International Journal of Biological Macromolecules 70 (2014) 482–489
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Characterization of a highly thermostable glycoside hydrolase family 10 xylanase from Malbranchea cinnamomea Guangsen Fan a , Shaoqing Yang a , Qiaojuan Yan b , Yu Guo a , Yanxiao Li a , Zhengqiang Jiang a,∗ a College of Food Science and Nutritional Engineering, Beijing Key Laboratory of Functional Food from Plant Resources, China Agricultural University, Beijing 100083, China b Bioresource Utilization Laboratory, College of Engineering, China Agricultural University, Beijing 100083, China
a r t i c l e
i n f o
Article history: Received 17 March 2014 Received in revised form 6 July 2014 Accepted 7 July 2014 Available online 21 July 2014 Keywords: Thermostable xylanase M. cinnamomea Xylooligosaccharides
a b s t r a c t A thermostable xylanase (McXyn10) from the thermophilic fungus Malbranchea cinnamomea strain S168 was purified and biochemically characterized. The enzyme was purified to homogeneity with a molecular mass of 43.5 kDa on SDS–PAGE. The optimal pH and temperature of the purified enzyme were pH 6.5 and 80 ◦ C, respectively. The enzyme showed a broad range of pH stability (pH 4.0–10.5), and was stable up to 70 ◦ C with a thermal denaturing half life of 76.0 min. The enzyme exhibited strict specificity for various xylans as substrates, but displayed no activity toward other tested polysaccharides. McXyn10 hydrolyzed birchwood xylan, beechwood xylan and oat-spelt xylan, yielded mainly xylobiose, xylotriose and xylooligosaccharides with degree of polymerization (DP) above 5, while yielded xylobiose from xylotriose and xylotetraose. The xylanase gene was further cloned. It had an open reading frame of 1191 bp with two introns. The deduced amino acid sequence of the gene showed highest identity (58%) with a glycoside hydrolase family 10 xylanase from Aureobasidium pullulans. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Xylanases (EC 3.2.1.8) randomly catalyze the cleavage of -1,4xylcosidic bonds in xylan—the second most abundant renewable resource in nature [1]. Xylanases have garnered much attention in recent years due to their great potential for industrial applications, such as in producing functional xylooligosaccharides from hemicelluloses, improving the nutritional properties of animal feedstuffs containing agricultural residues, converting biomass to ethanol, improving the quality of bread in the baking industry, clarifying fruit and vegetable juices, and reducing the environmental pollution caused by the paper and pulp industry [1–3]. In general, the availability of xylanases for industrial applications is restricted by their poor stability or low relative activity at higher temperatures or pH values. Thermostable xylanases offer a great advantage in catalytic procedures: the reaction can be performed at higher temperatures, thereby improving reaction rate, increasing productivity, decreasing the amount of enzyme needed and avoiding microbial contamination, toward increased technical and economical availability of the process [4]. Thermophilic fungi
∗ Corresponding author. Tel.: +86 10 62737689; fax: +86 10 82388508. E-mail address: [email protected] (Z. Jiang). http://dx.doi.org/10.1016/j.ijbiomac.2014.07.025 0141-8130/© 2014 Elsevier B.V. All rights reserved.
have attracted much attention due to their potential as sources of thermostable lignocellulose-degrading enzymes [5]. To date, some thermostable xylanases have been purified and characterized from thermophilic fungi such as Achaetomium sp. [6], Chaetomium sp. [7], Paecilomyces thermophila [8] and Rhizomucor miehei [9]. However, the only reports on the production, purification and characterization of xylanases from thermophilic Malbranchea species address two species, Malbranchea flava [2] and Malbranchea pulchella var. sulfurea [10]. Malbranchea cinnamomea strain S168 is a newly isolated thermophilic fungus shown to produce a novel multifunctional ␣amylase [11]. Furthermore, it was found to secrete multiple forms of extracellular xylanases into the fermentation broth (data not published). Here we report the purification and biochemical characterization of a thermostable xylanase from M. cinnamomea strain S168 and its gene sequence. 2. Material and methods 2.1. Chemicals Birchwood xylan, beechwood xylan, oat-spelt xylan, lichenan, Avicel, carboxymethylcellulose (CMC, low viscosity), locust bean gum, para-nitrophenyl (pNP)--d-xylopyranoside,
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
483
pNP--d-glucopyranoside, pNP--d-fucopyranoside and pNP--dgalactopyranoside were purchased from Sigma Chemical Company (St. Louis, MO). Q-Sepharose Fast Flow (QSFF) resin was purchased from Pharmacia (Uppsala, Sweden). Sephacryl S-100 was obtained from GE Life Sciences (Chalfont St. Giles, Buckinghamshire, UK). All other chemicals were of analytical grade unless otherwise specified.
approximately 2–3 ml, and then loaded onto a Sephacryl S-100 column (1 × 100 cm) equilibrated with 20 mM phosphate buffer (pH 7.0) with 100 mM NaCl, and the proteins were eluted with the same buffer at a flow rate of 0.3 ml/min. The fractions with xylanase activity were checked for purity by SDS–PAGE.
2.2. Strain and enzyme production
SDS–PAGE was performed as described by Laemmli [15] on a 12.5% separating gel with 4.0% stacking gel. Protein bands were visualized by staining with Coomassie brilliant blue R-250. The protein standards (TaKaRa) used for molecular-mass calibration were phosphorylase b (97.2 kDa), albumin (66.4 kDa), ovalbumin (44.3 kDa), carbonic anhydrase (29.0 kDa), trypsin inhibitor (20.1 kDa) and ␣-lactalbumin (14.3 kDa). Active staining was carried out according to the method of Han et al. [11]. The native molecular mass of the purified xylanase was estimated by gel filtration on a Superdex-75 column (1 × 40 cm) using 50 mM phosphate buffer (pH 7.2) with 100 mM NaCl. The proteins were eluted at a flow rate of 0.33 ml/min. The molecularmass standards used were albumin bovine V (68.0 kDa), albumin egg (44.3 kDa), chymotrypsinogen ␣ (25.6 kDa) and cytochrome c (12.4 kDa).
The M. cinnamomea strain S168 used in the present study was deposited in the China General Microbiological Culture Collection Center (CGMSS) under accession no. 6022. The strain was maintained on potato dextrose agar (PDA) and transferred every 6–7 weeks. Enzyme was produced by solid-state fermentation (SSF). The solid-state medium was prepared by mixing 5 g wheat bran (0.45–0.9 mm) and 20 ml basal medium solution in a 250-ml Erlenmeyer flask. The basal medium solution consisted of (g/l): 1 KH2 PO4 , 2.5 NaCl, 0.5 MgSO4 ·7H2 O, 1 (NH4 )2 SO4 and 0.5 CaCl2 , and the pH was adjusted to 7.0. Spores were prepared by washing a PDA plate covered with 5-day-old mycelium with 20% (v/v) sterile glycerin solution, and the spore concentration was counted by hemocytometer. M. cinnamomea strain S168 spores (1 × 106 ) were added to the medium in a 250-ml Erlenmeyer flask, thoroughly mixed and incubated at 45 ◦ C for 5 days. For enzyme extraction, 50 ml of 50 mM phosphate buffer (pH 7.0) was added to the flask which was then shaken (200 rpm) at 30 ◦ C for 2 h. The debris was removed by centrifugation at 10,000 × g for 10 min, and the supernatant was used as the crude enzyme for the following experiments. 2.3. Enzyme assay and protein determination Xylanase activity was assayed according to the method of Bailey et al. [12] with slight modifications. Suitably diluted enzyme solution (0.1 ml) was added to 0.9 ml birchwood xylan substrate (1%, w/v) dissolved in 50 mM pH 7.0 phosphate buffer. The mixture was incubated at 50 ◦ C for 10 min, and then the amount of reducing sugar released was determined by the 3,5-dinitrosalicylic acid (DNS) method [13]. One unit (U) of enzyme activity was defined as the amount of enzyme required to release 1 mol reducing sugars per minute under the above conditions with xylose as the standard. Specific activity was expressed in units per milligram protein. Protein concentration was estimated by the Lowry method using BSA as the standard [14]. 2.4. Enzyme purification Unless otherwise stated, all purification steps were carried out at 4 ◦ C, and flow rates were adjusted to 1.0 ml/min. The crude enzyme (3 l) was first fractionated by 60–80% saturated ammonium sulfate precipitation. The precipitate was collected, dissolved in 20 mM Tris–HCl buffer pH 9.0 (buffer A), and dialyzed against the same buffer for 12 h (the dialyzing buffer was changed every 4 h). The dialyzed enzyme was loaded onto a QSFF column (1 × 10 cm) equilibrated with buffer A containing 100 mM NaCl (buffer B). After washing with buffer B, the bound proteins were eluted with a 100–300 mM gradient of NaCl in buffer A. The fractions with xylanase activity were combined and dialyzed against 20 mM acetic acid buffer pH 4.5 (buffer C) for 12 h (the dialyzing buffer was changed every 4 h). Then the dialyzed sample was loaded onto a QSFF column (1 × 10 cm) equilibrated with buffer C. The bound proteins were eluted with 75 mM NaCl in buffer C to a constant base line, followed by a gradient elution of 75–150 mM NaCl in buffer C. The active fractions were collected and concentrated to
2.5. SDS–PAGE and molecular-mass determination
