Plant Physiology and Biochemistry 75 (2014) 114e122

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Characterization of an oleate 12-desaturase from Physaria fendleri and identification of 50 UTR introns in divergent FAD2 family genes Sharla Lozinsky, Hui Yang, Li Forseille, Gillian R. Cook, Irving Ramirez-Erosa, Mark A. Smith* National Research Council of Canada, 110 Gymnasium Place, Saskatoon, SK S7N 0W9, Canada

a r t i c l e i n f o

a b s t r a c t

Article history: Received 30 October 2013 Accepted 20 December 2013 Available online 28 December 2013

Mining of an EST sequence collection representing genes expressed during seed development in Physaria fendleri identified abundant sequences encoding apparent homologues of the Arabidopsis oleate 12desaturase (AtFAD2 At3g12120). Of the 62 sequenced clones, 59 were identified as encoding the previously characterized bifunctional oleate 12-hydroxylase/desaturase (LFAH12/PfFAH12). The remaining 3 clones encoded a second FAD2 homologue. Isolation of a full length ORF and heterologous expression in yeast revealed that this sequence, designated PfFAD2, is the first full length sequence from any Physaria species that encodes an oleate 12-desaturase. PfFAD2 was expressed in both leaf and developing seed with activity on palmitate (16:1D9) and oleate (18:1D9). Sequence comparison revealed that PfFAD2 shares 93% amino acid identity with Arabidopsis FAD2 and only 84% identity with PfFAH12. By comparison of EST and genomic sequences it was revealed that the PfFAD2 gene encodes a transcript with a single intron of 1120 bp in the 50 untranslated region (50 UTR). A short intron, 81 bp in length, was also discovered in the 50 UTR of the PfFAH12 gene, 16 bp upstream of the translation initiation codon. In silico examination of FAD2 like genes from the genome of castor (Ricinus communis) identified putative 50 UTR introns in genes encoding the castor oleate 12-desaturase (RcFAD2) and oleate 12-hydroxylase (CFAH12). By sequencing of genomic DNA the presence of single 50 UTR introns in each gene, and the size of these introns, was confirmed. These findings suggest that 50 UTR introns may be a characteristic feature of FAD2 genes and also of divergent FAD2 genes encoding fatty acid modifying enzymes, and that the selection pressure maintaining these introns is very different. Crown Copyright Ó 2014 Published by Elsevier Masson SAS. All rights reserved.

Keywords: Fatty acid desaturase FAD2 Fatty acid hydroxylase Physaria fendleri Lesquerella 50 UTR intron

1. Introduction Plants of the genus Physaria (previously Lesquerella (Al-Shehbaz and O’Kane, 2002)) generally store hydroxy fatty acids (HFAs) as the predominant acyl component of their seed oil (Hayes et al., 1995; Salywon et al., 2005). The pathway of biosynthesis of lesquerolic acid (14-hydroxyeicos-cis-11-enoic acid, 20:1-OH), the dominant HFA of Physaria fendleri, involves the hydroxylation of oleate (octadec-cis-9-enoic acid, 18:1) to form ricinoleate (12-hydroxyoctadeccis-9-enoic acid,18:1-OH), followed by elongation to lesquerolic acid (Engeseth and Stymne, 1996; Reed et al., 1997; Moon et al., 2001). Cloning of the fatty acid hydroxylase from P. fendleri (Broun et al., 1998a) revealed that hydroxylation was catalyzed by a bifunctional enzyme, designated LFAH12, capable of introducing either a

Abbreviations: EST, expressed sequence tag; FAD2, fatty acid desaturase 2; FAMES, fatty acid methyl esters; HFA, hydroxy fatty acid; ORF, open reading frame. * Corresponding author. Tel.: þ1 306 975 5574; fax: þ1 306 975 4839. E-mail address: [email protected] (M.A. Smith).

hydroxyl group to carbon atom 12 (C12) of 18:1 to form ricinoleate, or a double bond between C12 and C13 to form linoleate (octadeccis-9,12-dienoic acid, 18:2). The LFAH12 hydroxylase/desaturase enzyme belongs to the FAD2 fold of enzymes, a group of enzymes which are considered to have arisen from an ancestral oleate 12desaturase (FAD2) (Shanklin and Cahoon, 1998). These enzymes use a di-iron center to catalyze the oxygen dependent modification of fatty acids. Reaction outcomes including desaturation, hydroxylation, epoxidation and acetylation have been reported (Shanklin and Cahoon, 1998; Sperling et al., 2003). The evolution of the divergent FAD2 enzymes, catalyzing modification reactions other than desaturation, is thought to have involved gene duplication, followed by specialization of enzyme function and gene expression. These enzymes are generally expressed only in developing seeds, and the modified fatty acids they synthesize can accumulate to high levels. Seeds of castor (R. communis) contain triacylglycerol oil in which ricinoleic acid is the predominant component, at close to 90% of total seed fatty acids. In this plant, ricinoleic acid production is catalyzed by a divergent FAD2 that functions as an oleate 12-hydroxylase, encoded by the CFAH12 gene (van de Loo et al.,

0981-9428/$ e see front matter Crown Copyright Ó 2014 Published by Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.plaphy.2013.12.016

