49

Biochimica et Biophysica Acta, 1132 (1992) 49-57 © 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4781/92/$05.00

BBAEXP 92402

Characterization of a novel promoter structure and its transcriptional regulation of the murine laminin B1 gene Ryusuke Okano, Takashi Mita and Takashi Matsui Department of Molecular Biology, School of Medicine, Unil,ersity of Occupational and Em'ironmental Health, Kitakyushu (Japan) (Received 7 March 1992)

Key words: In vitro transcription; Laminin BI gene; Promoter; Transcription control; (Mouse)

Expression of the laminin B1 gene is known to be induced late during the differentiation of F9 cells by retinoic acid (RA) and dibutyryl cAMP. The involvement of retinoic acid receptors (RARs) has been demonstrated recently in the late induction of laminin B1 gene expression, although the precise regulatory mechanism is not known. In this study, we have reconstituted an efficient in vitro transcription system using F9 nuclear extracts and defined the core promoter structure of the murine laminin B1 gene. The laminin B1 gene was shown to lack a TATA box. The level of the in vitro transcription of the laminin B1 gene was determined by at least three regions between the transcription initiation sites and -100. The most distal region (from - 8 9 to - 69) contained three GC boxes. The second region (from - 62 to 47) contained a direct repeat of TG(C/A)GCA motif. The proximal region (from - 4 5 to - 11) contained another direct repeat of CCTCCCT(C/A)GG motif. A deletion of any one of the three regions respectively decreased the level of transcription to about 20% of wild type DNA. The protein binding analyses revealed that F9 cells contain a factor(s) binding to the TG(C/A)GCA repeat, which was also found in HeLa cells. Together with the observation that the 5' ends of the laminin BI mRNA from the differentiated F9 cells were identical to those from the undifferentiated F9 cells, it was concluded that the three regions identified here constitute the core promoter of the laminin BI gene.

Introduction Retinoic acid (RA), a derivative of vitamin A, plays a key role in cellular growth and differentiation [1,2]. The cellular responses to R A are mediated by two families of nuclear receptors, R A R s (a, /3 and y) and RXR, both of which belong to a superfamily of steroid hormone receptors [3-10]. They act as RA-inducible transcriptional factors to regulate the expression of target genes by binding to specific D N A sequences, termed hormone responsive elements [11,12]. Their distinct spatial-temporal expression patterns during embryogenesis and the differences in affinity to R A have suggested that each R A R subtype plays a major role in RA-induced changes of gene expression [7,8,10,13-16]. The murine F9 cells have been widely used as a model system for cellular differentiation and in some

Correspondence to: T. Matsui, Department of Molecular Biology, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushi 807, Japan. Abbreviations: RA, retinoic acid; RAR, retinoic acid receptor; RARE, retinoic acid responsive element; CAT, chloramphenicol acetyltransferase.

aspects in early embryonic development. F9 cells differentiate into a homogeneous population of primitive endoderm cells in response to R A and further into a population of parietal endoderm cells in the presence of dibutyryl cyclic AMP [17,18]. The RA-induced differentiation of the F9 cells is accompanied by specific changes in gene expression. During the differentiation of F9 cells, several genes such as ERA-1 (Hoxl.6) and RAR-/3 genes are induced within a few hours [19,20], thus classified as 'early' genes. Those inductions are not prevented by protein synthesis inhibitors such as cycloheximide [19,20]. Identification of an element responsive to R A ( R A R E ) within the promoter of the RAR-/3 gene has revealed the involvement of RAR-c~ in the induction of RAR-/3 gene expression [21,22]. It has also been demonstrated that R A R - a negatively regulates the expressions of several genes in embryonal carcinoma cells [23-25]. In contrast to the 'early' genes, several genes are known to be induced at later stages of the differentiation of F9 cells, therefore classified as late genes [2629]. It is not clear, however, whether expression of these late genes is directly regulated by RARs. Among those 'late' genes, the laminin B1 gene, which encodes one of the polypeptides comprising a heteromeric ex-

50 tracellular matrix protein, laminin [30,31], has been shown to contain three R A R E core motifs in the 5' upstream region [32]. Transient expression analysis has demonstrated that the lain-RAREs exert a potent RA-induced transcription activation of the thymidine kinase gene promoter in the presence of exogenously expressed R A R - a , -/3 or -3' [32]. Moreover, in vitro studies have shown the binding of R A R to the IamRAREs, albeit with a weaker affinity than t h e / 3 - R A R E [33]. These observations suggest that R A R s are directly involved in the expression of the laminin B1 gene. On the other hand, it was demonstrated that inhibitors of protein synthesis prevent transcriptional induction of the laminin B1 gene by RA [29]. F9 cells express the RAR-c~ protein at a relatively high level, which remains constant during the differentiation [10,20]. In addition, much evidence was collected which indicates that the functions of R A R s are modulated by interacting, not only with the thyroid hormone receptor [34-36], but also with AP-1 [37-40] or other cell type-specific proteins [41]. Taking this into consideration, it is speculated that besides RARs, some other protein(s) specific in the differentiated F9 cells is involved in the late induction of laminin B1 gene expression. Alternatively, it is also possible that R A R s are involved only in the induction of such a factor(s), implying a hierarchy of steps in the late induction of the laminin B1 gene. To understand the mechanism for the late induction of laminin B1 gene expression in F9 cells, we analyzed the promoter structure of the laminin B1 gene using an in vitro transcription system with F9 nuclear extracts. The results revealed a novel feature of the core promoter structure of the laminin B1 gene. The laminin B1 promoter lacked a T A T A box, but it consisted of at least three regions, a most distal region ( - 8 9 to - 6 9 ) , a region containing a direct repeat of T G ( C / A ) G C A motif ( - 6 2 to - 4 7 ) and a region proximal to the transcription initiation sites ( - 35 to - 11). These three regions were found to be positive elements, as determined by the inactivation of transcription that was resulted from their deletions. It was also demonstrated by protein binding assays that F9 cells contain a factor(s) binding to the T G ( C / A ) G C A repeat within the core promoter. Materials and Methods