2.6. Protein identification by internal peptide sequences To determine the purified xylanase’s partial amino acid sequence, the Coomassie-stained protein bands were excised from the SDS–polyacrylamide gel, digested by trypsin, and then submitted to the National Center of Biomedical Analysis (Beijing, China) for amino acid sequencing of the internal peptides using HPLC-ESI-MS/MS. Mass spectral sequencing was performed on a Q-TOF II mass analyzer (Micromass Ltd., Manchester, UK). Peptide sequencing was performed using a palladium-coated borosilicate electrospray needle (Protana, Denmark). The raw data were analyzed by software PLGS2.4 (Waters, Milford, MA), and MS/MS Ion search was performed using Masscot (Matrix science, London). 2.7. Enzymatic properties of the purified xylanase The optimal pH was determined by measuring the enzyme’s activity at 50 ◦ C in different buffers with pH ranging from 3.0 to 12.0. The buffers used were: 50 mM citrate–Na2 HPO4 (pH 3.0–6.0), 3(N-morpholino)propanesulfonic acid (MOPS; pH 6.5–7.5), Tris–HCl (pH 8.0–9.0), 2-(cyclohexylamino) ethanesulfonic acid (CHES; pH 9.5–10.0), (cyclohexylamino)-1-propanesulfonic acid (CAPS; pH 10.5–11.0) and NaH2 PO4 –NaOH (pH 11.5–12.0). To determine its pH stability, the enzyme was incubated in the above buffers at 50 ◦ C for 30 min, and then residual xylanase activity was measured. The effect of temperature on the enzyme’s activity was determined by assaying its activity at different temperatures (30–90 ◦ C) in 50 mM MOPS buffer (pH 6.5). To determine its thermostability, the enzyme was incubated at different temperatures (30–90 ◦ C) in 50 mM MOPS buffer (pH 6.5) for 30 min, and then the retained activity was measured. To determine thermal denaturing half life, the enzyme was incubated at 65 ◦ C and 70 ◦ C for 4 h each, samples were withdrawn at different times, and residual activity was determined according to the standard assay. 2.8. Substrate specificity and kinetic parameters Substrate specificities were studied by measuring enzyme activity in the presence of various natural polysaccharides and pNPglycosides as substrates. For the various polysaccharides, 0.1 ml of suitably diluted enzyme solution (about 5 g/ml) was added to 0.9 ml substrate solution (1%, w/v) dissolved in 50 mM MOPS (pH
484
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
6.5), and incubated at 80 ◦ C for 10 min. The amount of released reducing sugars was measured by the DNS method [13]. For the different pNP-glycosides, 50 l of suitably diluted enzyme solution was added to 200 l pNP-glycoside solution (5 mM) dissolved in 50 mM MOPS (pH 6.5), and incubated at 80 ◦ C for 10 min. The amount of formed pNP was determined by spectrophotometry at 405 nm. One unit of enzyme activity was defined as the amount of enzyme required to produce 1 mol reducing sugars or pNP per minute under the above assay conditions. Specific activities were expressed as units per milligram protein. To determine the kinetic parameters, the hydrolysis reaction was carried out at 80 ◦ C for 5 min using different substrate concentrations (3.5–11 mg/ml birchwood xylan, 1.6–5.6 mg/ml beechwood xylan or 0.8–2.8 mg/ml oat spelt xylan) in 50 mM MOPS, pH 6.5. The kinetic parameters Km and Vmax were estimated by none linear regression using a “GraFit” software.
Fig. 1. SDS–PAGE and zymogram analysis of xylanase (McXyn10) purified from M. cinnamomea. Lane M, low-MW protein markers; lane 1, crude enzyme; lane 2 ammonium sulfate precipitation; lane 3, after QSFF column (pH 9.0 Tris–HCl); lane 4, after QSFF column (pH 4.5 acetate buffer); lane 5, after Sephacryl S-100 column.
2.9. Hydrolytic properties of the purified xylanase To investigate the hydrolytic properties of the enzyme, 5 U of purified enzyme was added to 1 ml of 1% (w/v) of the various xylans or xylooligosaccharides dissolved in 50 mM MOPS (pH 6.5) and incubated at 50 ◦ C for 12 h. The hydrolysis products were analyzed by TLC method. Aliquots withdrawn at different times during the hydrolysis were spotted on a silica gel Plate 60F 254 (Merck, Darmstadt, Germany). The plate was developed with two runs in a butanol:acetic acid:water (2:1:1, v/v) solvent system. After spraying with methanol:sulfuric acid (95:5, v/v) solvent, the sugars on the plate were visualized by heating for a few minutes in an oven set at 130 ◦ C. A mixture consisting of xylose (X1 ), xylobiose (X2 ), xylotriose (X3 ), xylotetraose (X4 ) and xylopentaose (X5 ) was used as the standard. 2.10. Cloning and sequence analysis of a xylanase gene from M. cinnamomea DNA manipulations were performed according to the techniques described by Sambrook and Russell [16]. To clone the xylanase gene (termed McXyn10), M. cinnamomea genomic DNA was used as the template, and the degenerate primers Xyn40DF (5 CCGGCGGCGACGTAGTNGCNAA3 ) and Xyn40DR (5 GCGTGCTCCAGGTTGTAGTCRTTRTARTA3 , R = A/T/C/G, N = A/G) were designed according to the conserved sequences of GGDWVVAN and YYNDYNIEHA, respectively, derived from the purified xylanase by MS using the CODEHOP algorithm. PCR conditions were as follows: a hot start at 94 ◦ C for 5 min, 30 cycles of 94 ◦ C for 30 s, 58 ◦ C for 30 s and 72 ◦ C for 1 min. The PCR product was purified, ligated to the pMDl8-T vector and sequenced. The full-length cDNA sequence of McXyn10 was obtained by assembling 5 and 3 gene sequences. The 3 -terminal sequence was obtained by rapid amplification of cDNA ends (RACE) using a SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA). The PCR conditions for RACE were: 94 ◦ C for 5 min, 30 cycles of 94 ◦ C for 30 s, 60 ◦ C for 30 s, and 72 ◦ C for 1 min, and finally at 72 ◦ C for 10 min. The primers used for the nested PCR were designed based on the partial gene sequences obtained above. The first nested PCR was performed with the primer pair Xyn40-3 GSP (5 TTCAGACGGAAACTTCGACAATGC3 ) and Nested Universal Primer A mix (BD Biosciences, Clontech). The second nested PCR was performed using the primer pair Xyn40-3 NGSP (5 TAATGGAGAACCACATCACCCAAACC3 ) and Nested Universal Primer A mix, with the products of the first nested PCR (diluted 100-fold) as the template. The obtained PCR products were purified, cloned and sequenced. The 5 sequence was obtained by hiTAIL-PCR according to the method of Liu and Chen [17]. The specific upstream Xyn40USP1 (5 CAATGAGATGCCCCTGTAAGCCAA3 ), primers
Xyn40USP2 (5 TACGCTGAGCACCAGTGGCTTTTG3 ) and Xyn40USP3 (5 CGCTTCACCAATGGTCCGGTAGAA3 ) were designed on the basis of the gene sequence obtained above. The obtained PCR products were purified, ligated to pMDl8-T vector and sequenced. The full-length xylanase gene was amplified from the genomic DNA of M. cinnamomea by PCR, using the specific primers Xyn40kDEF (5 CTAGCTAGCAATGGGTTGAGTGCTCGC3 ) and Xyn40kDER (5 CCCAAGCTTTCACAAGCACTGCCAGTACCA3 , restriction sites incorporated into the primers are underlined). The PCR conditions were: 94 ◦ C for 5 min, 30 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s, and 72 ◦ C for 1.5 min, and finally at 72 ◦ C for 10 min. The amplified PCR product of the DNA was purified and cloned into the pMD18-T vector, transformed into Escherichia coli Trans 5␣ for sequencing, and subjected to BLAST analysis. Nucleotide and deduced amino acid sequences were analyzed with the ExPASy Proteomics tools (http://www.expasy.ch/tools/). Open reading frame (ORF) analysis was performed using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Signal peptide was analyzed using the Signal P 4.0 server (http://www.cbs.dtu.dk/services/SignaIP). Introns were identified using the software DNAman6.0. The amino acid sequence alignment was performed using the ClustalW program.
3. Results 3.1. Xylanase production and purification The highest xylanase activity of 1139 U/g dry substrate was obtained by solid-state fermentation, after 5 days of cultivation using wheat bran as the carbon source. A xylanase was purified to homogeneity from the crude enzyme extract (Fig. 1) with a purification fold of 5.9 (Table 1). The molecular mass of the denatured enzyme was estimated to be 43.5 kDa by SDS–PAGE (Fig. 1), and the native molecular mass was determined to be 40.5 kDa by gelfiltration chromatography, indicating that the purified xylanase is a monomer. The enzyme was designated McXyn10. Amino acid sequences of eight internal peptide fragments of McXyn10 were obtained: peptide I (AADPDAK), peptide II (LQQQATDYASVVSA), peptide III (LSDSAY), peptide IV (GGDVVAN), peptide V (HWDVVNEALNED), peptide VI (TIGEAYIPIAFK), peptide VII (DSVFYR) and peptide VIII (YYNDYNIEH). All of the internal peptides were compared to other fungal xylanases by NCBI-BLAST. The sequences of peptides I, V, VI and VII derived from McXyn10 showed 100% identity with some fungal glycoside hydrolase (GH) family 10 xylanases. However, the sequence of peptide III and IV did not display any significant similarity with other xylanases (data not shown).
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
485
Table 1 Purification summary of the xylanase (McXyn10) from M. cinnamomea. Purification step
Total activity (U)a
Protein (mg)b
Specific activity (U/mg)
Purification factor (fold)
Activity recovery (%)
Crude supernatant (NH4 )2 SO4 precipitation QSFF (pH 9.0) QSFF (pH 4.5) S-100
337,865.9 19,951.6 2050.6 1025 938.8
3833.0 743.1 18.1 2.0 1.8
88.1 26.8 113.3 512.5 521.6
1 0.3 1.3 5.8 5.9
100 5.91 0.61 0.30 0.28
a b
The enzyme was determined in 50 mM MOPS buffer (pH 6.5) at 50 ◦ C for 10 min using DNS [13] method. Protein concentration was estimated by the Lowry method [14].