S. Lozinsky et al. / Plant Physiology and Biochemistry 75 (2014) 114e122

1995). CFAH12 is only expressed in developing seed and transcript is abundant (Lu et al., 2007; Brown et al., 2012). The castor genome also encodes a second FAD2 homologue (EF071863) ((Chan et al., 2010), www.plantgdb.org, http://castorbean.jcvi.org/index.php) which encodes an oleate 12-desaturase (Lu et al., 2007) and is expressed at low levels in seed and in other tissues. Similarly, although P. fendleri expresses LFAH12 in the developing seed, a number of studies have shown that a second FAD2 homologue is also expressed during seed development and in vegetative tissue (Broun et al., 1998a; Chen et al., 2011). The protein encoded by this gene has not been functionally characterized and it is not known whether this is a second bifunctional enzyme, or a true fatty acid desaturase. The FAD2 family fatty acid hydroxylase and desaturase genes in castor and P. fendleri clearly show differential expression. Factors determining the timing and location of expression of genes encoding divergent FAD2 enzymes, are not well understood. Seed specific expression of LFAH12 from P. fendleri has been shown to be conferred by regulatory elements within the promoter region of the LFAH12 gene (Broun et al., 1998a). However, the recent cloning of FAD2 genes from a range of plant species and the discovery of FAD2 desaturase genes that show seed specific expression, suggests that additional factors may be involved that confer tissue specificity, and regulate the level of mRNA accumulation. Genome sequencing and isolation of genomic clones indicates that FAD2 genes are characterized by the presence of a single intron located in the 50 -untranslated region of the precursor mRNA (50 UTR intron) (Kim et al., 2006; Zhang et al., 2009; Kang et al., 2011; Lee et al., 2012; Cao et al., 2013). In Arabidopsis, these introns have been implicated in enhancing gene expression through a mechanism that increases mRNA levels, without boosting transcript initiation (Parra et al., 2011). Although not all introns are capable of intron-mediated enhancement (IME), a recent study of a seed specific FAD2 from sesame (Sesamum indicum) suggests that the 50 UTR intron of this gene may contain IME elements. Kim and coworkers (Kim et al., 2006) reported that a regulatory mechanism involving negative cis-regulatory elements in the SeFAD2 promoter and enhancers in the 50 UTR controlled the seed specific expression of the SeFAD2 gene. Whether the expression of divergent FAD2 genes, which are often expressed at high levels in the seed, involves IME due to the presence of a 50 UTR intron is not known and the conservation of this feature in such genes has not been reported in detail. Genome annotation suggests that a 50 UTR intron is present in the oleate 12hydroxylase gene of castor, but no intron was reported for the LFAH12 gene of P. fendleri (Broun et al., 1998a). Further characterization of the FAD2 homologues of P. fendleri, including demonstration of function of the putative FAD2 desaturase would allow a better understanding of the evolution of hydroxylase activity in this species and would provide a way to assess the potential presence of an unreported 50 UTR intron in the LFAH12 gene. To achieve these objectives, we used an EST sequencing approach to identify full length clones encoding the P. fendleri FAD2 homologues, PfFAH12 and PfFAD2, followed by demonstration of function for PfFAD2 by heterologous expression in the yeast Saccharomyces cerevisiae. Genomic and EST sequence comparison demonstrated the presence of 50 UTR introns in both genes. 2. Materials and methods 2.1. Physaria fendleri cDNA library construction and EST sequencing Whole, field grown Physaria fendleri plants, with roots removed, were generously donated by Dr. D. Dierig (USDA, National Center for Genomic Resources Preservation, Fort Collins, CO. USA). Developing seeds from early to mid maturation (stages I to II as

115

previously defined (Moon et al., 2001)) were removed from seed capsules, flash frozen in liquid nitrogen and stored at 80  C until needed. For cDNA library preparation, total RNA was isolated from developing seeds of P. fendleri using the CTAB method (Meisel et al., 2005) and mRNA was purified using a Dynabead mRNA Purification Kit (Invitrogen Inc., Burlington, ON, Canada) following the manufacturer’s instructions. An aliquot of 3.5 mg mRNA was used for cDNA synthesis using a Stratagene cDNA synthesis kit (Stratagene Inc. Santa Clara, CA, USA) and resulting cDNAs were cloned into the vector pBluescript SKþ. Recombinant plasmids were used to transform DH10B T1 phage resistant E. coli (Invitrogen) with selection on carbenicillin. Colonies were picked into 96 well plates for high-throughput single end sequencing using an Applied Biosystems 3730 sequencer (www.appliedbiosystems.com). Sequences were assembled and annotated against TAIR Proteins and UniProt Plants databases using the National Research Council Canada FIESTA-2 bioinformatics software (http://bioinfo.pbi.nrc.ca/ home/index.html). 2.2. Isolation of full length cDNAs and gene expression analysis by RT-PCR Colonies were selected for further sequencing based on sequence similarity to Arabidopsis FAD2 (At3g12120, AtFAD2) and the identification of a putative translation initiation codon in the EST sequence. Sequencing was conducted using an Applied Biosystems 3730 sequencer. Plasmids encoding homologues of Arabidopsis tubulin beta-2, actin and glyceraldehyde-3-phosphate dehydrogenase were also chosen for sequencing. Vector sequence was identified using VecScreen (http://www.ncbi.nlm.nih.gov/ VecScreen/VecScreen.html) and sequence reads were assembled using ClustalW (http://www.genome.jp/tools/clustalw/). Reversetranscription PCR (RT-PCR) was used to assess relative expression levels in leaf and developing seed of Physaria fendleri. Total RNA was isolated using TRIzol reagent (Invitrogen) and resuspended in RNase-free water for further purification using an RNeasy mini kit (Qiagen). Purified total RNA was used as template for cDNA synthesis using SuperScript II reverse transcriptase (Invitrogen). PCR was performed with Taq polymerase (Invitrogen) for 28 cycles (94  C 30 s, 58  C 30 s, 72  C 1 min, followed by a final extension at 72  C for 10 min), using gene specific primer pairs LfHRTF (50 -T TGGGTATGTCAAGGCTGTG) and LfHRTR (50 -CATTCCCACTCGGTTG AATC), PfFRTF (50 -TAAAGCGTGTGCCTTGTGAG) and PfFRTR (50 -TT CACGGTCGTTGTAGATGG) and PfBTRTF (50 -CTTTCGCCCTGATAA CTTCG) and PfBTRTR (50 -AGGGAACGGTACTGCTGAGA) to amplify LFAH12, PfFAD2 and tubulin respectively. Primer pairs used in RTPCR to amplify P. fendleri actin were PfACTRTF (50 -TTCAAT GTCCCTGCCATGTA) and PfACTRTR (50 -CATGCTGCTAGGTGCAAGAG) and glyceraldehyde-3-phosphate dehydrogenase were PfGDRTF (50 -TTATCATTTCTGCCCCAAGC) and PfGDRTR (50 -TGTAACCCCATTCG TTGTCA). 2.3. Expression of P. fendleri FAD2 in yeast A clone identified by EST sequencing (111H02) encoding a full length putative FAD2 was used as a template for the PCR amplification of the ORF using the primers PfFAD2L (50 -ACAGAATTCTCCCC TACGTTAGCTCCA) and PfFAD2R (50 -CACCTCGAGCACCATGCATC ATCTTCTTCA). The resulting PCR product was cloned into the pGEM-T Easy vector (Promega Corp. Madison, WI, USA), following the manufacturers protocol. The FAD2 ORF was released using restriction enzymes EcoRI and XhoI and cloned into the vector pHVX2 for yeast expression under control of the constitutive promoter PGK1 (Volschenk et al., 1997). Transformation of yeast cells was conducted as described in the manual of the pYES2.1 TOPOÒ TA Expression Kit