Cell culture. F9 cells were obtained from the Japanese Cancer Research Resources Bank and maintained in Eagle's minimal essential medium supplemented with 10% fetal calf serum (Gibco). The cells were seeded at 2- 105/ml every other day and grown at 37°C in a humidified atmosphere of 5% CO 2 in air. Cloning of the upstream region of the laminin B1 gene. To clone the 5' flanking region of the laminin B1 gene, mouse genomic D N A was amplified using the

polymerase chain reaction. The primers used here were a sequence of 5 ' - C C A G A C A G G T T G A C C C T T T T TCTAAGGGCTTAACCTAGCTCACCTC-3' which encompasses the l a m - R A R E [32], and a sequence of 5 '-TTCTTCG GGTCTTCCTTTCAG GAGAGGTG A G C G G G G A G A A A - 3 ' which is located near the 5' end of the laminin B1 e D N A [32]. The amplified D N A fragment (about 660 bp) obtained as a single band was cloned into the Sinai site of pUC19 D N A (pLam0.6). The nucleotide sequence of the cloned D N A was performed by dideoxy method with Sequenase (USB). An identical nucleotide sequence was obtained between two independent clones. Although two ApaI sites were found at +88 and +129, the site at +88 was not digested within the D N A cloned in Escherichia coli HB101 strain because of its base modification. A series of 5' and 3' deletion clones of pLam0.6 D N A were constructed by digesting with exonuclease III and S1 nuclease. Internal deletion clones were constructed by combining appropriate 5' and 3' deletion clones, 5' end analysis of in viL'o laminin B1 mRNA. Total R N A was prepared from F9 cells or F9 cells differentiated by 10 - 6 M R A and 0.5 mM dibutyryl cAMP for 72 h. Poly(A) + R N A was prepared by using oligo(dT) latex (Takara Shuzo Co.). 20/zg of total R N A from the differentiated F9 ceils, or 20 /xg of poly(A) + RNA from F9 ceils was hybridized with a single-stranded FspI-ApaI D N A fragment labeled at the 5' end. SI nuclease protection mapping was carried out as described previously [43].

Preparation of nuclear extracts from F9 cells' and in Lqtro transcription. Nuclear extracts were prepared from about 5 • 10 s of F9 cells as described previously [44]. In vitro transcription and analysis of the product R N A were essentially performed as described previously [43]. Briefly, transcription was carried out in 25 /zl reaction containing 5 / x g / m l each of test D N A and p A d M L [43] as an internal standard DNA, and 1.5 m g / m l proteins of the F9 nuclear extracts. Gel shift assay. Nuclear extracts were incubated with a 5' end-labeled D N A fragment in 10 /zl reaction mixture containing 20 mm H e p e s - N a O H (pH 7.8), 80 mM KC1, 7.5 mM MgCI 2, 15% glycerol and 2 /zg poly(dA-dT)-poly(dA-dT) (Pharmacia). After incubation for 10 min at 23°C, the reaction mixture was directly loaded on a 5% polyacrylamide gel. The gel was dried and autoradiographed on an X-ray film (Kodak AR-5).

DNase I footprinting and methylation interference footprinting analyses. For footprinting experiments, a D N A fragment containing a region from - 116 to +52 was labeled at the 5' end of the upper or the lower strand with polynucleotide kinase and used as a probe. The binding reaction was carried out under the same conditions as the gel shift assay, and followed by diges-

51 tion with 5 / x g / m l of DNase 1 for 1 min at 23°C in the presence of a final concentration of 0.25 mM CaCI 2. The reaction was terminated by an addition of a final concentration of 10 mM EDTA, 1% SDS and 200 /xg/ml of proteinase K followed by an incubation of 60 rain at 37°C. D N A was purified by extracting once with p h e n o l / c h l o r o f o r m and once with chloroform. D N A was then precipitated with ethanol, and dissolved in 80% formamide, 1 mM E D T A and 10 mM NaOH. After heating for 2 min at 90°C, D N A was electrophoresed on a 10% polyacrylamide sequencing gel along with the sequencing ladders. Methylation interference footprinting was performed, essentially as described previously [45] with slight modifications. The same D N A probe as used in DNase I footprinting experiments was methylated with dimethylsulfate as described previously [46]. Binding reaction was carried out on a 10-fold scale of the standard binding reaction. The reaction was directly loaded on a 5% preparative polyacrylamide gel. After electrophoresis, autoradiography was performed on the wet gel. The complexed or free D N A was electroeluted from the gel. The eluate was then applied on a 200 #1 of DEAE-cellulose column to remove solubilized polyacrylamide. After washing extensively the column with a buffer containing 10 mM Tris-HCl (pH 7.5), 1 mM E D T A and 0.2% SDS, the D N A was eluted with the same buffer containing t M NaCI. D N A was purified by extracting once with p h e n o l / c h l o r o f o r m and once with chloroform, and was precipitated with ethanol. D N A was cleaved as described previously [46]. Electrophoresis was performed as described above. Results