3.2. Effect of pH and temperature on enzyme activity and stability The optimal pH for McXyn10 activity was determined to be 6.5 (Fig. 2a). The enzyme exhibited excellent stability within the pH range of 4.0–10.5 (Fig. 2b). McXyn10 activity was optimal at 80 ◦ C (Fig. 3a). The enzyme was stable up to 70 ◦ C (Fig. 3b). The thermal denaturing half lives of McXyn10 at 65 ◦ C and 70 ◦ C were 137.2 min and 76.0 min, respectively (data not shown).
birchwood xylan (879.9 U/mg, 100%), but exhibited no activity on the other tested natural polysaccharides such as Avicel, CMC, locust bean gum and lichenan, or the pNP-glycosides such as pNP--d-glucopyranoside, pNP--d-fucopyranoside and pNP-d-galactopyranoside. However trace activity was detected with pNP--xylopyranoside. The kinetic parameters Km and Vmax of McXyn10 for birchwood xylan, beechwood xylan and oat-spelt xylan are reported in Table 2.
3.3. Substrate specificity and kinetic parameters
3.4. Hydrolytic properties of the purified xylanase
McXyn10 was most active on oat-spelt xylan (1478.2 U/mg, 168%) followed by beechwood xylan (1027.7 U/mg, 116.8%) and
The action patterns of McXyn10 on different xylans and xylooligosaccharides were further studied. McXyn10 hydrolyzed birchwood xylan and beechwood xylan to yield mainly X2 , X3 , X5
Fig. 2. Optimal pH (a) and pH stability (b) of xylanase (McXyn10) purified from M. cinnamomea. The optimal pH was determined by measuring the enzyme activity at 50 ◦ C in different buffers (50 mM) from pH 3.0 to 12.0. Buffers used were citrate-Na2 HPO4 (pH 3.0–6.0), MOPS (pH 6.5–7.5), Tris–HCl (pH 8.0–9.0), CHES (pH 9.5–10.0), CAPS (pH 10.5–11.0) and NaH2 PO4 –NaOH (pH 11.5–12.0). pH stability was determined by incubating the enzyme in the above buffers at 50 ◦ C for 30 min, and then measuring the residual enzyme activity in 50 mM MOPS (pH 6.5) at 50 ◦ C by standard assay. The highest enzyme activity was used as 100%.
Fig. 3. Optimal temperature (a) and thermostability (b) of xylanase (McXyn10) purified from M. cinnamomea. The optimal temperature was determined by measuring enzyme activity at different temperatures (30–90 ◦ C) in 50 mM MOPS (pH 6.5). Thermal stability was determined by measuring residual activity after the enzyme had been incubated at different temperatures (30–90 ◦ C) for 30 min. The highest enzyme activity was used as 100%.
486
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
Table 2 Kinetic parameters of McXyn10 purified from M. cinnamomeaa . Substrates
Vmax (mol/min/mg)
Km (mg/ml)
kcat (s−1 )
kcat /Km (ml/mg/s)
Birchwood xylan Beechwood xylan Oat-spelt xylan
5878.2 ± 159.5 5763.7 ± 225.8 6322.8 ± 226.4
7.1 ± 0.4 3.0 ± 0.26 1.5 ± 0.12
4.26 4.18 4.58
0.60 1.39 3.06
a The kinetic parameters were determined by measuring the enzyme’s activities with various substrate concentrations in 50 mM MOPS buffer (pH 6.5) at 80 ◦ C for 5 min.
and X6 after 12 h of hydrolysis (Fig. 4a and b). For the hydrolysis of oat-spelt xylan, McXyn10 first released X2 and X3 as the predominant products and a small amount of other xylooligosaccharides (X4 –X6 ), and then the intermediate products were ultimately converted to X2 and X3 (Fig. 4c). With respect to hydrolysis of the various xylooligosaccharides, McXyn10 did not show any activity on X2 , but efficiently hydrolyzed X3 and X4 , with X2 as the predominant end product (Fig. 4d).
amino acids, and contains two introns (80 bp and 68 bp) (Fig. 5). The mature protein has a predicted molecular mass of 40 kDa and a theoretical pI of 4.37. The N-terminal region of the deduced protein contains a predicted 19-amino acid signal peptide. The gene sequence has been submitted to the GenBank database, accession no. KF572027. Amino acid sequence alignment of McXyn10 (M. c. KF572027) revealed the highest sequence identity of 58% with a GH family 10 xylanase from Aureobasidium pullulans ATCC 20524 (A. p. BAE71410, [18], Fig. 6). It also displayed relative high sequence identities with some other reported GH family 10 xylanases, including those from Penicillium funiculosum (P. f. CAG25554, 57%, [19]), Agaricus bisporus (A. b. O60206, 56%, [20]), Fusarium oxysporum (F. o. 3U7B A, 56%, [21]) and Phanerochaete chrysosporium (P. c. AEK97220, 56%, [22]) (Fig. 6), suggesting that the obtained McXyn10 is a novel member of GH family 10 xylanases. In addition, all the sequences of eight peptides derived by MS spectrum from McXyn10 were found in the deduced amino acid sequence of the cloned xylanase gene, confirming that the obtained xylanase gene is just the McXyn10 encoding gene.
3.5. Gene cloning and sequence analysis of McXyn10 4. Discussion The xylanase gene (McXyn10) with a full length of 1652 bp was cloned from M. cinnamomea by PCR. There were two nontranslated regions (of 103 bp and 210 bp) at the 5 and 3 terminuses of the gene, respectively. McXyn10 has an ORF of 1191 bp, encoding 396
Thermostable xylanases from thermophilic fungi have gathered much attention due to their specific biochemical properties, which are useful for various industrial applications [23]. The genus
Fig. 4. Hydrolytic properties of xylanase (McXyn10) purified from M. cinnamomea on various xylans and xylooligosaccharides. The reactions were performed by incubating 5 U/ml enzyme with 1% (w/v) birchwood xylan (a), beechwood xylan (b), oat-spelt xylan (c), and xylobiose, xylotriose and xylotetraose (d) at 50 ◦ C for 12 h. Samples withdrawn at different times were inactivated by boiling at 100 ◦ C for 10 min and analyzed by TLC. The numbers indicated in the figures are incubation time (h).
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
487
Fig. 5. Nucleotide and deduced amino acid sequences of the xylanase gene (McXyn10) from M. cinnamomea. Two intron sequences are shown in lowercase letters, and those in the cDNA sequences are shown in uppercase letters. The translation-initiation codon (ATG) and termination codon (TGA) are boxed in frame, and the termination codon is also marked by an asterisk (*). A putative signal peptide is underlined. The sequences matching the peptide sequences determined by MS are shaded in gray. The nucleotide sequence has been submitted to Genbank under accession no. KF572027.
Malbranchea is a promising producer of xylanolytic enzymes, as it has been reported to produce multiple isoforms of xylanases [2,5]. In the present study, we report the purification, biochemical characterization and gene cloning of a novel thermostable xylanase (McXyn10) from the thermophilic fungus M. cinnamomea strain S168. The purified xylanase McXyn10 is a monomer with a molecular mass of 43.5 kDa (Fig. 1). Most microbial xylanases are singlesubunit proteins with molecular masses ranging from 8 kDa to 145 kDa [24]. Among them, GH family 10 xylanases have relatively high molecular masses (>30 kDa) [18]. Another Malbranchea
species, M. flava, was previously reported to secrete two low-MW xylanases, MFX I and MFX II, with molecular masses of 25.2 kDa and 30.0 kDa, respectively [2]. The molecular mass of McXyn10 is similar to that of some GH family 10 xylanases [18,20,22,25–28]. Moreover, McXyn10 displayed highest sequence identity (58%) with a GH family 10 xylanase from A. pullulans ATCC 20524 (Fig. 6). Thus, the present xylanase can be considered a novel GH family 10 xylanase. In general, microbial xylanases are most active in a neutral or weakly acidic pH range (4.0–7.0) and stable within a broad pH range (3.0–10.0, [29]). McXyn10 showed optimal activity at pH 6.5
488
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
Fig. 6. Sequence alignment of McXyn10 from M. cinnamomea (M. c. KF572027) with other GH family 10 xylanases. Numbers on the left are the residue numbers of the first amino acid in each line. Listed sequences include the xylanases from A. pullulans ATCC 20524 (A. p. BAE71410, 58%), P. funiculosum (P. f. CAG25554, 57%), A. bisporus (A. b. O60206, 56%), F. oxysporum (F. o. 3U7B A, 56%) and P. chrysosporium (P. c. AEK97220, 56%).
(Fig. 2), similar to that of most other reported fungal xylanases, such as those from Fusarium graminearum [26], Humicola insolens [30], and P. thermophila [8]. However, the present xylanase exhibited a wider range of pH stability (pH 4.0–10.5) than most of the other fungal xylanases [9,25,27,31]. An optimal temperature of 80 ◦ C was found for McXyn10 (Fig. 3), which is a little higher than that of the thermostable xylanases from some other thermophilic fungi, including Achaetomium sp. (75 ◦ C, [6]), Acremonium cellulolyticus (75 ◦ C, [28]), P. thermophila (75 ◦ C, [8]), R. miehei 3169 (75 ◦ C, [9]), and Thermoascus aurantiacus miehe (75 ◦ C, [5]), and quite a bit higher than that of most mesophilic fungal xylanases, such as those from F. graminearum (45 ◦ C, [26]), Aspergillus usamii E001 (50 ◦ C,
[27]), Aspergillus niger (50 ◦ C, [31]), Schizophyllum commune (50 ◦ C, [32]), Aspergillus awamori (50–55 ◦ C, [25]), Penicillium sclerotiorum (xylanase I, 50 ◦ C, xylanase II, 55 ◦ C, [33]), Chaetomium sp. (65 ◦ C, [7]) and M. flava (70 ◦ C, [2]). To the best of our knowledge, the optimum temperature of McXyn10 (80 ◦ C) represents a high value for fungal xylanases, second only to that of a xylanase from Aspergillus fumigatus MKU1 (90 ◦ C, [34]). Thermostability is an important prerequisite for commercialization and industrial applications, as the use of thermostable enzymes at relative high temperatures can accelerate reactions, prevent microbial contamination and reduce production costs. The influence of different metal ions and agents on the enzyme’s activity was also investigated.