116

S. Lozinsky et al. / Plant Physiology and Biochemistry 75 (2014) 114e122

(Invitrogen). Transformants were selected on minimal medium without leucine. For analysis of yeast total cellular fatty acids, cells from 5 mL liquid cultures grown in minimal medium without leucine for 72 h at 28  C were pelleted by centrifugation and resuspended in 2 mL of 3 M HCl in methanol (Supelco, Bellefonte, PA, USA) with 300 mL of hexane in screw top Pyrex tubes. The tubes were tightly capped and heated at 80  C for 2 h. After cooling, 2 mL of 0.9% NaCl was added to each tube and FAMES were recovered by collecting the hexane fraction. FAMES were separated by gas chromatography using an Agilent 6890N GC equipped with a DB-23 capillary column (0.25 mm  30 m, 0.25 mM thickness; J & W; Folsom, Ca, USA) and flame ionization detector. Double bond position of the dienoic fatty acids was determined by GCeMS of fatty acid 4,4-dimethyloxazoline (DMOX) derivatives (Christie, 1998). For fatty acid feeding studies, free fatty acid (Nu-Chek Prep Inc. MN, USA), dissolved in a small volume of ethanol was added to the culture medium to a final concentration of 0.5 mM, prior to incubation. 2.4. Amplification of genomic sequences from Physaria fendleri and Ricinus communis Genomic DNA from developing seeds of P. fendleri and leaves of R. communis (variety 99N891) was prepared using the DNeasy Plant Mini kit (Qiagen) according to the manufacturer’s instructions. To amplify a genomic sequence encompassing the PfFAD2 50 UTR intron, genomic DNA was amplified using the GenomeWalker Universal kit (Clontech, Mountain View, CA, USA) as directed, using BD-advantage polymerase (Clontech), with nested adaptor primer AP2 (50 -ACTATAGGGCACGCGTGGT) and PfFAD2GR3 (50 -TGGC GATGTAGTAGAAGCA) as the gene specific primer for secondary PCR. The resulting PCR product (KC972620) was cloned into the pGEM-T Easy vector and the 50 UTR intron amplified by PCR using primer pair PfFAD2GF1 (50 -AAGGTGCTTCAGCCACACA) and PfFAD2GR3 for comparison to the PfFAD2 cDNA clones. To obtain genomic sequence for PfFAH12, genomic DNA was amplified using the GenomeWalker Universal with nested adaptor primer AP2 and H12GS1A (50 -GGTAACCATTATTCTTCCACCAGCACCCAT) as the gene specific primer for secondary PCR. The resulting PCR product (KC972622) was cloned into the pGEM-T Easy vector for sequencing. To complete the sequencing of the castor FAD2 50 UTR intron, the entire intron was amplified from genomic DNA using primer pairs RcFAD2F (50 -CCGTTCCCTCAGATAGTTAGCTT) and RcFAD2R (50 -C TTAGATGGAGGAGGAACAGACA) and sequenced using primers RcFAD2S4 (50 -ATGGACGTTTGTTTCTGTGAGAT) and RcFAD2S2 (50 -C TATGTGGGGAATGTCCTAAATG). Sequence for the castor CFAH12 50 UTR intron was determined using primers RcNH12F1 (50 -TCAA AATCCTCCTTTAAATCGAA) and RcNH12R2 (50 -TTAAGCAGACATCA TAGGCAACA). 3. Results 3.1. Clarification of nomenclature A recent phylogenetic review of Lesquerella and Physaria has resulted in the merging of the 2 genera (Al-Shehbaz and O’Kane, 2002; Bailey et al., 2006). Some 75 species in the genus Lesquerella were transferred to Physaria and Lesquerella fendleri is now accepted taxonomically as Physaria fendleri. Although the name Lesquerella fendleri remains in widespread use in scientific literature, the sequences of FAD2 family genes identified in this work will be given the prefix Pf for Physaria fendleri. The sequence of the bifunctional oleate 12-hydroxylase/desaturase from Lesquerella fendleri (AF016103), published prior to re-naming (Broun et al., 1998a), is referred to LFAH12.