Analysis of 5' ends of the laminin B1 mRNA Mapping of the transcription initiation site(s) of the laminin B1 gene was carried out to know whether the same initiation site(s) was used during the differentiation of F9 cells. We analyzed the 5' end(s) of the laminin B1 m R N A by S1 mapping. As shown in Fig. 1, three major protection bands were detected with R N A from the undifferentiated F9 cells. We mapped the 5' end of the longest m R N A as + 1 for the transcription initiation site within the nucleotide sequence as shown in Fig. 2, which is located 90 bp upstream from the 5' end of cDNA, as reported previously [42]. The identical 5' ends were also observed by primer extension analyses (data not shown). After 72 h differentiation of F9 cells by R A and cAMP, the level of laminin B1 m R N A increases by more than 50-fold [28]. The 5' ends of m R N A from the differentiated F9 cells were identical to those from the undifferentiated F9 cells (Fig. 1, lane 2). Since 20/xg of poly(A) + R N A or total R N A was used to detect the laminin B1 m R N A of the undifferentiated or the differentiated F9 cells, respec-

1

3 4 Py Pu

2

m

I

I

G A A G A A A C C C G G C C A C C C

t

i

--g Fig. 1. 5' Ends of the laminin B1 mRNA. 20/xg of poly(A)+ RNA from F9 cells (lane 1) or 20 txg of total RNA from the differentiated F9 cells (lane 2) was hybridized with a single-stranded FspI (-61)Apal (+134) fragment labeled at the 5' end of the ApaI site followed by digestion with S1 nuclease. The hybrid was electrophoresed on a 8% polyacrylamide-5M urea gel. In vitro transcription was carried out in the presence (lane 3) or absence (lane 4) of template laminin B1 DNA. Pu or Py represents the chemically cleaved A+G or T+C sequence latter of the same probe, respectively.

tively, it was indicated that induction of laminin B1 gene expression after differentiation resulted from stimulation of transcription at the same initiation sites. This result suggests that the same core promoter is used for transcription of the laminin B1 gene during differentiation of F9 cells.

Structure of the laminin B1 gene promoter The nucleotide sequence analysis revealed that the laminin B1 gene lacks a typical T A T A box 30 bp upstream from the transcription initiation sites (Fig. 2). Several sequence motifs known as regulatory elements were found between the initiation sites and the R A R E s identified previously [32], including an AP-1 binding

52 site at - 3 6 3 , a C A T box at - 188, an AP-2 binding site at - 138 and three G C boxes between - 6 8 and - 8 9 . Besides, two direct repeats of T G ( C / A ) G C A and CCTCCCT(C/A)GG were found between - 1 1 and - 6 2 . The region encompassing three G C boxes also showed a perfect direct repeat of C C T C C G C C C motif. When the promoter activity of the cloned laminin B1 D N A fused with a bacterial chloramphenicol acetyltransferase gene (CAT) was initially analyzed in F9 cells in transient expression assays, almost no CAT activity was detected in the absence of R A (data not shown). To identify the core promoter of the laminin B1 gene, we therefore tried to reconstitute an in vitro transcription system using the F9 cell nuclear extracts. At the initial stage of this work, we detected only a minimal level of transcription of the laminin B1 gene in vitro. However, when 10 mM ammonium sulfate was added to the transcription reaction supplemented with 40 mM KC1, a high level of transcription of the laminin B1 gene was observed as shown in Fig. 3. The level of transcription of the adenovirus major late gene also increased in proportion to the concentration of ammo-

nium sulfate. Although the effect of ammonium sulfate on the major late transcription was substituted with the optimal concentration of KCI (80 raM), the transcription efficiency of the laminin B1 gene changed only slightly at the optimal concentration of KC1 (60 mM). Therefore, ammonium sulfate appears to be required for the efficient transcription of the laminin B1 gene in vitro, but not of the major late gene. The in vitro transcription of the laminin B1 gene initiated at four major sites, three of which were the same as in vivo (Fig. 1), indicating that the F9 nuclear extracts directed an accurate initiation of transcription. We next constructed a series of 5' deletion mutant DNAs and analyzed the effects of those deletions on transcriptional efficiency by S1 nuclease mapping. To avoid the fluctuation in the efficiency of transcription reconstitution, the level of transcription of the laminin B1 gene relative to that of the major late gene was determined in each assay. The results obtained from such experiments are shown and summarized in Fig. 4. Any deletions of the sequences upstream from - 9 3 , and deletion of one of the three G C boxes (to - 8 3 )

-460

CCAGACAGGT~-~-~CTTTTTCTAAGGGCT~-~'~TAGC F GGTCTGTCC~ACTGGpAAAAAGATTCCCG~ATTG~ATCC~ -42o

CAC~TCCCTCTAGCGCTAGTTGCCAGAGTTCCTAGCCTTGGGCACATTTC~CTTCTTATAAAC GT~.~_~AGGGAGATCGCGATCAACGGTCTCAAGGATCGGAACCCGTGTAAAGgACTGAGT~AAGAATATTTG -350 GTAAATGTATAAGTCCGCGGTAGGTCCTACCGGCCCCCTTTGCCGGCCGATCTACACACCTACCTCCGGG CATTTACATATTCAGGCGCCATCCAGGATGGCCGGGGGAAACGGCCGGCTAGATGTGTGGATGGAGGCCC -280