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
McXyn10 showed strict substrate specificity. It only acted on various xylans, but exhibited no activity on other tested natural polysaccharide substrates, such as CMC and cellulose (data not shown); this behavior is similar to that of xylanases from Chaetomium sp. [7] and P. sclerotiorum [33]. In contrast, some other xylanases exhibit relatively broader substrate specificities. For example, the xylanase MFX II from M. flava showed hydrolytic activity toward lichenan [2], a xylanase from a halophilic bacterium hydrolyzed CMC [35], a compost metagenomic libraryderived xylanase exhibited hydrolyzing activity toward CMC, starch, lichenan and pectin [36], and a xylanase from Trichoderma reesei favored hydrolysis of rhodymenan, a soluble linear -1,3-1,4-xylan [37]. Cellulase-free xylanases are preferred in the paper and pulp industry as cellulase activity can result in cellulose loss, pulp-quality degradation, and increases in effluent treatment costs [23]. Since McXyn10 was stable over a wide pH range, and had a high optimum temperature, good thermostability and cellulasefree activity, it could potentially be used in the paper and pulp industry for bio-bleaching. The Km values of McXyn10 are in agreement with those of other fungal xylanases, which range from 0.1 to 40.9 mg/ml [1]. The enzyme showed the highest activity against oat-spelt xylan, followed by beehwood xylan and birchwood xylan (data not shown). Similarly, xylanases I and II from P. sclerotiorum exhibit higher affinities for oat-spelt xylan [33]. The purified McXyn10 hydrolyzed various xylans but with different modes of action. McXyn10 hydrolyzed birchwood xylan and beechwood xylan to release mainly X2 , X3 , X5 and xylooligosaccharides with a degree of polymerization above 5 (Fig. 4a and b). However, McXyn10 hydrolyzed oat-spelt xylan to yield X2 and X3 as the end products (Fig. 4c). The hydrolytic properties of McXyn10 are different from those of MFX I and MFX II from M. flava, which released X4 from the tested xylan substrates [2]. In fact, the hydrolytic properties of McXyn10 differ from those of most other reported fungal xylanases, such as the xylanase from P. thermophila which hydrolyzes beechwood xylan to yield mainly X2 and X3 [8], and the P. sclerotiorum xylanase which releases X2 , X3 and X4 as the major products from oat-spelt xylan [33]. Unexpectedly, the products of McXyn10 hydrolysis of birchwood xylan were similar to those of a GH family 11 xylanase from P. chrysosporium, but different from a GH family 10 xylanase from the same strain [22]. Furthermore, McXyn10 hydrolyzed X3 and X4 to X2 as the major end product without formation of the corresponding amount of X1 , and could barely hydrolyze X2 (Fig. 4d), indicating that the enzyme is an endo-type xylanase and may possess transglycosylation activity. 5. Conclusions A novel GH family 10 xylanase (McXyn10) from a thermophilic fungus, M. cinnamomea S168 was purification and biochemically characterized. The enzyme was purified to homogeneity with a molecular mass of 43.5 kDa. It was most active at pH 6.5 and exhibited a wide range of pH stability (pH 4.0–10.5). The optimal temperature of the enzyme was high up to 80 ◦ C. McXyn10 hydrolyzed various xylans to yield mainly xylooligosaccharides with trace amount of xylose. Thus, McXyn10 would be a useful candidate for the production of xylooligosaccharides. In addition, the
489
xylanase encoding gene was further cloned from M. cinnamomea S168 and sequenced. Acknowledgments This work was supported by the National Science Fund for Distinguished Young Scholars (No. 31325021) and the National High Technology Research and Development Program of China (863 Program, No. 2011AA100905). References [1] Q.K. Beg, M. Kapoor, L. Mahajan, G.S. Hoondal, Appl. Microbiol. Biotechnol. 56 (2001) 326–338. [2] M. Sharma, B.S. Chadha, H.S. Saini, Bioresour. Technol. 101 (2010) 8834–8842. [3] P. Falck, S. Precha-Atsawanan, C. Grey, P. Immerzeel, H. Stalbrand, J. Agric. Food Chem. 61 (2013) 7333–7340. [4] R. Da Silva, E.S. Lago, C.W. Merheb, E.M.M. Macchion, Y.K. Park, E. Gomes, Braz. J. Microbiol. 36 (2005) 235–241. [5] S.K. Ghatora, B.S. Chadha, A.K. Badhan, H.S. Saini, M.K. Bhat, BioResources 1 (2006) 18–33. [6] L. Zhao, K. Meng, P. Shi, Y. Bai, H. Luo, H. Huang, Y. Wang, P. Yang, B. Yao, Process Biochem. 48 (2013) 1879–1885. [7] Z.Q. Jiang, Q.Q. Cong, Q.J. Yan, N. Kumar, X.D. Du, Food Chem. 120 (2010) 457–462. [8] M. Zhang, Z.Q. Jiang, S.Q. Yang, C.W. Hua, L.T. Li, Bioresour. Technol. 101 (2010) 688–695. [9] E.M. Fawzi, Acta. Biol. Hung. 62 (2011) 85–94. [10] M.T. Matsuo, Agric. Biol. Chem. 49 (1985) 839–841. [11] P. Han, P. Zhou, S.Q. Hu, S.Q. Yang, Q.J. Yan, Z.Q. Jiang, Appl. Biochem. Biotechnol. 170 (2013) 420–435. [12] M.J. Bailey, P. Biely, K. Poutanen, J. Biotechnol. 23 (1992) 257–270. [13] G.L. Miller, Anal. Chem. 31 (1959) 426–428. [14] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 (1951) 265–275. [15] U.K. Laemmli, Nature 227 (1970) 680–685. [16] J. Sambrook, D.W. Russell, Molecular Cloning: A laboratory Manual, third ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001. [17] Y.G. Liu, Y.L. Chen, BioTechniques 43 (2007) 649–656. [18] H. Tanaka, M. Muguruma, K. Ohta, Appl. Microbiol. Biotechnol. 70 (2006) 202–211. [19] C.S.M. Furniss, G. Williamson, P.A. Kroon, J. Sci. Food Agric. 85 (2005) 574–582. [20] P.W.J. De Groot, D.E.J.W. Basten, A.S.M. Sonnenberg, L.J.L.D. Van Griensven, J. Visser, P.J. Schaap, J. Mol. Biol. 277 (1998) 273–284. [21] M. Dimarogona, E. Topakas, P. Christakopoulos, E.D. Chrysina, Acta Crystallogr. 68 (2012) 735–742. [22] B. Decelle, A. Tsang, R.K. Storms, Curr. Genet. 46 (2004) 166–175. [23] T. Collins, C. Gerday, G. Feller, FEMS Microbiol. Rev. 29 (2005) 3–23. [24] A. Sunna, G. Antranikia, Crit. Rev. Biotechnol. 17 (1997) 39–67. [25] T.T. Do, D.T. Quyen, T.H. Dam, Scienceasia 38 (2012) 157–165. [26] X.R. Dong, S.W. Meinhardt, P.B. Schwarz, J. Agric. Food Chem. 60 (2012) 2538–2545. [27] J.Q. Wang, X. Yin, M.C. Wu, H.M. Zhang, S.J. Gao, J.T. Wei, C.D. Tang, J.F. Li, J. Ind. Microbiol. Biotechnol. 40 (2013) 75–83. [28] S. Kishishita, M. Yoshimi, T. Fujii, L.E. Taylor, S.R. Decker, K. Ishikawa, et al., Protein Expr. Purif. 94 (2014) 40–45. [29] N. Kulkarni, A. Shendye, M. Rao, FEMS Microbiol. Rev. 23 (1999) 411–456. [30] X. Yang, P. Shi, H. Huang, H. Luo, Y. Wang, W. Zhang, B. Yao, Food Chem. 148 (2014) 381–387. [31] T.T. Do, D.T. Quyen, T.N. Nguyen, V.T. Nguyen, Protein Expr. Purif. 92 (2013) 196–202. [32] Y. Song, Y.G. Lee, I.S. Choi, K.H. Lee, E.J. Cho, H.J. Bae, Enzyme Microb. Technol. 52 (2013) 170–176. [33] A. Knob, E.C. Carmona, Appl. Biochem. Biotechnol. 162 (2010) 429–443. [34] S. Thiagarajan, M. Jeya, P. Gunasekaran, World J. Microbiol. Biotechnol. 22 (2006) 487–492. [35] P.L. Wejse, K. Ingvorsen, K.K. Mortensen, Extremophiles 7 (2003) 423–431. [36] Y.S. Jeong, H.B. Na, S.K. Kim, Y.H. Kim, E.J. Kwon, J. Kim, H.D. Yun, J.K. Lee, H. Kim, Appl. Biochem. Biotechnol. 166 (2012) 1328–1339. [37] M. Tenkanen, M. Vrsanska, M. Siika-aho, D.W. Wong, V. Puchart, M. Penttila, M. Saloheimo, P. Biely, FEBS J. 280 (2013) 285–301.