3.2. Identification and comparison of FAD2-like cDNA clones Annotation of 27675 P. fendleri developing seed ESTs identified 62 clones with sequence similarity to Arabidopsis FAD2. Of these, 59 were identified as encoding the known bifunctional oleate 12hydroxylase/desaturase (LFAH12) and were designated PfFAH12. The remaining 3 ESTs encoded a second FAD2 homologue with higher sequence identity Arabidopsis FAD2. Plasmid sequencing confirmed that three clones (93A03, 166F08, 209C03, NCBI GenBank accession numbers KC972619, KC972618 and KC972617) encoded the full PfFAH12 ORF with additional 50 sequence, and a further three clones (111H02, 159H09 and 303G06) contained full length ORFs encoding the putative FAD2. Bifunctional hydroxylase/ desaturase activity for PfFAH12 was confirmed by expression in yeast (data not shown). As the putative FAD2 cDNAs encoded products identical in amino acid sequence, clone 111H02 was chosen for further analysis (KC972621). The EST, designated PfFAD2, of 1441 bp contained an ORF of 1149 bp. The 382 amino acid deduced amino acid sequence of PfFAD2 shared 93% amino acid identity with Arabidopsis FAD2 and only 84% identity with PfFAH12. As illustrated in Fig. 1, the tripartite histidine rich motif characteristic of FAD2 fold desaturase enzymes (Shanklin and Cahoon, 1998; Sperling et al., 2003) was present in PfFAD2. The amino acid residues reported as being strictly conserved in FAD2 desaturases (Broun et al., 1998b; Mayer et al., 2005), but divergent in hydroxylases, matched those of Arabidopsis FAD2. Both PfFAD2 and PfFAH12 contain the C-terminal aromatic amino acid-rich sequence eFXXKFeCOOH (where F is a large hydrophobic amino acid and X is any amino acid) involved in maintaining protein localization in the endoplasmic reticulum (McCartney et al., 2004). In addition to FAD2 homologues, 3 cDNAs encoding homologues of Arabidopsis tubulin, actin and glyceraldehyde-3-phosphate dehydrogenase proteins were fully sequenced. Clone 194A08 (KC731434) contained a cDNA of 1618 bp, with an ORF of 1350 bp encoding a protein of 450 amino acids. The ORF and deduced amino acid sequence has 93% and 99% identity respectively to Arabidopsis thaliana tubulin beta-2 (TUB2, At5g62690). Clone 118B12 (KC731435) contained a cDNA of 1413 bp, with an ORF of 1131 bp encoding a protein of 377 amino acids. The ORF and deduced amino acid sequence has 93% and 98% identity respectively to A. thaliana actin-7 (ACT7, At5g09810). The third clone, clone 61A11 (KC731436), contained a cDNA of 1310 bp, with an ORF of 1014 bp encoding a protein of 338 amino acids. The ORF and deduced amino acid sequence has 94% and 98% identity respectively to A. thaliana glyceraldehyde-3-phosphate dehydrogenase C subunit (GAPC1, At3g04120). RT-PCR results (Fig. 2a) indicated that all three genes were expressed in leaf and developing seed and would be suitable reference genes for RT-PCR to determine seed/leaf expression. Using tubulin as an expression control (Fig. 2d), RT-PCR was conducted to determine the expression of PfFAH12 and PfFAD2. As shown in Fig. 2bec, expression of PfFAH12 was not detected in leaf, whereas PfFAD2 was expressed in both tissues. 3.3. PfFAD2 encodes a fatty acid desaturase Analysis of FAMES prepared from yeast cells expressing PfFAD2, revealed the presence of three novel fatty acids not present in untransformed yeast (Fig. 3a,b and Table 1). The most abundant of these were identified as 16:2D9,12 and 18:2D9,12 by GCeMS, and accounted for over 38% of the total fatty acids (Table 1). The third peak, with a retention time slightly greater than that of 18:2D9,12 was identified as 18:2D11,14 by GCeMS of its DMOX derivative (Fig. 3c). Very low levels of ricinoleic acid FAME, as determined by GCeMS, were also detected. To determine if the 18:2D11,14 was a

S. Lozinsky et al. / Plant Physiology and Biochemistry 75 (2014) 114e122

117

Fig. 1. Comparison of the deduced amino acid sequences of FAD2 desaturases from Arabidopsis thaliana (AtFAD2, AEE75152), Physaria fendleri (PfFAD2, KC972621), Ricinus communis (RcFAD2, ABK59093) and FAD2 family fatty acid hydroxylases from Physaria fendleri (PfFAH12, KC972619), Physaria lindheimeri (PlFAH12, ABQ01458) and Ricinus communis (CFAH12, EEF34257). Amino acid residues identified as being conserved in FAD2 desaturases, but divergent in hydroxylases (Broun et al., 1998b; Mayer et al., 2005) and marked with an asterisk *. The characteristic C-terminal aromatic amino acid-containing sequence (eFXXKFeCOOH) is indicated (McCartney et al., 2004). Conserved histidine residues are marked^ (Shanklin and Cahoon, 1998; Sperling et al., 2003).

result of PfFAD2 catalyzed desaturation of the 18:1D11 present in yeast, cells were grown in the presence of exogenous 18:1D11(Fig. 4a). Although the supplied 18:1D11 was readily taken up by the cells and accounted for around 23% of total cellular fatty acids, only a slight increase in 18:2D11,14 was seen (Table 1). These

results suggest that 18:2D11,14 is most likely an elongation product of 16:2D9,12 rather that the result of 18:1D11 desaturation. Activity of PfFAD2 on three additional fatty acid substrates was also assessed. Analysis of FAMES prepared from cells grown in the presence of 14:1D9 demonstrated uptake and elongation to 16:1D11, but only a trace amount of 14:2D9,12, tentatively identified by retention time, was observed (Fig. 4b). No evidence of desaturation of 16:1D9 trans (Fig. 4c) or 18:1D9 trans (Fig. 4d) was observed in cells grown in the presence of these fatty acids. 3.4. Identification of 50 UTR introns

Fig. 2. Expression of P. fendleri genes in leaf (L) or developing seed (S), assessed by reverse transcription PCR (RT-PCR). (a) reference genes, TUB (tubulin, PfTUB2, KC731434), ACT (actin, PfACT7, KC731435) and GDH (glyceraldehyde-3-phosphate dehydrogenase, PfGAPC1, KC731436). (b) PfFAD2, (c) PfFAH12, (d) PfTUB2. For (b), (c), (d) the same template cDNA was used for each primer pair with PCR replicates and 28 amplification cycles.