ACCAGCCCCGACGCATCCCTCCCCAGCTTGCTCCACTTGGGAAGCGCGCCCAGAAACGGACCCGCCAGCC TGGTCGGGGCTGCGTAGGGAGGGGTCGAACGAGGTGAACCCTTCGCGCGGGTCTTTGCCTGGGCGGTCGG -210 CACGTGGGAACTCAAGT~CCCTACAGCTTCAGCAGACGCTGCCTTAAAACAAAAGAGG¢CCTG GTGCACCCTTGAGTTCA~GGTT~CGGGATGTCGAAGTCGTCTGCGACGGAATTTTGTTTTCTCC~CGGAC -14o

-12o

-1oo

-8o

GGC~AGGTGGGACCTGGACCTCAACCCCCACCCCTAGCCAACTTGCTGTCCTCCGCCCCCTCCGCCCCCGC

CCC~TCCACCCTGGACCTGGAGTTGGGGGTGGGGATCGGTTGAACGACAGGAGGCGG~GGAGGCGG~GGCG

-70 -5O -3O -IO TCTCCATGTGCGCATGAGCAGAGACGCCTCCCTCGGTTCCTCCCTAGGCGAAACTTTCTAATTCCCTTCT AGAGGTACACGCGTACTCGTCTCTGCGGAGGGAGCCAAGGAGGGATCCGCTTTGAAAGATTAAGGGAAGA

+I +20 +40 +60 TTGGGCCGGTGGGCTGCCAGGAGCGGGTTGAGCGCTCGCCCAGCCGGGTGAGGAGAACAAAGTAGTTAAG AACCCGGCCACCCGACGGTCCTCGCCCAACTCGCGAGCGGGTCGGCCCACTCCTCTTGTTTCATCAATTC +71 ¥ CGACTTGACCCCCTTCCTGGGCCCAGCCCCCGCTTCCGTGGGAGCGGCAGGAAATGGAAGGGCCCCTCTC GCTGAACTGGGGGAAGGACCCGGGTCGGGGGCGAAGGCACCCTCGCCGTCCTTTACCTTCCCGGGGAGAG +141 CTCTCTCCCAACATTTGCCTTTTCTCCCCGCTACCTCTCCTGAAAGGAAGACCCGAAGAA GAGAGAGGGTTGTAAACGGAAAAGAGGGGCGATGGAGAGGACTTTCCTTCTGGGCTTCTT Fig. 2. Nucleotide sequence of the PCR-cloned laminin B1 DNA. Several known regulatory elements are boxed. The three direct repeats are indicated by arrows ( ---, ). In vivo ( $ ) and in vitro (I") transcription initiation sites are indicated by arrows. The 5' end of the laminin BI eDNA reported previously [42] is also indicated by an arrowhead. The primers used in the polymerase chain reaction are shown by over- and underlines, respectively.

53 did not affect the level of t r a n s c r i p t i o n (lanes 1 to 6). However, w h e n all t h r e e G C boxes w e r e d e l e t e d (to -70), the t r a n s c r i p t i o n d e c r e a s e d to a b o u t 20% of the wild type (lane 7). This t r a n s c r i p t i o n level was maint a i n e d on a D N A d e l e t i n g a n o t h e r 7 b p from - 7 0 . F u r t h e r d e l e t i o n to - 4 7 c a u s e d almost c o m p l e t e inactivation of the t r a n s c r i p t i o n (lanes 8 a n d 9). T h e s e results i n d i c a t e that the two distinct regions from - 8 3 to - 7 0 a n d f r o m - 6 2 to - 4 7 a r e n e c e s s a r y for the m a x i m a l level of t r a n s c r i p t i o n a n d that the s e q u e n c e d o w n s t r e a m from - 6 2 is c a p a b l e of p r o m o t i n g the m i n i m a l level of t r a n s c r i p t i o n in vitro. F o r f u r t h e r analysis of the p r o m o t e r structure, several i n t e r n a l d e l e t i o n D N A s w e r e c o n s t r u c t e d a n d the levels of t r a n s c r i p t i o n w e r e analyzed. I n t e r n a l d e l e t i o n of the s e q u e n c e b e t w e e n - 3 8 7 a n d - 9 3 did not c h a n g e the level of t r a n s c r i p t i o n (lane 10). W h e n the s e q u e n c e b e t w e e n - 1 6 0 and - 6 3 was d e l e t e d , the level of t r a n s c r i p t i o n d e c r e a s e d to a b o u t 20% of that of the wild type D N A (lane 11), which is consistent with the result o b t a i n e d with a 5' d e l e t i o n D N A lacking t h r e e G C boxes. In c o n t r a s t to the a b s e n c e of t r a n s c r i p t i o n on D N A d e l e t i n g the s e q u e n c e u p s t r e a m from - 4 7 , a low level of t r a n s c r i p t i o n ( a b o u t 20% of the wild type D N A ) was o b s e r v e d on D N A i n t e r n a l l y d e l e t i n g the s e q u e n c e b e t w e e n - 6 1 and - 4 7 ( c o m p a r e lanes 8 a n d 12). T h e s a m e level of t r a n s c r i p t i o n a l d e c r e a s e was

MI

2

3

4

5

147 122 110 90

Lam Lam Lam

ML

76 Fig. 3. Effect of ammonium sulfate on in vitro transcription. An increasing amount of ammonium sulfate was added to the reaction containing 40 mM KCI (lane 1, 0 mM; lane 2, 2.5 raM; lane 3, 5.0 mM; lane 4, 10 mM; lane 5, 15 mM). The transcripts were purified and analyzed by $1 mapping as described in Fig. 1. For detection of the major late transcripts, the BstNI-DdeI fragment labeled at the 5' end was used as a probe, which produces a 83 nt protection band, pBR322 DNA digested with HpalI was labeled at the 5' ends and used as a size maker (lane M).