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Characterization of a highly thermostable glycoside hydrolase family 10 xylanase from Malbranchea cinnamomea Guangsen Fan a , Shaoqing Yang a , Qiaojuan Yan b , Yu Guo a , Yanxiao Li a , Zhengqiang Jiang a,∗ a College of Food Science and Nutritional Engineering, Beijing Key Laboratory of Functional Food from Plant Resources, China Agricultural University, Beijing 100083, China b Bioresource Utilization Laboratory, College of Engineering, China Agricultural University, Beijing 100083, China
a r t i c l e
i n f o
Article history: Received 17 March 2014 Received in revised form 6 July 2014 Accepted 7 July 2014 Available online 21 July 2014 Keywords: Thermostable xylanase M. cinnamomea Xylooligosaccharides
a b s t r a c t A thermostable xylanase (McXyn10) from the thermophilic fungus Malbranchea cinnamomea strain S168 was purified and biochemically characterized. The enzyme was purified to homogeneity with a molecular mass of 43.5 kDa on SDS–PAGE. The optimal pH and temperature of the purified enzyme were pH 6.5 and 80 ◦ C, respectively. The enzyme showed a broad range of pH stability (pH 4.0–10.5), and was stable up to 70 ◦ C with a thermal denaturing half life of 76.0 min. The enzyme exhibited strict specificity for various xylans as substrates, but displayed no activity toward other tested polysaccharides. McXyn10 hydrolyzed birchwood xylan, beechwood xylan and oat-spelt xylan, yielded mainly xylobiose, xylotriose and xylooligosaccharides with degree of polymerization (DP) above 5, while yielded xylobiose from xylotriose and xylotetraose. The xylanase gene was further cloned. It had an open reading frame of 1191 bp with two introns. The deduced amino acid sequence of the gene showed highest identity (58%) with a glycoside hydrolase family 10 xylanase from Aureobasidium pullulans. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Xylanases (EC 3.2.1.8) randomly catalyze the cleavage of -1,4xylcosidic bonds in xylan—the second most abundant renewable resource in nature [1]. Xylanases have garnered much attention in recent years due to their great potential for industrial applications, such as in producing functional xylooligosaccharides from hemicelluloses, improving the nutritional properties of animal feedstuffs containing agricultural residues, converting biomass to ethanol, improving the quality of bread in the baking industry, clarifying fruit and vegetable juices, and reducing the environmental pollution caused by the paper and pulp industry [1–3]. In general, the availability of xylanases for industrial applications is restricted by their poor stability or low relative activity at higher temperatures or pH values. Thermostable xylanases offer a great advantage in catalytic procedures: the reaction can be performed at higher temperatures, thereby improving reaction rate, increasing productivity, decreasing the amount of enzyme needed and avoiding microbial contamination, toward increased technical and economical availability of the process [4]. Thermophilic fungi
∗ Corresponding author. Tel.: +86 10 62737689; fax: +86 10 82388508. E-mail address: [email protected] (Z. Jiang). http://dx.doi.org/10.1016/j.ijbiomac.2014.07.025 0141-8130/© 2014 Elsevier B.V. All rights reserved.
have attracted much attention due to their potential as sources of thermostable lignocellulose-degrading enzymes [5]. To date, some thermostable xylanases have been purified and characterized from thermophilic fungi such as Achaetomium sp. [6], Chaetomium sp. [7], Paecilomyces thermophila [8] and Rhizomucor miehei [9]. However, the only reports on the production, purification and characterization of xylanases from thermophilic Malbranchea species address two species, Malbranchea flava [2] and Malbranchea pulchella var. sulfurea [10]. Malbranchea cinnamomea strain S168 is a newly isolated thermophilic fungus shown to produce a novel multifunctional ␣amylase [11]. Furthermore, it was found to secrete multiple forms of extracellular xylanases into the fermentation broth (data not published). Here we report the purification and biochemical characterization of a thermostable xylanase from M. cinnamomea strain S168 and its gene sequence. 2. Material and methods 2.1. Chemicals Birchwood xylan, beechwood xylan, oat-spelt xylan, lichenan, Avicel, carboxymethylcellulose (CMC, low viscosity), locust bean gum, para-nitrophenyl (pNP)--d-xylopyranoside,
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
483
pNP--d-glucopyranoside, pNP--d-fucopyranoside and pNP--dgalactopyranoside were purchased from Sigma Chemical Company (St. Louis, MO). Q-Sepharose Fast Flow (QSFF) resin was purchased from Pharmacia (Uppsala, Sweden). Sephacryl S-100 was obtained from GE Life Sciences (Chalfont St. Giles, Buckinghamshire, UK). All other chemicals were of analytical grade unless otherwise specified.
approximately 2–3 ml, and then loaded onto a Sephacryl S-100 column (1 × 100 cm) equilibrated with 20 mM phosphate buffer (pH 7.0) with 100 mM NaCl, and the proteins were eluted with the same buffer at a flow rate of 0.3 ml/min. The fractions with xylanase activity were checked for purity by SDS–PAGE.
2.2. Strain and enzyme production
SDS–PAGE was performed as described by Laemmli [15] on a 12.5% separating gel with 4.0% stacking gel. Protein bands were visualized by staining with Coomassie brilliant blue R-250. The protein standards (TaKaRa) used for molecular-mass calibration were phosphorylase b (97.2 kDa), albumin (66.4 kDa), ovalbumin (44.3 kDa), carbonic anhydrase (29.0 kDa), trypsin inhibitor (20.1 kDa) and ␣-lactalbumin (14.3 kDa). Active staining was carried out according to the method of Han et al. [11]. The native molecular mass of the purified xylanase was estimated by gel filtration on a Superdex-75 column (1 × 40 cm) using 50 mM phosphate buffer (pH 7.2) with 100 mM NaCl. The proteins were eluted at a flow rate of 0.33 ml/min. The molecularmass standards used were albumin bovine V (68.0 kDa), albumin egg (44.3 kDa), chymotrypsinogen ␣ (25.6 kDa) and cytochrome c (12.4 kDa).
The M. cinnamomea strain S168 used in the present study was deposited in the China General Microbiological Culture Collection Center (CGMSS) under accession no. 6022. The strain was maintained on potato dextrose agar (PDA) and transferred every 6–7 weeks. Enzyme was produced by solid-state fermentation (SSF). The solid-state medium was prepared by mixing 5 g wheat bran (0.45–0.9 mm) and 20 ml basal medium solution in a 250-ml Erlenmeyer flask. The basal medium solution consisted of (g/l): 1 KH2 PO4 , 2.5 NaCl, 0.5 MgSO4 ·7H2 O, 1 (NH4 )2 SO4 and 0.5 CaCl2 , and the pH was adjusted to 7.0. Spores were prepared by washing a PDA plate covered with 5-day-old mycelium with 20% (v/v) sterile glycerin solution, and the spore concentration was counted by hemocytometer. M. cinnamomea strain S168 spores (1 × 106 ) were added to the medium in a 250-ml Erlenmeyer flask, thoroughly mixed and incubated at 45 ◦ C for 5 days. For enzyme extraction, 50 ml of 50 mM phosphate buffer (pH 7.0) was added to the flask which was then shaken (200 rpm) at 30 ◦ C for 2 h. The debris was removed by centrifugation at 10,000 × g for 10 min, and the supernatant was used as the crude enzyme for the following experiments. 2.3. Enzyme assay and protein determination Xylanase activity was assayed according to the method of Bailey et al. [12] with slight modifications. Suitably diluted enzyme solution (0.1 ml) was added to 0.9 ml birchwood xylan substrate (1%, w/v) dissolved in 50 mM pH 7.0 phosphate buffer. The mixture was incubated at 50 ◦ C for 10 min, and then the amount of reducing sugar released was determined by the 3,5-dinitrosalicylic acid (DNS) method [13]. One unit (U) of enzyme activity was defined as the amount of enzyme required to release 1 mol reducing sugars per minute under the above conditions with xylose as the standard. Specific activity was expressed in units per milligram protein. Protein concentration was estimated by the Lowry method using BSA as the standard [14]. 2.4. Enzyme purification Unless otherwise stated, all purification steps were carried out at 4 ◦ C, and flow rates were adjusted to 1.0 ml/min. The crude enzyme (3 l) was first fractionated by 60–80% saturated ammonium sulfate precipitation. The precipitate was collected, dissolved in 20 mM Tris–HCl buffer pH 9.0 (buffer A), and dialyzed against the same buffer for 12 h (the dialyzing buffer was changed every 4 h). The dialyzed enzyme was loaded onto a QSFF column (1 × 10 cm) equilibrated with buffer A containing 100 mM NaCl (buffer B). After washing with buffer B, the bound proteins were eluted with a 100–300 mM gradient of NaCl in buffer A. The fractions with xylanase activity were combined and dialyzed against 20 mM acetic acid buffer pH 4.5 (buffer C) for 12 h (the dialyzing buffer was changed every 4 h). Then the dialyzed sample was loaded onto a QSFF column (1 × 10 cm) equilibrated with buffer C. The bound proteins were eluted with 75 mM NaCl in buffer C to a constant base line, followed by a gradient elution of 75–150 mM NaCl in buffer C. The active fractions were collected and concentrated to
2.5. SDS–PAGE and molecular-mass determination