To confirm the presence and estimate the size of the PfFAD2 50 UTR intron, PCR was conducted using primers designed to pair with the 50 end of the longest PfFAD2 clone, and a sequence 208 bp downstream of the initiation codon, giving an expected PCR product of 350 bp with a cDNA template. PCR with genomic DNA as template gave a product of 1470 bp, indicating the presence of a 50 UTR Intron. Sequencing of the PCR product and alignment with the cDNA clones revealed a single intron of 1120 bp with the 30 AG splice site (Mount, 1982) located 5 bp upstream from the translation initiation codon. The PfFAD2 and closely related Arabidopsis FAD2 50 UTR introns show a number of blocks of conserved sequence (Fig. 5). The cDNA clones encoding the full PfFAH12 ORF with additional 50 sequence were aligned with the genomic sequence obtained from P. fendleri. As shown in Fig. 6, an intron of 81 bp was detected in the 50 UTR of the LFAH12 gene, 16 bp upstream of the translation initiation codon. Both the PfFAD2 and PfFAH12 50 UTR introns coding sequences are typically A þ T nucleotide rich (Simpson and Filipowicz, 1996), at 69% and 71% respectively (Table 2). Both also show conserved splice site dinucleotides (50 GT- and 30 -AG), but in common with AtFAD2 show diversity in the 50 splice site adjacent nucleotides, differing from the consensus (50 -C/AAG:GTAAGT, where: indicates the splice site) determined for Arabidopsis (Brown et al., 1996). The location of 50 UTR introns in the castor CFAH12 and FAD2 genes was determined by in-silico examination of available sequence information. The castor genome contains a single copy

118

S. Lozinsky et al. / Plant Physiology and Biochemistry 75 (2014) 114e122

Fig. 3. Gas Chromatogram of FAMES prepared from untransformed yeast (a) and yeast cells expressing PfFAD2 (b). The peak labeled * was identified as ricinoleic acid-FAME (18:1OH). (c) Mass spectrum of the DMOX derivative of 18:2D11,14 from yeast cells expressing PfFAD2.

composition, size and predicted splice sites for the complete 50 UTR introns is given in Table 2. Sequencing confirmed the presence of a single 50 UTR intron in each gene and intron lengths were 2285 bp for CFAH12 and 2978 bp for RcFAD2. Both CFAH12 and RcFAD2 50 UTR introns show conserved splice site dinucleotides (50 GT- and 30 -AG) and are typically A þ T nucleotide rich 80% and 66% respectively.

each of CFAH12 and FAD2. The gene model for the castor oleate 12hydroxylase (CFAH12, NCBI gene ID RCOM_0146820) from the draft castor bean genome assembly (www.plantgdb.org) predicts an intron of approximately 2027 bp in the 50 UTR, 26 bp upstream of the translation start codon. Similarly, the RcFAD2 gene (NCBI gene ID RCOM_0503360) is predicted to contain a 50 UTR intron of approximately 3137 bp, 11 bp upstream of the translation initiation codon. The current castor genome assembly, at 4.6 coverage, is assembled only to the scaffold level and sequencing gaps occur in the 50 UTR regions of both genes. The true length of both putative 50 UTR introns is therefore unknown. To determine the DNA sequence of the missing regions, we used PCR with castor genomic DNA as template and primers designed to amplify the introns and span the missing regions. A comparison of intron nucleotide

4. Discussion Only partial sequences corresponding to the putative Physaria fendleri FAD2 gene have previously been reported (NCBI accession numbers DQ518313, DQ518314, AF016104 and AF016105). Cloning of a full length cDNA and expression in yeast clearly demonstrates, for the first time, that this gene encodes a FAD2 desaturase with

Table 1 Fatty acid composition of total lipids extracted from control yeast and yeast expressing PfFAD2. Samples marked þ18:1D11 were grown in the presence of added 18:1D11. Data is given as average  stddev (n ¼ 4). PUFA is polyunsaturated fatty acid. Fatty acid (%) 16:1D9

16:0 Control þPfFAD2 Control þ18:1D11 þ18:1D11 þ PfFAD2

20.4 20.4 18.5 16.6

   

0.7 0.7 0.1 0.2

35.2 18.2 26.6 12.4

   

0.5 1.1 0.6 0.6

16:2D9,12

18:0

0.0 14.1  1.0 0.0 11.1  0.4

9.5 10.3 8.0 8.8

18:1D9    

0.3 0.5 0.1 0.1

31.8 11.2 23.4 7.7

   

18:1D11 0.6 1.0 0.0 0.1

1.6 0.5 23.6 23.0

   

