel. 1982. Construction of a broad host range cosmid vector and its use in the genetic analysis of Rhizobium mutants. Gene 18:289-296. Frischauf, A.-M. 1987. Digestion of DNA: size fractionation. Methods Enzymol. 152:183-189.

J. BACTERIOL.

20. Hanahan, D. 1985. Techniques for transformation of E. coli, p. 109-135. In D. M. Glover (ed.), DNA cloning, vol. I: a practical approach. IRL Press, Oxford. 21. Hirsch, P. R., and J. E. Beringer. 1984. A physical map of pPH1JI and pJB4JI. Plasmid 12:133-141. 22. Hoekstra, M. F., R. M. Liskay, A. C. Ou, A. J. DeMaggio, D. G. Burbee, and F. Heffron. 1991. HRR25, a putative protein kinase from budding yeast: association with repair of damaged DNA. Science 253:1031-1034. 23. Huynh, T. V., R. A. Young, and R. W. Davis. 1985. Constructing and screening cDNA libraries in XgtlO and Xgtll, p. 49-78. In D. M. Glover (ed.), DNA cloning, vol. I: a practical approach. IRL Press, Oxford. 24. Keister, D. L., and S. S. Marsh. 1990. Hemoproteins of Bradyrhizobiumjaponicum cultured cells and bacteroids. Appl. Environ. Microbiol. 56:2736-2741. 25. Keister, D. L., S. L. Marsh, and M. T. El Mokadem. 1983. Cytochromes of Rhizobium japonicum 61A76 bacteroids from soybean nodules. Plant Physiol. 71:194-196. 26. Kuykendall, L. D., M. A. Roy, J. J. O'Neill, and T. E. Devine. 1988. Fatty acids, antibiotic resistance, and deoxyribonucleic acid homology groups of Bradyrhizobium japonicum. Int. J. Syst. Bacteriol. 38:358-361. 27. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. 28. Leonard, L. T. 1943. A simple assembly for use in the testing of cultures of rhizobia. J. Bacteriol. 45:523-527. 29. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 30. Mierendorf, R. C., C. Percy, and R. A. Young. 1987. Gene isolation by screening Xgtll libraries with antibodies. Methods Enzymol. 152:458-469. 31. Miller, H. 1987. Practical aspects of preparing phage and plasmid DNA: growth, maintenance, and storage of bacteria and bacteriophage. Methods Enzymol. 152:145-170. 32. Nautlyal, C. S., P. van Berkum, M. J. Sadowsky, and D. L. Keister. 1989. Cytochrome mutants of Bradyrhizobium japonicum induced by transposon Tn5. Plant Physiol. 90:553-559. 33. Norrander, J., T. Kempe, and J. Messing. 1983. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene 26:101-106. 34. Norris, D. 0. 1964. Techniques used in work with Rhizobium. Commonw. Bur. Pastures Field Crops Hurley Berkshire Bull. 47:186-198. 35. O'Brian, M. R., P. K. Kirshbom, and R. J. Maler. 1987. TnS-induced cytochrome mutants of Bradyrhizobium japonicum: effects of the mutations on cells grown symbiotically and in culture. J. Bacteriol. 169:1089-1094. 36. O'Brian, M. R., and R. J. Maier. 1982. Electron transport components involved in hydrogen oxidation in free-living Rhizobium japonicum. J. Bacteriol. 152:422-430. 37. O'Brian, M. R., and R. J. Maier. 1983. Involvement of cytochromes and a flavoprotein in hydrogen oxidation in Rhizobium japonicum bacteroids. J. Bacteriol. 155:481-487. 38. Pettigrew, G. W., and G. R. Moore. 1987. Cytochromes c. Springer-Verlag, New York. 39. Ranaweera, S. S., and D. J. D. Nicholas. 1985. Cytochromes c550 and c552 as electron donors for nitrate and nitrite reductases in membrane fractions of Rhizobium japonicum CC705. Biochem. Int. 10:415-423. 40. Rossbach, S., H. Loferer, C. A. Appleby, P. James, and H. Hennecke. 1990. Cloning, sequencing and mutational analysis of the Bradyrhizobiumjaponicum gene for cytochrome c552, abstr. P125, p. 97. Abstr. 5th Int. Symp. Mol. Genet. Plant-Microbe Interact., 1990. 41. Sadowsky, M. J., R. E. Tully, P. B. Cregan, and H. H. Keyser. 1987. Genetic diversity in Bradyrhizobiumjaponicum serogroup 123 and its relation to genotype-specific nodulation of soybean. Appi. Environ. Microbiol. 53:2624-2630. 42. Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Labora-

VOL. 173, 1991

tory, Cold Spring Harbor, N.Y. 43. Simon, R., U. Priefer, and A. Piihler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1:784791. 44. Staskawicz, B., D. Dahlbeck, N. Keen, and C. Napoli. 1987. Molecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea. J. Bacteriol. 169:5789-5794. 45. TiJssen, P. 1985. Practice and theory of enzyme immunoassays, p. 96-99. In R. H. Burdon and P. H. van Knippenberg (ed.), Laboratory techniques in biochemistry and molecular biology, vol. 15. Elsevier, Amsterdam. 46. van Berkum, P. 1990. Evidence for a third uptake hydrogenase phenotype among the soybean bradyrhizobia. Appl. Environ. Microbiol. 56:3835-3841. 47. Vieira, J., and J. Messing. 1982. The pUC plasmids, an

BRADYRHIZOBIUM JAPONICUM CYTOCHROMES c

48. 49. 50. 51. 52.

7895

M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268. Vincent, J. M. 1970. A manual for the practical study of root-nodule bacteria. International Biological Programme Handbook no. 15. Blackwell Scientific Publications, Oxford. Vogeli, G., and P. S. Kaytes. 1987. Amplification, storage, and replication of libraries. Methods Enzymol. 152:407-415. Wood, P. M. 1984. Bacterial proteins with CO-binding b- or c-type haem functions and absorption spectroscopy. Biochim. Biophys. Acta 768:293-317. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119. Young, J. P. W., H. L. Downer, and B. D. Eardly. 1991. Phylogeny of the phototrophic rhizobium strain BTAil by polymerase chain reaction-based sequencing of a 16S rRNA gene segment. J. Bacteriol. 173:2271-2277.