1

2

3

4 5 6 7 8

RAREs ALP-!

9 M 1011121314

Core 2 C/U~T AP-2 Core3 Core1 Txn(%)

WT

-380 -223 -182 -93 -83 -70

-63 -47 -11 A 387//93 A 160/63 A 71/63 A 54/47 A61/47 A 71/47 A 35/11

100

98 1 05 95 97 1 O0 18 20 ND

NO 110 22 93 19 23 89 17

Fig. 4. Transcription of the laminin B1 gene from various mutant DNAs. (Upper) Transcription was carried out in the presence of 10 mM ammonium sulfate and 40 mM KCI. Lane 1, wild type DNA; lane 2, -380 DNA; lane 3, -223 DNA; lane 4, - 182 DNA; lane 5, - 93 DNA; lane 6, - 83 DNA; lane 7, - 70 DNA; lane 8, - 47 DNA; lane 9, -11 DNA; lane 10, A387/93 DNA, lane 11, -4160/63 DNA; lane 12, -461/47 DNA; lane 13, A71/47 DNA; lane 14, A35/11 DNA. (Lower) The amount of the laminin BI gene transcript was determined by using Fujix Image Analyzer BAS2000 and normalized by estimation of the amount of the major late gene transcript. The relative amount of transcript from each DNA was estimated by calculating the amount of transcripts of the wild type DNA (100%). ND: not detected.

o b s e r v e d also on a D N A d e l e t i n g the s e q u e n c e bet w e e n - 5 4 a n d - 4 7 . T h e s e results s u g g e s t e d that t h e s e q u e n c e d o w n s t r e a m f r o m - 4 6 could direct the initiation o f t r a n s c r i p t i o n in the p r e s e n c e of the G C box region. In fact, d e l e t i o n of the s e q u e n c e b e t w e e n - 3 5 and - 1 1 c a u s e d a t r a n s c r i p t i o n a l d e c r e a s e to a b o u t 20% o f the wild type D N A (lane 14). A n e x c e p t i o n was o b s e r v e d on a D N A d e l e t i n g the s e q u e n c e b e t w e e n - 7 1 a n d - 4 7 . T r a n s c r i p t i o n on this D N A o c c u r r e d with almost the s a m e efficiency as on t h e wild type D N A (lane 13), a l t h o u g h it is not known at p r e s e n t why this D N A r e t a i n e d the m a x i m a l level of the t e m p l a t e activity. In the e x p e r i m e n t s shown above, n u c l e a r extracts from the u n d i f f e r e n t i a t e d F9 cells w e r e u s e d for in vitro t r a n s c r i p t i o n reactions. W e e x a m i n e d w h e t h e r the s e q u e n c e d o w n s t r e a m from - 9 2 could p r o m o t e an e n h a n c e d level of t r a n s c r i p t i o n in r e a c t i o n s s u p p l e m e n t e d with the d i f f e r e n t i a t e d F9 n u c l e a r extracts. T h e s a m e level o f t r a n s c r i p t i o n , however, was o b s e r v e d irrespective of the source o f the n u c l e a r extracts ( d a t a

54 not shown). Thus, it appeared that the sequence downstream from - 9 2 alone does not confer differentiation-specific enhancement of transcription of the laminin B1 gene. Taking this into consideration, it was suggested that the core promoter of the laminin B1 gene is constituted from the three regions: a region containing three G C boxes between - 8 9 and - 6 9 (core 3), a region containing direct repeats between - 6 2 and - 4 7 (core 2) and a proximal region between - 3 5 and - 11 (core 1), and that any two of them could promote a minimal level of transcription.

Lower

P u PY

-

Upper

+

+

-

Py Pu

-,oo- !i~i~il fill .... -90

~' I

- 'i!i~i~i~!~

- -20

ii;iiil -8O-i'~i~!~i~i~ ~_

ii~ii!i~

- -40

-70---64 -60-

Presence of a factor(s) binding to the core 2 region Judging from its nucleotide sequence and the ability of transcriptional activation, the region between - 8 9 and - 6 5 was initially expected to function as the binding sites for Spl. To examine this possibility, gel mobility shift assays were carried out using various D N A fragments as shown in Fig. 5. One major shift band was observed with a D N A fragment containing

-50 -

-48

- -70

-40 -

-3o

i!~i!!!

1 2 3 4

5 6 7

8

-64

9 1011

-80

-20 . . . . . Fig. 6. DNase 1 footprinting analysis. The binding reaction was carried out in the presence ( + ) or absence ( - ) of F9 nuclear extracts. Electrophoresis on a sequencing gel was performed along with the chemically cleaved A + G (Pu) and T + C (Py) sequence ladders from the same probe as used in the binding reactions. The positions of apparent protein contacts are indicated.