0.1 0.1 0.5 1.3

18:2D9,12

18:2D11,14

Total PUFA

0.0 24.4  1.2 0.0 19.0  0.1

0.0 1.0  0.1 0.0 1.5  0.1

0.0 39.5  0.6 0.0 31.6  0.4

S. Lozinsky et al. / Plant Physiology and Biochemistry 75 (2014) 114e122

119

Fig. 4. Gas chromatograms of FAMES prepared from untransformed yeast and yeast cells expressing PfFAD2 (þFAD2) in cultures containing added fatty acids. (a) 18:1D11, (b) 14:1D9, (c) 16:1D9 trans and (d) 18:1D9 trans. The peak labeled * was tentatively identified as 14:2, double bond positions could not be unequivocally confirmed by GCeMS due to low abundance.

activity on both 16:1D9 and 18:1D9 with almost no hydroxylase activity. Previous studies have speculated about the function of this gene product, but no evidence of activity was given (Broun et al., 1998a; Chen et al., 2011) and it was not known if this was also a bifunctional enzyme. Compared to data presented for the castor FAD2 (RcFAD2) (Lu et al., 2007), the Physaria FAD2 appears to have considerably greater activity on 16:1 in the yeast expression

system, suggesting less stringent chain length selectivity. Although PfFAD2 and RcFAD2 only share 78% sequence identity, comparison of these proteins may aid in the identification of the molecular basis of chain length selectivity in FAD2 enzymes. Significant desaturase activity on 14:1D9 was not observed for PfFAD2 suggesting that the shorter chain length monounsaturated fatty acid was not a substrate for efficient desaturation. The lack of activity with 16:1D9 trans

Fig. 5. Nucleotide sequences encoding the 50 UTR introns of AtFAD2 and PfFAD2 showing conserved regions.

120

S. Lozinsky et al. / Plant Physiology and Biochemistry 75 (2014) 114e122

Fig. 6. Alignment of genomic (PfFAH12g) and cDNA sequences (50 ends of clones 209C03, 166F08 and 93A03) of PfFAH12 showing the location of the 50 UTR intron (underlined). The translation initiation codon (ATG) is indicated.

and 18:1D9 trans suggests that cis configuration of the D9 double bond is required for activity. Although the analysis of PfFAD2 expression in P. fendleri was restricted to comparison of leaf and developing seed by RT-PCR, it is clear that this gene is expressed in both tissues. A more detailed expression study analyzing both the desaturase and bifunctional hydroxylase/desaturase during seed development has been published previously (Chen et al., 2011). In contrast to observations from castor, where expression of FAD2 is barely detectable in developing seed (Lu et al., 2007), expression patterns in L. fendleri suggest that both PfFAD2 and the bifunctional enzyme contribute to PUFA biosynthesis in this tissue.

The PfFAD2 gene, contains a 50 UTR intron of 1120 bp, similar in size to the 50 UTR introns of A. thaliana FAD2, and the three Camelina sativa FAD2 genes (Kang et al., 2011). These species are the members of the Brassicaceae most closely related to Physaria (Bailey et al., 2006; Al-Shehbaz et al., 2006) for which genome sequence information is currently available. At around 65% sequence identity, the intron is clearly not under the same selection pressure as the ORF, where PfFAD2 and AtFAD2 show 90% nucleotide identity and 93% amino acid identity. The diversity of sequence length of plant FAD2 50 UTR introns suggests that multiple unidentified factors may be involved in the maintenance of this feature. In addition to variation between plants from different families, a study of the

Table 2 Features of the ORF and 50 UTR intron coding regions of FAD2 and divergent FAD2 genes from Arabidopsis thaliana, Physaria fendleri and Ricinus communis.

ORF

50 UTR intron

a b

Length (bp) %T %A Length (bp) %T %A 50 Splice site 30 Splice site 30 Splice site relative to ATG

PfFAD2

PfFAH12

AtFAD2 At3g12120

CFAH12 RCOM_0146820a

RcFAD2 RCOM_0503360b

1146 29 25 1120 43 26 CAG:GTTCGT CAG:A 5

1152 32 25 81 43 28 AAC:GTAAGT CAG:C 16

1149 26 24 1000 42 25 CTG:GTCTCG CAG:A 5

1161 30 23 2285 43 37 CAG:GTATTT TAG:G 25

1149 30 20 2978 39 27 CAG:GTACTT CAG:G 11

GenBank Accession for the corrected sequence is KC972615. GenBank Accession for the corrected sequence is KC972616.