2.6. Protein identification by internal peptide sequences To determine the purified xylanase’s partial amino acid sequence, the Coomassie-stained protein bands were excised from the SDS–polyacrylamide gel, digested by trypsin, and then submitted to the National Center of Biomedical Analysis (Beijing, China) for amino acid sequencing of the internal peptides using HPLC-ESI-MS/MS. Mass spectral sequencing was performed on a Q-TOF II mass analyzer (Micromass Ltd., Manchester, UK). Peptide sequencing was performed using a palladium-coated borosilicate electrospray needle (Protana, Denmark). The raw data were analyzed by software PLGS2.4 (Waters, Milford, MA), and MS/MS Ion search was performed using Masscot (Matrix science, London). 2.7. Enzymatic properties of the purified xylanase The optimal pH was determined by measuring the enzyme’s activity at 50 ◦ C in different buffers with pH ranging from 3.0 to 12.0. The buffers used were: 50 mM citrate–Na2 HPO4 (pH 3.0–6.0), 3(N-morpholino)propanesulfonic acid (MOPS; pH 6.5–7.5), Tris–HCl (pH 8.0–9.0), 2-(cyclohexylamino) ethanesulfonic acid (CHES; pH 9.5–10.0), (cyclohexylamino)-1-propanesulfonic acid (CAPS; pH 10.5–11.0) and NaH2 PO4 –NaOH (pH 11.5–12.0). To determine its pH stability, the enzyme was incubated in the above buffers at 50 ◦ C for 30 min, and then residual xylanase activity was measured. The effect of temperature on the enzyme’s activity was determined by assaying its activity at different temperatures (30–90 ◦ C) in 50 mM MOPS buffer (pH 6.5). To determine its thermostability, the enzyme was incubated at different temperatures (30–90 ◦ C) in 50 mM MOPS buffer (pH 6.5) for 30 min, and then the retained activity was measured. To determine thermal denaturing half life, the enzyme was incubated at 65 ◦ C and 70 ◦ C for 4 h each, samples were withdrawn at different times, and residual activity was determined according to the standard assay. 2.8. Substrate specificity and kinetic parameters Substrate specificities were studied by measuring enzyme activity in the presence of various natural polysaccharides and pNPglycosides as substrates. For the various polysaccharides, 0.1 ml of suitably diluted enzyme solution (about 5 g/ml) was added to 0.9 ml substrate solution (1%, w/v) dissolved in 50 mM MOPS (pH
484
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
6.5), and incubated at 80 ◦ C for 10 min. The amount of released reducing sugars was measured by the DNS method [13]. For the different pNP-glycosides, 50 l of suitably diluted enzyme solution was added to 200 l pNP-glycoside solution (5 mM) dissolved in 50 mM MOPS (pH 6.5), and incubated at 80 ◦ C for 10 min. The amount of formed pNP was determined by spectrophotometry at 405 nm. One unit of enzyme activity was defined as the amount of enzyme required to produce 1 mol reducing sugars or pNP per minute under the above assay conditions. Specific activities were expressed as units per milligram protein. To determine the kinetic parameters, the hydrolysis reaction was carried out at 80 ◦ C for 5 min using different substrate concentrations (3.5–11 mg/ml birchwood xylan, 1.6–5.6 mg/ml beechwood xylan or 0.8–2.8 mg/ml oat spelt xylan) in 50 mM MOPS, pH 6.5. The kinetic parameters Km and Vmax were estimated by none linear regression using a “GraFit” software.
Fig. 1. SDS–PAGE and zymogram analysis of xylanase (McXyn10) purified from M. cinnamomea. Lane M, low-MW protein markers; lane 1, crude enzyme; lane 2 ammonium sulfate precipitation; lane 3, after QSFF column (pH 9.0 Tris–HCl); lane 4, after QSFF column (pH 4.5 acetate buffer); lane 5, after Sephacryl S-100 column.
2.9. Hydrolytic properties of the purified xylanase To investigate the hydrolytic properties of the enzyme, 5 U of purified enzyme was added to 1 ml of 1% (w/v) of the various xylans or xylooligosaccharides dissolved in 50 mM MOPS (pH 6.5) and incubated at 50 ◦ C for 12 h. The hydrolysis products were analyzed by TLC method. Aliquots withdrawn at different times during the hydrolysis were spotted on a silica gel Plate 60F 254 (Merck, Darmstadt, Germany). The plate was developed with two runs in a butanol:acetic acid:water (2:1:1, v/v) solvent system. After spraying with methanol:sulfuric acid (95:5, v/v) solvent, the sugars on the plate were visualized by heating for a few minutes in an oven set at 130 ◦ C. A mixture consisting of xylose (X1 ), xylobiose (X2 ), xylotriose (X3 ), xylotetraose (X4 ) and xylopentaose (X5 ) was used as the standard. 2.10. Cloning and sequence analysis of a xylanase gene from M. cinnamomea DNA manipulations were performed according to the techniques described by Sambrook and Russell [16]. To clone the xylanase gene (termed McXyn10), M. cinnamomea genomic DNA was used as the template, and the degenerate primers Xyn40DF (5 CCGGCGGCGACGTAGTNGCNAA3 ) and Xyn40DR (5 GCGTGCTCCAGGTTGTAGTCRTTRTARTA3 , R = A/T/C/G, N = A/G) were designed according to the conserved sequences of GGDWVVAN and YYNDYNIEHA, respectively, derived from the purified xylanase by MS using the CODEHOP algorithm. PCR conditions were as follows: a hot start at 94 ◦ C for 5 min, 30 cycles of 94 ◦ C for 30 s, 58 ◦ C for 30 s and 72 ◦ C for 1 min. The PCR product was purified, ligated to the pMDl8-T vector and sequenced. The full-length cDNA sequence of McXyn10 was obtained by assembling 5 and 3 gene sequences. The 3 -terminal sequence was obtained by rapid amplification of cDNA ends (RACE) using a SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA). The PCR conditions for RACE were: 94 ◦ C for 5 min, 30 cycles of 94 ◦ C for 30 s, 60 ◦ C for 30 s, and 72 ◦ C for 1 min, and finally at 72 ◦ C for 10 min. The primers used for the nested PCR were designed based on the partial gene sequences obtained above. The first nested PCR was performed with the primer pair Xyn40-3 GSP (5 TTCAGACGGAAACTTCGACAATGC3 ) and Nested Universal Primer A mix (BD Biosciences, Clontech). The second nested PCR was performed using the primer pair Xyn40-3 NGSP (5 TAATGGAGAACCACATCACCCAAACC3 ) and Nested Universal Primer A mix, with the products of the first nested PCR (diluted 100-fold) as the template. The obtained PCR products were purified, cloned and sequenced. The 5 sequence was obtained by hiTAIL-PCR according to the method of Liu and Chen [17]. The specific upstream Xyn40USP1 (5 CAATGAGATGCCCCTGTAAGCCAA3 ), primers
Xyn40USP2 (5 TACGCTGAGCACCAGTGGCTTTTG3 ) and Xyn40USP3 (5 CGCTTCACCAATGGTCCGGTAGAA3 ) were designed on the basis of the gene sequence obtained above. The obtained PCR products were purified, ligated to pMDl8-T vector and sequenced. The full-length xylanase gene was amplified from the genomic DNA of M. cinnamomea by PCR, using the specific primers Xyn40kDEF (5 CTAGCTAGCAATGGGTTGAGTGCTCGC3 ) and Xyn40kDER (5 CCCAAGCTTTCACAAGCACTGCCAGTACCA3 , restriction sites incorporated into the primers are underlined). The PCR conditions were: 94 ◦ C for 5 min, 30 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s, and 72 ◦ C for 1.5 min, and finally at 72 ◦ C for 10 min. The amplified PCR product of the DNA was purified and cloned into the pMD18-T vector, transformed into Escherichia coli Trans 5␣ for sequencing, and subjected to BLAST analysis. Nucleotide and deduced amino acid sequences were analyzed with the ExPASy Proteomics tools (http://www.expasy.ch/tools/). Open reading frame (ORF) analysis was performed using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Signal peptide was analyzed using the Signal P 4.0 server (http://www.cbs.dtu.dk/services/SignaIP). Introns were identified using the software DNAman6.0. The amino acid sequence alignment was performed using the ClustalW program.
3. Results 3.1. Xylanase production and purification The highest xylanase activity of 1139 U/g dry substrate was obtained by solid-state fermentation, after 5 days of cultivation using wheat bran as the carbon source. A xylanase was purified to homogeneity from the crude enzyme extract (Fig. 1) with a purification fold of 5.9 (Table 1). The molecular mass of the denatured enzyme was estimated to be 43.5 kDa by SDS–PAGE (Fig. 1), and the native molecular mass was determined to be 40.5 kDa by gelfiltration chromatography, indicating that the purified xylanase is a monomer. The enzyme was designated McXyn10. Amino acid sequences of eight internal peptide fragments of McXyn10 were obtained: peptide I (AADPDAK), peptide II (LQQQATDYASVVSA), peptide III (LSDSAY), peptide IV (GGDVVAN), peptide V (HWDVVNEALNED), peptide VI (TIGEAYIPIAFK), peptide VII (DSVFYR) and peptide VIII (YYNDYNIEH). All of the internal peptides were compared to other fungal xylanases by NCBI-BLAST. The sequences of peptides I, V, VI and VII derived from McXyn10 showed 100% identity with some fungal glycoside hydrolase (GH) family 10 xylanases. However, the sequence of peptide III and IV did not display any significant similarity with other xylanases (data not shown).
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
485
Table 1 Purification summary of the xylanase (McXyn10) from M. cinnamomea. Purification step
Total activity (U)a
Protein (mg)b
Specific activity (U/mg)
Purification factor (fold)
Activity recovery (%)
Crude supernatant (NH4 )2 SO4 precipitation QSFF (pH 9.0) QSFF (pH 4.5) S-100
337,865.9 19,951.6 2050.6 1025 938.8
3833.0 743.1 18.1 2.0 1.8
88.1 26.8 113.3 512.5 521.6
1 0.3 1.3 5.8 5.9
100 5.91 0.61 0.30 0.28
a b
The enzyme was determined in 50 mM MOPS buffer (pH 6.5) at 50 ◦ C for 10 min using DNS [13] method. Protein concentration was estimated by the Lowry method [14].