~ ii ~ ' ~ i ~ ~

~5

~ ~ ~ i ~ ~ ~ ~i i~ ~ ,~ i~i ~

Fig. 5. Gel shift analysis of protein binding to the laminin BI DNA. DNA fragments containing various regions were labeled at their 5' ends and incubated without (lane 8) or with undifferentiated F9 (lanes 1-7 and 9), differentiated F9 (lane 10) or HeLa (lane 11) nuclear extracts. The reactions were directly run on a polyacrylamide gel as described in Materials and Methods. Lanes l and 8-11, - 9 2 to +135; lane 2, - 6 2 to +135; lane 3, - 4 6 to +135; lane 4, - 1 0 to + 135; lane 5, - 1 9 4 to - 7 2 ; lane 6, - 1 9 4 to - 3 6 ; lane 7, - 194 to +18.

the sequence between - 9 2 to +135, which was observed even with a D N A fragment deleting the three G C boxes (lanes 1 and 2). In contrast, the complex formation did not occur with a D N A deleting the upstream sequence from - 4 6 (lane 3). To determine the 3' border of the binding site, the effect of 3 ~ deletion on binding was also analyzed. The complex formation occurred with D N A fragments containing the sequences upstream from - 3 6 , but not with DNAs deleting the sequences downstream from - 7 2 (lanes 5 to 7). The complex observed in these assays was competed out specifically with D N A which contained only the sequence between - 6 2 and - 3 6 (data not shown). The binding activity appeared to exist ubiquitously in a variety of cell types, since a similar activity was detected in the differentiated F9 and also in H e L a nuclear extracts (lanes 9 to ll). To precisely identify the sequence bound with protein, we next carried out DNase I footprinting analysis as shown in Fig. 6. The region from - 64 to - 48 of the lower strand was protected from digestion with DNase I. Similarly, a protection of the region from - 6 4 to - 4 6 was observed on the upper strand. However, no protection was observed on the three G C boxes rang-

55 Lower

Upper

PuPY

C

F C

-2o-m

N

F

Py Pu

-80

....

-3o~

-4o-

--50

-

....

S

? ~'

-60G -58G

~,

-52G

D.

~

-70

-

~-

.......

.........

......

• -55G

-60-

--60

-50

•-61G

-40

-70 -

.....

20

Fig. 7. Methylation interference footprinting analysis. Methylation interference footprinting was carried out as described in Materials and Methods. The probe used was the same as in DNase I footprinting experiment (Fig. 6). Pu or Py represents the chemically cleaved A + G or T + C sequence ladder of the same probe, respectively. F or C represents the free or the complex D N A on a preparative gel, respectively. The positions of the guanine residues of which methylation interfered with binding of the protein are indicated.

ing from - 9 2 to - 6 8 , which was consistent with the results obtained with gel shift assays. Methylation interference footprinting analyses showed that methylation of the guanine at - 61 or - 55 of the lower strand, and at - 6 0 , - 5 8 or - 5 5 of the upper strand interfered with the binding of protein (Fig. 7). Along with the result of the gel shift assays, it was concluded that a ubiquitous factor(s) binds to the direct repeat of T G ( C / A ) G C A motif essential for transcription of the laminin B1 gene. Discussion

Laminin, an extracellular matrix protein, is expressed ubiquitously in various cell types and influences cell adhesion, growth, morphology, differentiation and migration [30]. Laminin molecules are composed of three polypeptide chains, designated A, B1 and B2. Expression of B1 chain is induced at two-cell

stage of mouse embryo. It is also known that during in vitro differentiation of the mouse embryonal carcinoma F9 cells, expression of the laminin B1 gene is stimulated by more than 50-fold at 30-48 h after the addition of RA and cAMP. This increase is shown to be controlled at the transcriptional level [28]. Recent studies have suggested the involvement of RAR(s) in the late induction of laminin B1 gene expression [32,33], while the precise regulatory mechanism is not known. In the present work, we reconstituted an in vitro transcription system using F9 nuclear extracts. In this system, F9 nuclear extracts directed an accurate initiation of transcription of the laminin B1 gene. The in vitro transcription of the laminin B1 gene occurred as efficient as that of the major late gene, although the in vitro transcription of these two genes showed different optima for salt requirement. The efficient in vitro transcription of the laminin B1 gene required 10 mM ammonium sulfate, but not in the case of the major late gene. We have previously observed the similar salt requirement for the in vitro transcription of the adenovirus IVa2 gene which also lacks a T A T A box (Ref. 47, and our unpublished data). It thus appears that the requirement of ammonium sulfate is a common feature of the in vitro transcription of non-TATA box genes. Deletion analyses revealed that any known regulatory elements localized upstream from - 1 0 0 , such as four core motifs of RARE, an AP-1 binding site, an AP-2 binding site and a CAAT box, were not required for transcription in vitro under the conditions so far studied. Instead, three regions between the initiation sites and - 100 were shown to be required for efficient transcription in vitro: first, the most distal region containing three GC boxes (core 3), second, the middle region containing a direct repeat of T G ( C / A ) G C A motif (core 2), and third, the most proximal region from - 3 5 to - 1 1 (core 1). Deletion of any one of these cores decreased the transcription level to about 20% of the wild type DNA. In other words, any two of them could direct an accurate initiation of transcription in vitro. The core 3 appears to function as a GC box element according to its sequence. However, as shown in Figs. 5 and 6, no apparent binding was observed in the GC boxes of the laminin B1 gene. Under the identical conditions, the same batches of the F9 nuclear extracts could bind to the GC boxes of SV40 early promoter (data not shown). At present, it is not known whether the GC boxes of the laminin B1 gene bind Spl or Spl-like protein with lower affinity compared to those of the SV40, or whether this region functions as a different sequence element, since a perfect direct repeat of CCTCGCCC motif was found within the region. The core 2 element ( T G ( C / A ) G C A repeat) was shown to bind an ubiquitous factor(s) present in both

