Plant Molecular Biology 6: 245-252, 1986 © 1986 Martinus Nijhoff Publishers, Dordrecht - Printed in the Netherlands

Characterization of a chloroplast D N A sequence from Chlorella ellipsoidea that promotes a u t o n o m o u s replication in yeast Takashi Yamada, l Miyuki Shimaji I & Yuji Fukuda 2

1Department of Cell Biology, Mitsubishi-Kasei Institute of Life Sciences, 11 Minamiooya, Machida-shi, Tokyo, Japan 2present address: Fermentation Research Institute, Agency of Industrial Science and Technology, 1-1-3, Yatabecho-Higashi, Tukuba-gun, Ibaraki 305, Japan

Keywords: Chlorella, chloroplast DNA, autonomous replicating sequence

Summary An EcoRI 2.7 kbp fragment from Chlorella ellipsoidea chloroplast DNA (cpDNA) cloned in YIp5 was shown to promote autonomous replication in Saccharomyces cerevisiae. The fragment was localized in the small single copy region close to the inverted repeat. The ARS activity (autonomously replicating sequences in yeast) was found to be confined within a subclone of a ca. 300 bp HindIlI fragment. Sequence analysis of this fragment revealed its high AT content and the presence of several direct and inverted repeats and a few elements that were related to the yeast ARS consensus sequence. Electron microscopic studies revealed that this sequence did not coincide with the primary replication origin of chloroplast DNA. The functioning of this sequence as a possible origin of plasmid replication in vivo is discussed. This is the first report on Chlorella cpDNA sequence.

Introduction

starts from one unique position located upstream from the 5' end of a supplementary 16S rRNA gene (7, 13) and in the case of Chlamydomonas reinhardii, the replication is initiated from two points; one is located at ca. 10 kbp upstream of the 5' end of a 16S rRNA gene and the second origin is at ca. 16.5 kbp upstream of the same 16S rRNA gene (22). Neither of the ARS sequences of C. reinhardii so far isolated (8, 20) coincides with the replication origins. Recently, Rochaix et al. (14) demonstrated that one of the chloroplast sequences that promote autonomous replication of a plasmid in C. reinhardii (ARC) hybridized to the fragment containing the replication origin and that another ARC sequence was very close to one of the ARS site (14). Therefore, these findings raise the question of how chloroplast ARS sequences, ARC sequences and cpDNA replication origins relate to each other. We have been interested in constructing a transformation system in the unicellular green alga Chlorella ellipsoidea and attempted to isolate cpDNA ARS fragments to be used for the replica-

ARS sequences (autonomously replicating sequences in yeast) of cpDNA have been isolated and characterized from higher plants (I0, 11) and algae (8, 20). They were localized on the cpDNA maps in the small single copy region proximal to the 23S rRNA gene in tobacco (10), in the small single copy region close to the inverted repeat and in the large single copy region in petunia (11) and in the single copy region proximal to the 16S rRNA gene and around the gene for the large subunit of ribulose-l,5-bisphosphate carboxylase/oxygenase (rbcL) in Chlamydomonas reinhardii (8, 20). Sequence analyses of these ARS regions revealed the presence of elements related to the yeast ARS consensus sequence (1, 17) and of many short direct and inverted repeats. It is, however, not clear whether the chloroplast ARS sequences can function as replication origins in cpDNA. So far, only in two cases, the origins of cpDNA replication have been accurately mapped: In the case of Euglena gracilis, cpDNA replication 245

246 tion origin of vector plasmids (3, 25). In this report, we describe the isolation, localization, properties and sequence analysis of a cpDNA ARS sequence from C. ellipsoidea.

Materials and methods

pared from plaques bearing the recombinant DNA was sequenced using the chain termination procedure (15). M13 sequencing kits were obtained from Takara Shuzo Co., Kyoto. Sequencing reaction products were electrophoresed on 6°70 and 8°70 0.3 mm polyacrylamide-urea gels. Sequence analyses were carried out in both orientations.