S. Lozinsky et al. / Plant Physiology and Biochemistry 75 (2014) 114e122

FAD2 genes in Gossypium species (cotton) found differences in the rate of evolution, determined by substitution rate, in the FAD2 50 UTR introns of closely related diploid species (Liu et al., 2001). The difference in substitution rate between the FAD2 genes of different genomic origin was also apparent in the allotetrapoid Gossypium species. The divergent FAD2 gene PfFAH12, encoding the bifunctional oleate 12-desaturase/hydroxylase of P. fendleri, also encodes a 50 UTR intron, although at only 81 bp in length, it is shorter than other known FAD2 family 50 UTR introns which range in size from 96 bp to 3150 bp (Kim et al., 2006; Cao et al., 2013). All of the P. fendleri LFAH12 sequences currently in the NCBI database (NCBI accession numbers AF016103, BD078105, FJ904269 and EU797193) are sequences from genomic clones and the occurrence of a 50 UTR intron and has not been previously reported. No significant sequence homology was apparent between the 50 UTR introns of PfFAD2 and PfFAH12 suggesting that the selection pressure maintaining these introns is likely very different. Similarly, the 50 UTR sequences of the R. communis FAD2 and CFAH12 genes are highly divergent in sequence. In earlier work characterizing the LFAH12 promoter (Broun et al., 1998a), the b-glucuronidase (GUS) reporter gene construct used in the study can now be shown to have contained the complete 50 UTR intron in addition to the promoter. As evidenced from the majority of the EST sequences in our study, and from northern blot information published by Broun et al. (1998a), the 50 UTR introns are most likely cleaved in the mature transcript of both PfFAD2 and PfFAH12. The PfFAH12 clone 209C03, in which the intron is still present, could represent a pre-mRNA that became a template for cDNA synthesis during library preparation. The systematic analysis of the 50 UTR intron from the seed specific Sesame indicum FAD2 gene (SeFAD2) identified a variety of potential cis-elements, including motifs known to be seed or endosperm specific expression (Kim et al., 2006). As the RT-PCR analysis of PfFAD2 and PfFAH12 expression, and previous studies (Broun et al., 1998a; Chen et al., 2011) show that these genes are differentially expressed, we conducted a search of the PfFAD2 and PfFAH12 50 UTR sequences for potential cis-regulatory elements using the Signal Scan program (http://www.dna.affrc.go.jp/PLACE/ signalscan.html) (Higo et al., 1999; Prestridge, 1991). Although putative signal sequences were identified, the only motif present in the 50 UTR intron of the seed specific PfFAH12 and not in PfFAD2 was the CURECORCR motif (GTAC), a copper response motif identified in Chlamydomonas reinhardtii (Quinn et al., 2002). Thus it seems likely that the regulatory elements conferring gene specific expression of PfFAH12 reside primarily in the upstream untranscribed sequence. Intron sequences were also examined for the occurrence of the putative IME pentamer CGATT (Parra et al., 2011). This motif occurred once in the PfFAD2 50 UTR intron and was also found in the AtFAD2 and RcFAD2 50 UTR intron, but was not present in the PfFAH12 or CFAH12 50 UTR intron. The regulatory mechanism responsible for seed specific expression and high levels of mRNA accumulation that generally accompany the expression of divergent FAD2 genes, and the role of the 50 UTR introns, remains to be determined. The small size of the PfFAH12 50 UTR intron compared to that present in the castor CFAH12 gene, both of which show seed specific expression, suggests that regulation may perhaps differ in these species. 5. Conclusion The complete sequence of the PfFAD2 gene was determined. Functional characterization by expression in yeast indicates that PfFAD2 is an oleate 12-desaturase. PfFAD2 is expressed in leaf and developing seed. Both PfFAD2 and PfFAH12, encoding a

121

bifunctional oleate 12-hydroxylase/desaturase, contain 50 UTR introns. No sequence homology was observed between these two introns. Acknowledgments The work was conducted with support from the National Research Council Canada, Natural Products Genomics Program (NAPGEN). The authors thank the NRC Saskatoon DNA services, sequencing and bioinformatics teams for sequencing and bioinformatics support, and Drs Patrick Covello and Adrian Cutler for critical review of the manuscript. This is National Research Council of Canada publication number 54684. Contributions SL, HY, LF and GRC performed the research, IRE conducted GCe MS analysis, MAS designed the research, drew figures and drafted the manuscript. All authors reviewed the manuscript. References Al-Shehbaz, I.A., O’Kane Jr., S.L., 2002. Lesquerella is United with Physaria (Brassicaceae). Novon 12, 319e329. Al-Shehbaz, I.A., Beilstein, M.A., Kellogg, E.A., 2006. Systematics and phylogeny of the Brassicaceae (Cruciferae): an overview. Pl. Syst. Evol. 259, 89e120. Bailey, C.D., Koch, M.A., Mayer, M., Mummenhoff, K., O’Kane Jr., S.L., Warwick, S.I., Windham, M.D., Al-Shehbaz, I.A., 2006. Towards a global phylogeny of the Brassicaceae. Mol. Biol. Evol. 23, 2142e2160. Broun, P., Boddupalli, S., Somerville, C., 1998a. A bifunctional oleate 12-hydroxylase: desaturase from Lesquerella fendleri. Plant J. 13, 201e210. Broun, P., Shanklin, J., Whittle, E., Somerville, C., 1998b. Catalytic plasticity of fatty acid modification enzymes underlying chemical diversity of plant lipids. Science 282, 1315e1317. Brown, J.W.S., Smith, P., Simpson, C.G., 1996. Arabidopsis consensus intron sequences. Plant Mol. Biol. 32, 531e535. Brown, A.P., Kroon, J.T.M., Swarbreck, D., Febrer, M., Larson, T.R., Graham, I.A., Caccamo, M., Slabas, A.R., 2012. tissue-specific whole transcriptome sequencing in castor, directed at understanding triacylglycerol lipid biosynthetic pathways. PLOS One 7, e30100. Cao, S., Zhou, X.-J., Wood, C.C., Green, A.G., Singh, S.P., Liu, L., Liu, Q., 2013. A large and functionally diverse family of FAD2 genes in safflower (Carthamus tinctorius L.). BMC Plant Biol. 13, 5. Chan, A.P., Crabtree, J., Zhao, Q., Lorenzi, H., Orvis, J., Puiu, D., Melake-Berhan, A., Jones, K.M., Redman, J., Chen, G., Cahoon, E.B., Gedil, M., Stanke, M., Haas, B.J., Wortman, J.R., Fraser-Liggett, C.M., Ravel, J., Rabinowicz, P.D., 2010. Draft genome sequence of the oilseed species Ricinus communis. Nat. Biotechnol. 28, 951e959. Chen, G.Q., Lin, J.-T., Lu, C., 2011. Hydroxy fatty acid synthesis and lipid gene expression during seed development in Lesquerella fendleri. Ind. Crop. Prod. 34, 1286e1292. Christie, W.W., 1998. Mass spectrometry of fatty acids with methylene-interrupted ene-yne systems. Chem. Phys. Lipids, 35e41. Engeseth, N., Stymne, S., 1996. Desaturation of oxygenated fatty acids in Lesquerella and other oil seeds. Planta 198, 245e283. Hayes, D.G., Kleiman, R., Phillips, B.S., 1995. The triglyceride composition, structure, and presence of estolides in the oils of Lesquerella and related species. J. Am. Oil Chem. Soc. 5, 559e569. Higo, K., Ugawa, Y., Iwamoto, M., Korenaga, T., 1999. Plant cis-acting regulatory DNA elements (PLACE) dataset:1999. Nucl. Acids Res. 27, 297e300. Kang, J., Snapp, A.R., Lu, C., 2011. Identification of three genes encoding microsomal oleate desaturase (FAD2) from the oilseed crop Camelina sativa. Plant Physiol. Biochem. 49, 223e229. Kim, M.J., Kim, H., Shin, J.S., Chung, C.-H., Ohlrogge, J.B., Suh, M.C., 2006. Seedspecific expression of sesame microsomal oleic acid desaturase is controlled by combinatorial properties between negative cis-regulatory elements in the SeFAD2 promoter and enhancers in the 50 -UTR intron. Mol. Gen. Genom. 276, 351e368. Lee, K.-R., Kim, S.H., Go, Y.-S., Jung, S.M., Roh, K.H., Kim, J.-B., Suh, M.-C., Lee, S., Kim, H.U., 2012. Molecular cloning and functional analysis of two FAD2 genes from American grape (Vitis labrusca L.). Gene 509, 189e194. Liu, Q., Brubaker, C.L., Green, A.G., Marshall, D.R., Sharpe, P.J., Singh, S.P., 2001. Evolution of the FAD2-1 fatty acid desaturase 50 UTR intron and the molecular systematic of Gossypium (Malvaceae). Am. J. Bot. 88, 92e102. Lu, C., Wallis, J.G., Browse, J., 2007. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library. BCM Plant Biol. 7, 42.