3.2. Effect of pH and temperature on enzyme activity and stability The optimal pH for McXyn10 activity was determined to be 6.5 (Fig. 2a). The enzyme exhibited excellent stability within the pH range of 4.0–10.5 (Fig. 2b). McXyn10 activity was optimal at 80 ◦ C (Fig. 3a). The enzyme was stable up to 70 ◦ C (Fig. 3b). The thermal denaturing half lives of McXyn10 at 65 ◦ C and 70 ◦ C were 137.2 min and 76.0 min, respectively (data not shown).
birchwood xylan (879.9 U/mg, 100%), but exhibited no activity on the other tested natural polysaccharides such as Avicel, CMC, locust bean gum and lichenan, or the pNP-glycosides such as pNP--d-glucopyranoside, pNP--d-fucopyranoside and pNP-d-galactopyranoside. However trace activity was detected with pNP--xylopyranoside. The kinetic parameters Km and Vmax of McXyn10 for birchwood xylan, beechwood xylan and oat-spelt xylan are reported in Table 2.
3.3. Substrate specificity and kinetic parameters
3.4. Hydrolytic properties of the purified xylanase
McXyn10 was most active on oat-spelt xylan (1478.2 U/mg, 168%) followed by beechwood xylan (1027.7 U/mg, 116.8%) and
The action patterns of McXyn10 on different xylans and xylooligosaccharides were further studied. McXyn10 hydrolyzed birchwood xylan and beechwood xylan to yield mainly X2 , X3 , X5
Fig. 2. Optimal pH (a) and pH stability (b) of xylanase (McXyn10) purified from M. cinnamomea. The optimal pH was determined by measuring the enzyme activity at 50 ◦ C in different buffers (50 mM) from pH 3.0 to 12.0. Buffers used were citrate-Na2 HPO4 (pH 3.0–6.0), MOPS (pH 6.5–7.5), Tris–HCl (pH 8.0–9.0), CHES (pH 9.5–10.0), CAPS (pH 10.5–11.0) and NaH2 PO4 –NaOH (pH 11.5–12.0). pH stability was determined by incubating the enzyme in the above buffers at 50 ◦ C for 30 min, and then measuring the residual enzyme activity in 50 mM MOPS (pH 6.5) at 50 ◦ C by standard assay. The highest enzyme activity was used as 100%.
Fig. 3. Optimal temperature (a) and thermostability (b) of xylanase (McXyn10) purified from M. cinnamomea. The optimal temperature was determined by measuring enzyme activity at different temperatures (30–90 ◦ C) in 50 mM MOPS (pH 6.5). Thermal stability was determined by measuring residual activity after the enzyme had been incubated at different temperatures (30–90 ◦ C) for 30 min. The highest enzyme activity was used as 100%.
486
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
Table 2 Kinetic parameters of McXyn10 purified from M. cinnamomeaa . Substrates
Vmax (mol/min/mg)
Km (mg/ml)
kcat (s−1 )
kcat /Km (ml/mg/s)
Birchwood xylan Beechwood xylan Oat-spelt xylan
5878.2 ± 159.5 5763.7 ± 225.8 6322.8 ± 226.4
7.1 ± 0.4 3.0 ± 0.26 1.5 ± 0.12
4.26 4.18 4.58
0.60 1.39 3.06
a The kinetic parameters were determined by measuring the enzyme’s activities with various substrate concentrations in 50 mM MOPS buffer (pH 6.5) at 80 ◦ C for 5 min.
and X6 after 12 h of hydrolysis (Fig. 4a and b). For the hydrolysis of oat-spelt xylan, McXyn10 first released X2 and X3 as the predominant products and a small amount of other xylooligosaccharides (X4 –X6 ), and then the intermediate products were ultimately converted to X2 and X3 (Fig. 4c). With respect to hydrolysis of the various xylooligosaccharides, McXyn10 did not show any activity on X2 , but efficiently hydrolyzed X3 and X4 , with X2 as the predominant end product (Fig. 4d).
amino acids, and contains two introns (80 bp and 68 bp) (Fig. 5). The mature protein has a predicted molecular mass of 40 kDa and a theoretical pI of 4.37. The N-terminal region of the deduced protein contains a predicted 19-amino acid signal peptide. The gene sequence has been submitted to the GenBank database, accession no. KF572027. Amino acid sequence alignment of McXyn10 (M. c. KF572027) revealed the highest sequence identity of 58% with a GH family 10 xylanase from Aureobasidium pullulans ATCC 20524 (A. p. BAE71410, [18], Fig. 6). It also displayed relative high sequence identities with some other reported GH family 10 xylanases, including those from Penicillium funiculosum (P. f. CAG25554, 57%, [19]), Agaricus bisporus (A. b. O60206, 56%, [20]), Fusarium oxysporum (F. o. 3U7B A, 56%, [21]) and Phanerochaete chrysosporium (P. c. AEK97220, 56%, [22]) (Fig. 6), suggesting that the obtained McXyn10 is a novel member of GH family 10 xylanases. In addition, all the sequences of eight peptides derived by MS spectrum from McXyn10 were found in the deduced amino acid sequence of the cloned xylanase gene, confirming that the obtained xylanase gene is just the McXyn10 encoding gene.
3.5. Gene cloning and sequence analysis of McXyn10 4. Discussion The xylanase gene (McXyn10) with a full length of 1652 bp was cloned from M. cinnamomea by PCR. There were two nontranslated regions (of 103 bp and 210 bp) at the 5 and 3 terminuses of the gene, respectively. McXyn10 has an ORF of 1191 bp, encoding 396
Thermostable xylanases from thermophilic fungi have gathered much attention due to their specific biochemical properties, which are useful for various industrial applications [23]. The genus
Fig. 4. Hydrolytic properties of xylanase (McXyn10) purified from M. cinnamomea on various xylans and xylooligosaccharides. The reactions were performed by incubating 5 U/ml enzyme with 1% (w/v) birchwood xylan (a), beechwood xylan (b), oat-spelt xylan (c), and xylobiose, xylotriose and xylotetraose (d) at 50 ◦ C for 12 h. Samples withdrawn at different times were inactivated by boiling at 100 ◦ C for 10 min and analyzed by TLC. The numbers indicated in the figures are incubation time (h).
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
487
Fig. 5. Nucleotide and deduced amino acid sequences of the xylanase gene (McXyn10) from M. cinnamomea. Two intron sequences are shown in lowercase letters, and those in the cDNA sequences are shown in uppercase letters. The translation-initiation codon (ATG) and termination codon (TGA) are boxed in frame, and the termination codon is also marked by an asterisk (*). A putative signal peptide is underlined. The sequences matching the peptide sequences determined by MS are shaded in gray. The nucleotide sequence has been submitted to Genbank under accession no. KF572027.
Malbranchea is a promising producer of xylanolytic enzymes, as it has been reported to produce multiple isoforms of xylanases [2,5]. In the present study, we report the purification, biochemical characterization and gene cloning of a novel thermostable xylanase (McXyn10) from the thermophilic fungus M. cinnamomea strain S168. The purified xylanase McXyn10 is a monomer with a molecular mass of 43.5 kDa (Fig. 1). Most microbial xylanases are singlesubunit proteins with molecular masses ranging from 8 kDa to 145 kDa [24]. Among them, GH family 10 xylanases have relatively high molecular masses (>30 kDa) [18]. Another Malbranchea
species, M. flava, was previously reported to secrete two low-MW xylanases, MFX I and MFX II, with molecular masses of 25.2 kDa and 30.0 kDa, respectively [2]. The molecular mass of McXyn10 is similar to that of some GH family 10 xylanases [18,20,22,25–28]. Moreover, McXyn10 displayed highest sequence identity (58%) with a GH family 10 xylanase from A. pullulans ATCC 20524 (Fig. 6). Thus, the present xylanase can be considered a novel GH family 10 xylanase. In general, microbial xylanases are most active in a neutral or weakly acidic pH range (4.0–7.0) and stable within a broad pH range (3.0–10.0, [29]). McXyn10 showed optimal activity at pH 6.5
488
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
Fig. 6. Sequence alignment of McXyn10 from M. cinnamomea (M. c. KF572027) with other GH family 10 xylanases. Numbers on the left are the residue numbers of the first amino acid in each line. Listed sequences include the xylanases from A. pullulans ATCC 20524 (A. p. BAE71410, 58%), P. funiculosum (P. f. CAG25554, 57%), A. bisporus (A. b. O60206, 56%), F. oxysporum (F. o. 3U7B A, 56%) and P. chrysosporium (P. c. AEK97220, 56%).
(Fig. 2), similar to that of most other reported fungal xylanases, such as those from Fusarium graminearum [26], Humicola insolens [30], and P. thermophila [8]. However, the present xylanase exhibited a wider range of pH stability (pH 4.0–10.5) than most of the other fungal xylanases [9,25,27,31]. An optimal temperature of 80 ◦ C was found for McXyn10 (Fig. 3), which is a little higher than that of the thermostable xylanases from some other thermophilic fungi, including Achaetomium sp. (75 ◦ C, [6]), Acremonium cellulolyticus (75 ◦ C, [28]), P. thermophila (75 ◦ C, [8]), R. miehei 3169 (75 ◦ C, [9]), and Thermoascus aurantiacus miehe (75 ◦ C, [5]), and quite a bit higher than that of most mesophilic fungal xylanases, such as those from F. graminearum (45 ◦ C, [26]), Aspergillus usamii E001 (50 ◦ C,
[27]), Aspergillus niger (50 ◦ C, [31]), Schizophyllum commune (50 ◦ C, [32]), Aspergillus awamori (50–55 ◦ C, [25]), Penicillium sclerotiorum (xylanase I, 50 ◦ C, xylanase II, 55 ◦ C, [33]), Chaetomium sp. (65 ◦ C, [7]) and M. flava (70 ◦ C, [2]). To the best of our knowledge, the optimum temperature of McXyn10 (80 ◦ C) represents a high value for fungal xylanases, second only to that of a xylanase from Aspergillus fumigatus MKU1 (90 ◦ C, [34]). Thermostability is an important prerequisite for commercialization and industrial applications, as the use of thermostable enzymes at relative high temperatures can accelerate reactions, prevent microbial contamination and reduce production costs. The influence of different metal ions and agents on the enzyme’s activity was also investigated.