56 F9 and H e L a cells. The protein binding interfered with methylation of the guanine residues within either half of the repeat. Consistently, the deletion of half of the repeat decreased transcription to the same level as deletion of the entire repeat. These result suggested that the repetition of the motifs is essential for the protein binding and thus for the promoter activity. The third region was localized proximal to the transcription initiation sites. A D N A deleting the sequence between - 3 5 and - 1 1 (core 1) retained its template activity at the same level as a D N A deleting the core 3 or core 2 region. Surprisingly, the transcription initiation on the D N A deleting the core 1 region occurred at the same site as on the wild type DNA. As described above, the murine laminin B1 gene does not contain a T A T A box within the promoter. It is thought that the T A T A box is an intrinsic element in determining the site of transcription initiation. Thus, it is of interest to know which sequence element(s) determines the site of initiation of the transcription on the laminin B1 gene. If such a sequence element is localized upstream from the initiation sites, deletion of any sequences downstream from the element should lead to a shift of the initiation site proportionally to the length of deletion. A direct repeat of the C C T C C C T ( C / A ) G G motif was found between - 4 3 and - 2 5 . Reduction of 17 bp in length (deletion of 25 bp from - 3 5 to - 11 and insertion of 8 bp derived during the ligation) allowed the 5' half of the repeat to be located to the site where the 3' half of the repeat was originally located. Therefore, it is possible that the C C T C C C T ( C / A ) G G motif determines the initiation sites of transcription. The decrease in the transcription level by deletion of half of the repeat might indicate a requirement of the repeat for the full promoter activity. Obviously, it is also possible that the sequence around the initiation sites is required for determining the initiation sites. More detailed analyses will be necessary to identify how a n o n - T A T A box promoter determines the site of initiation transcription. Together with the observation that in vivo enhanced transcription in the differentiated F9 cells initiates at the same sites as in the undifferentiated F9 cells, the results obtained fro,,l t~,c, in -'itr~ transcription and protein binding experiments suggested that the core promoter of the laminin B1 gene is constituted from at least the three regions between - 9 2 and - 1 1 , and that it directs not only constitutive transcription in the undifferentiated F9 cells but also enhanced transcription in the differentiated F9 cells in concert with the other unidentified regulatory element(s). Finally, it should be noted that in spite of the presence of the factor binding to the T G ( C / A ) G C A repeat, H e L a nuclear extracts inefficiently directed the initiation of in vitro transcription of the laminin B1 gene. Moreover, in transient expression assays, the

core promoter linked to the lain-RAREs was not activated by RA in H e L a cells even in the presence of exogenously expressed R A R - a , while it was activated in F9 cells (data not shown). These observations suggest that unlike in F9 cells, the core promoter of the laminin B1 gene is inactive in H e L a cells. It is not known at present whether some factor(s) essential for the basal transcriptional apparatus is absent in HeLa cells, or whether a repressor inactivating the core promoter activity is prescnt in H e L a cells. Several lines of evidence have indicated that the upstream activators such as Spl and VP16 interact with the basal transcriptional apparatus through a coactivator (also termed modulator or adaptor) [3,48-50]. It is, therefore, of importance to know how the core promoter activity is inactivated in H e L a cells. This line of work might lead to the finding of a new aspect of transcriptional regulation that a core promoter is regulated in a cell-type specific manner.

Acknowledgments We thank H. Saiga and M. Nomoto for helpful s and C. Kitashiro for technical assistance. We also thank Y. Kitagawa for providing us the laminin B1 cDNA. This work was supported in part by Grants-in-aid for Research for Priority Areas from the Ministry of Education, Science and Culture, Japan.

References 1 Maden, M. (1982) Nature 295, 672 675. 2 Roberts, A.B. and Sporn, M.B. (1984) in The Retinoids (Sporn, M.B., Roberts, A.B. and Goodman, D.S., eds.), pp. 209-286, Academic press, New York. 3 Berger, S.L., Cress, W.D., Cress, A., Triezenberg, S.J. and Guarente, L. (19911) Cell 61, 1199-1208. 4 Brand, N., Petkovich, M., Krust, A., Chambon, P., De Thd, H., Marchio, A., Tiollais, P. and Dejean, A. (1988) Nature 332, 850-853. 5 Gigubre, V., Ong, E.S., Segui, P. and Evans, R.M. (19871 Nature 330, 624-629. 6 Gigu~re, V., Shago, M., Zirngible, R., Tare, P., Rossant, J. and Vamuza, S. (1990) Mol. Cell. Biol. 10, 2335 2340. 7 Krust, A., Kastner, P., Petkovich, M., Zelent, A. and Chambon, P. 91989) Proc. Natl. Acad. Sci. USA 86, 5311/-5314. 8 Mangelsdorf, D.J., Ong, E.S., Dyck, J.A. and Evans, R.M. (19911) Nature 345,224-229. 9 Petkovich, M., Brand, N.J., Krust, A. and Chambon, P. (19871 Nature 3311, 444 450. 10 Zelent, A., Krust, A., Petkovich, M., Kastner, P. and Chambon, P. (19891 Nature 339, 714-717. 1l Evans, R.M. (19881 Science 240, 889-895. 12 Green, S.. and Chambon, P. 119881 Trends Genet. 4, 309-314. 13 Benbrook, D., Lernhardt, E. and Pfahl, M. 11988) Nature 333, 669 572. 14 De Th6, H., Marchio, A., Tiollais, P. and Dejean, A. (1989) EMBO J. 8, 429-433. 15 Doll~, P., Ruberte, E., Leroy, P., Morriss-Kay, G. and Chambon, P. (19901 Development 110, 1133-1151. 16 Mangelsdorf, D.J., Umesono, K., Kliewer, S.A., Borgmeyer, U., Ong, E.S. and Evans, R.M. (1991) Cell 66, 555-561.