Strains

Transformation

Chlorella ellipsoidea C-87 was obtained from the algal culture collection of the Institute of Applied Microbiology, Univ. of Tokyo. Escherichia coli HB101 (C600 recA, supE, lac, leuB, proA, thi, Sm r, hsdR, hsdM) and JM101 (Alac pro, thi, supE, F' traD36, proAB, laclq Z M15) were used for bacterial transformation and propagation of plasmids. Saccharomyces cerevisiae YNN27 (c~, trpl, ura3, gal2) was used as a host for yeast transformation.

E. coil was transformed by the method of Davis et al. (2). The transformation procedure for intact yeast cells was according to Ito et al. (6). Electron microscopy Spreading the DNA and preparing, staining and shadowing the grids were performed as previously described (23).

DNAs Results

Chloroplast DNA from C. ellipsoidea was prepared as described previously (23). Plasmid DNAs for large and small scale preparations were prepared according to Maniatis et al. (9). A gene library of C. ellipsoidea cpDNA was constructed by ligation of SstI-digested cpDNA fragments and SstI-digested pUC12 (5) and transformed into E. coli JM101.

Gel electrophoresis and Southern hybridization Chloroplast DNA and plasmid DNAs digested with restriction enzymes were analyzed by electrophoresis on horizontal 0.7°70 agarose gels. Digestion of DNA with the various restriction enzymes (Takara Shuzo Co., Kyoto, Toyobo Biochemicals, Osaka, Bethesda Research Labs., Maryland, and New England Biolabs, Boston) was performed according to the suppliers. For hybridization analysis, electrophoretically separated DNA was transferred to a nitrocellulose filter and hybridized with 32p_ labelled probes according to Southern (16).

Sequencing of DNA fragments HindlII fragments containing the ARS sequences of interest were cloned in the HindlII site of M13 mpl8 and 19 (5). Single-stranded DNA pre-

Isolation of cp A R S sequences The vector YIp5, which is a hybrid of pBR322 and the yeast ura3 gene, has no yeast replication origin. If an ARS sequence is inserted into YIp5, it can then transform ura- yeast strains to a Ura ÷ phenotype (18). YIp5 was linearized with EcoRI, ligated with EcoRI-digested cpDNA from C. ellipsoidea and introduced into S. cerevisiae YNN27 (ura-). Several Ura ÷ transformants were selected after a week of growth and from three of them, plasmids were isolated and characterized (pCcl-3) (3, 25). All of these plasmids contained an EcoRI 2.7 kbp cpDNA fragment. Restriction enzyme analyses revealed that the three inserts were the same. A physical map of pCcl is shown in Fig. 1.

Localization of the A R S sequence on the cpDNA of C. ellipsoidea When the EcoRI 2.7 kbp was labelled by nick translation and hybridized to cpDNA digested with EcoRI, a strong hybridizing band of 2.7 kbp and several additional bands appeared reproducibly (Fig. 2, b, lane 1). Thus it was difficult to localize with certainty the 2.7 kbp fragment on the cpDNA. Since the digestion was complete (overnight diges-

247 E

A

Ha

PH BHA

H

E

Fig. 1. Physical map of the plasmid pCcl. The 2.7 kbp cpDNA EcoRI fragment was inserted in the EcoRI site of Ylp5. The restriction sites for the endonucleases AvalI (A), BgllI (B) EcoRI (E), Hindlll (H), HaelI (Ha), PstI (P) and Sail (S) were determined by analysing the DNA fragment patterns of digests after electrophoresis on 0.7070 and 1.407oagarose gels. Sizes are shown in kilo base pairs.

tion with 10 vol. of enzyme did not alter the digestion pattern) and the hybridization condition was stringent (with 4×SSC and 50% formamide at 42 °C; Tm-7 °C), the additional hybridization may be because some sequences in the fragment are highly repeated in the cp genome. Therefore, in order to map the EcoRI 2.7 kbp fragment on the