G. Fan et al. / International Journal of Biological Macromolecules 70 (2014) 482–489
McXyn10 showed strict substrate specificity. It only acted on various xylans, but exhibited no activity on other tested natural polysaccharide substrates, such as CMC and cellulose (data not shown); this behavior is similar to that of xylanases from Chaetomium sp. [7] and P. sclerotiorum [33]. In contrast, some other xylanases exhibit relatively broader substrate specificities. For example, the xylanase MFX II from M. flava showed hydrolytic activity toward lichenan [2], a xylanase from a halophilic bacterium hydrolyzed CMC [35], a compost metagenomic libraryderived xylanase exhibited hydrolyzing activity toward CMC, starch, lichenan and pectin [36], and a xylanase from Trichoderma reesei favored hydrolysis of rhodymenan, a soluble linear -1,3-1,4-xylan [37]. Cellulase-free xylanases are preferred in the paper and pulp industry as cellulase activity can result in cellulose loss, pulp-quality degradation, and increases in effluent treatment costs [23]. Since McXyn10 was stable over a wide pH range, and had a high optimum temperature, good thermostability and cellulasefree activity, it could potentially be used in the paper and pulp industry for bio-bleaching. The Km values of McXyn10 are in agreement with those of other fungal xylanases, which range from 0.1 to 40.9 mg/ml [1]. The enzyme showed the highest activity against oat-spelt xylan, followed by beehwood xylan and birchwood xylan (data not shown). Similarly, xylanases I and II from P. sclerotiorum exhibit higher affinities for oat-spelt xylan [33]. The purified McXyn10 hydrolyzed various xylans but with different modes of action. McXyn10 hydrolyzed birchwood xylan and beechwood xylan to release mainly X2 , X3 , X5 and xylooligosaccharides with a degree of polymerization above 5 (Fig. 4a and b). However, McXyn10 hydrolyzed oat-spelt xylan to yield X2 and X3 as the end products (Fig. 4c). The hydrolytic properties of McXyn10 are different from those of MFX I and MFX II from M. flava, which released X4 from the tested xylan substrates [2]. In fact, the hydrolytic properties of McXyn10 differ from those of most other reported fungal xylanases, such as the xylanase from P. thermophila which hydrolyzes beechwood xylan to yield mainly X2 and X3 [8], and the P. sclerotiorum xylanase which releases X2 , X3 and X4 as the major products from oat-spelt xylan [33]. Unexpectedly, the products of McXyn10 hydrolysis of birchwood xylan were similar to those of a GH family 11 xylanase from P. chrysosporium, but different from a GH family 10 xylanase from the same strain [22]. Furthermore, McXyn10 hydrolyzed X3 and X4 to X2 as the major end product without formation of the corresponding amount of X1 , and could barely hydrolyze X2 (Fig. 4d), indicating that the enzyme is an endo-type xylanase and may possess transglycosylation activity. 5. Conclusions A novel GH family 10 xylanase (McXyn10) from a thermophilic fungus, M. cinnamomea S168 was purification and biochemically characterized. The enzyme was purified to homogeneity with a molecular mass of 43.5 kDa. It was most active at pH 6.5 and exhibited a wide range of pH stability (pH 4.0–10.5). The optimal temperature of the enzyme was high up to 80 ◦ C. McXyn10 hydrolyzed various xylans to yield mainly xylooligosaccharides with trace amount of xylose. Thus, McXyn10 would be a useful candidate for the production of xylooligosaccharides. In addition, the
489
xylanase encoding gene was further cloned from M. cinnamomea S168 and sequenced. Acknowledgments This work was supported by the National Science Fund for Distinguished Young Scholars (No. 31325021) and the National High Technology Research and Development Program of China (863 Program, No. 2011AA100905). References [1] Q.K. Beg, M. Kapoor, L. Mahajan, G.S. Hoondal, Appl. Microbiol. Biotechnol. 56 (2001) 326–338. [2] M. Sharma, B.S. Chadha, H.S. Saini, Bioresour. Technol. 101 (2010) 8834–8842. [3] P. Falck, S. Precha-Atsawanan, C. Grey, P. Immerzeel, H. Stalbrand, J. Agric. Food Chem. 61 (2013) 7333–7340. [4] R. Da Silva, E.S. Lago, C.W. Merheb, E.M.M. Macchion, Y.K. Park, E. Gomes, Braz. J. Microbiol. 36 (2005) 235–241. [5] S.K. Ghatora, B.S. Chadha, A.K. Badhan, H.S. Saini, M.K. Bhat, BioResources 1 (2006) 18–33. [6] L. Zhao, K. Meng, P. Shi, Y. Bai, H. Luo, H. Huang, Y. Wang, P. Yang, B. Yao, Process Biochem. 48 (2013) 1879–1885. [7] Z.Q. Jiang, Q.Q. Cong, Q.J. Yan, N. Kumar, X.D. Du, Food Chem. 120 (2010) 457–462. [8] M. Zhang, Z.Q. Jiang, S.Q. Yang, C.W. Hua, L.T. Li, Bioresour. Technol. 101 (2010) 688–695. [9] E.M. Fawzi, Acta. Biol. Hung. 62 (2011) 85–94. [10] M.T. Matsuo, Agric. Biol. Chem. 49 (1985) 839–841. [11] P. Han, P. Zhou, S.Q. Hu, S.Q. Yang, Q.J. Yan, Z.Q. Jiang, Appl. Biochem. Biotechnol. 170 (2013) 420–435. [12] M.J. Bailey, P. Biely, K. Poutanen, J. Biotechnol. 23 (1992) 257–270. [13] G.L. Miller, Anal. Chem. 31 (1959) 426–428. [14] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 (1951) 265–275. [15] U.K. Laemmli, Nature 227 (1970) 680–685. [16] J. Sambrook, D.W. Russell, Molecular Cloning: A laboratory Manual, third ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001. [17] Y.G. Liu, Y.L. Chen, BioTechniques 43 (2007) 649–656. [18] H. Tanaka, M. Muguruma, K. Ohta, Appl. Microbiol. Biotechnol. 70 (2006) 202–211. [19] C.S.M. Furniss, G. Williamson, P.A. Kroon, J. Sci. Food Agric. 85 (2005) 574–582. [20] P.W.J. De Groot, D.E.J.W. Basten, A.S.M. Sonnenberg, L.J.L.D. Van Griensven, J. Visser, P.J. Schaap, J. Mol. Biol. 277 (1998) 273–284. [21] M. Dimarogona, E. Topakas, P. Christakopoulos, E.D. Chrysina, Acta Crystallogr. 68 (2012) 735–742. [22] B. Decelle, A. Tsang, R.K. Storms, Curr. Genet. 46 (2004) 166–175. [23] T. Collins, C. Gerday, G. Feller, FEMS Microbiol. Rev. 29 (2005) 3–23. [24] A. Sunna, G. Antranikia, Crit. Rev. Biotechnol. 17 (1997) 39–67. [25] T.T. Do, D.T. Quyen, T.H. Dam, Scienceasia 38 (2012) 157–165. [26] X.R. Dong, S.W. Meinhardt, P.B. Schwarz, J. Agric. Food Chem. 60 (2012) 2538–2545. [27] J.Q. Wang, X. Yin, M.C. Wu, H.M. Zhang, S.J. Gao, J.T. Wei, C.D. Tang, J.F. Li, J. Ind. Microbiol. Biotechnol. 40 (2013) 75–83. [28] S. Kishishita, M. Yoshimi, T. Fujii, L.E. Taylor, S.R. Decker, K. Ishikawa, et al., Protein Expr. Purif. 94 (2014) 40–45. [29] N. Kulkarni, A. Shendye, M. Rao, FEMS Microbiol. Rev. 23 (1999) 411–456. [30] X. Yang, P. Shi, H. Huang, H. Luo, Y. Wang, W. Zhang, B. Yao, Food Chem. 148 (2014) 381–387. [31] T.T. Do, D.T. Quyen, T.N. Nguyen, V.T. Nguyen, Protein Expr. Purif. 92 (2013) 196–202. [32] Y. Song, Y.G. Lee, I.S. Choi, K.H. Lee, E.J. Cho, H.J. Bae, Enzyme Microb. Technol. 52 (2013) 170–176. [33] A. Knob, E.C. Carmona, Appl. Biochem. Biotechnol. 162 (2010) 429–443. [34] S. Thiagarajan, M. Jeya, P. Gunasekaran, World J. Microbiol. Biotechnol. 22 (2006) 487–492. [35] P.L. Wejse, K. Ingvorsen, K.K. Mortensen, Extremophiles 7 (2003) 423–431. [36] Y.S. Jeong, H.B. Na, S.K. Kim, Y.H. Kim, E.J. Kwon, J. Kim, H.D. Yun, J.K. Lee, H. Kim, Appl. Biochem. Biotechnol. 166 (2012) 1328–1339. [37] M. Tenkanen, M. Vrsanska, M. Siika-aho, D.W. Wong, V. Puchart, M. Penttila, M. Saloheimo, P. Biely, FEBS J. 280 (2013) 285–301.