57 17 Strickland, S. and Mahdavi, V. (1978) Cell 15, 393-403. 18 Strickland, S., Smith, K.K. and Marotti, K.R. (1980) Cell 21, 347-355. 19 LaRosa, G.J. and Gudas, L.J. (1988) Proc. Natl. Acad. Sci. USA 85, 329-333. 20 Martin, C.A., Ziegler, L.M. and Napoli, J.L. (19901 Proc. Natl. Acad. Sci. USA 87, 4804-4808. 21 De Th6, H., Del Mar Vivanco-Ruiz, M., Tiollais, P., Stunnenberg, H. and Dejean, A. (1990) Nature 343, 177-180. 22 Sucov, H.M., Murakami, K.K. and Evans, R.M. (1990) Proc. Natl. Acad. Sci. USA 87, 5392-5396. 23 Hosler, B.A., LaRosa, G.J., Grippo, J.F. and Gudas, L.J. (1989) Mol. Cell. Biol. 9, 5623-5629. 24 Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M. and Hamada, H. (1990) Cell 60, 461-472. 25 Okazawa, H., Okamoto, K., Ishini, F., Ishino-Kaneko, T., Takeda, S,, Toyoda, Y., Muramatsu, M. and Hamada, H. (1991) EMBO J. 10, 2997-3005. 26 Breier, G., Bucan, M., Francke, U., Colberg-Poley, A.M. and Gruss, P. (1986) EMBO J. 5, 2209-2215. 27 Simeone, A., Acampora, D., Arcioni, L., Andrews, P.W., Boncinelli, E. and Mavilio, F. (1990) Nature 346, 763-766. 28 Wang, S., LaRosa, G.J. and Gudas, L.J. (19851 Dev. Biol. 107, 75-86. 29 Wang, S. and Gudas, L.J. (1988) J. Cell. Phys. 136, 305-311. 30 Timpl, R. and Dziadek, M. (1986) Int. Rev. Exp. Path. 29, 1-112. 31 Timpl, R. (1989) Eur. J. Biochem. 180, 487-502. 32 Vasios, G.W., Gold, J.D., Petkovich, M., Chambon, P. and Gudas, L.J. (1989) Proc. Natl. Acad. Sci. USA 86, 9099-9103. 33 Vasios, G.W., Mader, S., Gold, J.D., Leid, M., Lutz, Y., Gaub, M.-P., Chambon, P. and Gudas, L.J. (1991) EMBO J. 10, 11491158.

34 Glass, C.K., Lipkin, S.M., Devary, O.V. and Rosenfeld, M.G. (19891 Cell 59, 697-708. 35 Graupner, G., Wills, K.N., Tzukerman, M., Zhang, X.-K. and Pfahl, M. (19891 Nature 340, 653-656. 36 Lucas, P.C., Forman, B.M., Samuels, H.H. and Granner, D.K. (1991) Mol. Cell. Biol. 11, 5164-5170. 37 Nicholson, R.C., Mad'er, S., Nagpal, S., Leid, M., Rochette-Egly, C. and Chambon, P. (1990) EMBO J. 9, 4443-4454. 38 Schiile, R., Umesono, K., Mangelsdorf, D.J., Bolado, J., Pike, J. and Evans, R.M. (1990) Cell 61,497-51/4. 39 Schiile, R., Rangarajan, P., Yang, N., Kliewer, S., Ransone, L.J., Bolado, J., Verma, I.M. and Evans, R.M. (199l) Proc. Natl. Acad. Sci. USA 88, 6092-6096. 411 Schiile, R. and Evans, R.M. (19911 Trends Genet. 7, 377-381. 41 Glass, C.K., Devary, O.V. and Rosenfeld, M.G. (19901 Cell 63, 729-738. 42 Sasaki, M., Kato, S., Kohno, K., Martin, G. and Yamada, Y. (1987) Proc. Natl. Acad. Sci. USA 84, 935-939. 43 Matsui, T. (19871 Mol. Cell. Biol. 7, 1401-1408. 44 Dignam, J.D., Lebovitz, R.M. and Roeder, R.G. (19831 Nucleic Acids Res. 11, 1475-1489. 45 Pfeifer, K., Arcangioli, B. and Guarente, L. (1987) Cell 49, 9-18. 46 Maxam, A.M. and Gilbert, W. (1980) Methods Enzymol. 65, 449-5611. 47 Matsui, T. (19821 Nucleic Acids Res. 10, 7089-71(11. 48 Kelleher, R.J., Flanagan, P.M. and Kornberg, R.D. (19901 Cell 61, 1209-1215. 49 Lewin, B. (1990) Cell 61, 1161-1164. 50 Pugh, B.F. and Tjian, R. (1990) Cell 61, 1187-1197.