122

S. Lozinsky et al. / Plant Physiology and Biochemistry 75 (2014) 114e122

Mayer, K.M., McCorkle, S.R., Shanklin, J., 2005. Linking enzyme sequence to function using conserved property difference locator to identify and annotate positions likely to control specific functionality. BMC Bioinforma. 6, 284. McCartney, A.W., Dyer, J.M., Dhanoa, P.K., Kim, P.K., Andrews, D.W., McNew, J.A., Mullen, R.T., 2004. Membrane-bound fatty acid desaturases are inserted cotranslationally into the ER and contain different ER retrieval motifs at their carboxy termini. Plant J. 37, 156e173. Meisel, L., Fonseca, B., Gonzalez, S., Baeza-Yates, R., Cambiazo, V., Campos, R., Gonzalez, M., Orellana, A., Retamales, J., Silva, H., 2005. A rapid and efficient method for purifying high quality total RNA from peaches (Prunus persica) for functional genomic analyses. Biol. Res. 38, 83e88. Moon, H., Smith, M.A., Kunst, L., 2001. A condensing enzyme from the seeds of Lesquerella fendleri that specifically elongates hydroxy fatty acids. Plant Physiol. 127, 1635e1643. Mount, S.M., 1982. A catalogue of splice junction sequences. Nucl. Acids Res. 10, 459e472. Parra, G., Bradnam, K., Rose, A.B., Korf, I., 2011. Comparative and functional analysis of intron-mediated enhancement signals reveals conserved features among plants. Nucl. Acids Res. 39, 5328e5337. Prestridge, D.S., 1991. SIGNAL SCAN: a computer program that scans DNA sequences for eukaryotic transcriptional elements. Comput. Appl. Biosci. 7, 203e206. Quinn, J.M., Eriksson, M., Moseley, J.L., Merchant, S., 2002. Oxygen deficiency responsive gene expression in Chlamydomonas reinhardtii through a coppersensing signal transduction pathway. Plant Physiol. 128, 463e471.

Reed, D.W., Taylor, D.C., Covello, P.S., 1997. Metabolism of hydroxy fatty acids in developing seeds in the genera Lesquerella (Brassicaceae) and Linum (Linaceae). Plant Physiol. 114, 63e68. Salywon, A.M., Dierig, D.A., Rebman, J.P., De-Rodriguez, D.J., 2005. Evaluation of new Lesquerella and Physaria (Brassicaceae) oilseed germplasm. Am. J. Bot. 92, 53e62. Shanklin, J., Cahoon, E.B., 1998. Desaturation and related modification of fatty acids. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 611e641. Simpson, G.G., Filipowicz, W., 1996. Splicing of precursors to mRNA in higher plants: mechanism, regulation and sub-nuclear organization of the spliceosomal machinery. Plant Mol. Biol. 32, 1e41. Sperling, P., Ternes, P., Zank, T.K., Heinz, E., 2003. The evolution of desaturases. Prostagl. Leukot. Essent. Fat. Acids 68, 73e95. van de Loo, F.J., Broun, P., Turner, S., Somerville, C., 1995. An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog. Proc. Natl. Acad. Sci. U S A 92, 6743e6747. Volschenk, H., Viljoen, M., Grobler, J., Petzold, B., Bauer, F., Subden, R.E., Young, R.A., Lonvaud, A., Denayrolles, M., van Vuuren, H.J., 1997. Engineering pathways for malate degradation in Saccharomyces cerevisiae. Nat. Biotechnol. 15, 253e257. Zhang, D., Pirtle, I.L., Park, S.J., Nampaisansuk, M., Neogi, P., Wanjie, S.W., Pirtle, R.M., Chapman, K.D., 2009. Identification and expression of a new delta-12 fatty acid desaturase (FAD2-4) gene in upland cotton and its functional expression in yeast and Arabidopsis thaliana plants. Plant Physiol. Biochem. 47, 462e471.