cpDNA, a larger DNA segment containing this fragment should be used as a probe. Such a clone was selected by colony hybridization from the gene library of C. ellipsoidea cpDNA. This clone, pCCS105, contained an SstI insert of 8.45 kbp in which the 2.7 kbp EcoRI fragment was located (Fig. 2, b). A physical map of pCCS105 is shown in Fig. 2 (c). Location on the cpDNA of the 8.45 kbp insert of pCCS105 was determined by Southern hybridization of BamHI, PvuI and SstII digests of the cpDNA with 32p-labelled pCCS105. Figure 3 (b) shows fragments of BamHI 38.6 kbp and 15 kbp (lane 1), PvuI 24 kbp and 5.8 kbp (lane 3), SstII 26.2 kbp and 14.8 kbp (lane 5) hybridized with pCCS105. According to these patterns and double digestion patterns (Fig. 3, b lanes 2, 4 and 6), the hybridizing fragments were mapped as shown in Fig. 3 (c). This region accurately corresponded to the small single copy region proximal to the 23S rRNA gene existing between the 22.5 kbp inverted repeat sequences (24). The location of the ARS sequence is shown in Fig. 4. The detailed physical map of C. ellipsoidea cpDNA will be published elsewhere.

Fig. 2. Hybridization of 32p-labelled EcoRI insert of pCcl to the EcoRl digests of C. ellipsoidea cpDNA and to a clone PCCS105 from the cpDNA gene library. (a) Agarose gel electrophoresis patterns of cpDNA digested with EcoRI (lane 1) and of pCCS105 digested with EcoRI/SstI (lane 2), EcoRI (lane 3), SstI (lane 4) and no digestion (lane 5). Lane 6 contained ~ DNA digested with HindIII as size markers. (b) Hybridization patterns with nick translated EcoRI 2.7 kb insert of pCcl. Arrows indicate the 2.7 kbp and 8.45 kbp hybridizing bands. (c) Physical map of pCCS105. Restriction sites are E, EcoRI; K, KpnI; S~, SstI; X, XhoI.

248 Subcloning o f the A R S sequence

Fig. 3. Hybridization of 32p-labelled pCCSI05 to restriction fragments of C. ellipsoidea cpDNA. (a) The cpDNA was digested with BamHI (lane 1), BamHl/Pvul (lane 2), PvuI (lane 3), PvuI/SstlI (lane 4), SstlI (lane 5) and BamHI/SstlI (lane 6). (b) Hybridization patterns with 32P-labelled pCCS105. (c) Physical map of hybridizing fragments. Restriction endonuclease sites are indicated by B, BamHI; P, Pvul; SH, SstlI. Sizes are given in kilo base pairs. Black bar indicates position of ARS sequence.

In o r d e r to localize the A R S sequence m o r e precisely, the E c o R I 2.7 k b p f r a g m e n t was cleaved by BglII into two f r a g m e n t s o f 1.5 k b p a n d o f 1.2 k b p a n d each f r a g m e n t was ligated to YIp5 digested with E c o R I a n d B a m H I (pUG515 a n d pUG513, respectively, Fig. 5). W h e n the new r e c o m b i n a n t p l a s m i d s were used to t r a n s f o r m S. cerevisiae YNN27, pUG515 p r o d u c e d U r a ÷ colonies b u t the efficiency was c o n s i d e r a b l y lower t h a n the case o f p C c l (Table 1). T h e p l a s m i d pUG513 did n o t produce any a p p r e c i a b l e U r a + colonies u p to a week o f g r o w t h (4), a l t h o u g h very small colonies a p p e a r e d after p r o l o n g e d i n c u b a t i o n o f m o r e t h a n 2 weeks. These results suggested that m o s t o f the A R S activity was c o n t a i n e d within the 1.5 k b p subf r a g m e n t in pUG515 b u t s o m e sequences o n the 1.2 k b p s u b f r a g m e n t m a y be n e e d e d for attaining its f u n c t i o n to the fullest. Therefore, the E c o R I 2.7 k b p f r a g m e n t was digested with H i n d I I I a n d three o f four generated f r a g m e n t s (1.25 kbp, 0.45 k b p a n d 0.3 kbp) were ligated to the YIp5 H i n d I I I site (Fig. 5). A m o n g the three r e c o m b i n a n t p l a s m i d s p C C H 1 0 0 , 101 a n d 102, only p C C H 1 0 0 E I

PH B H H IL i I J pUG515 (1.5) PUGS13 (1.2) PCCHI02 pCClIIO0 .pCCHIO1 . (1.25)

-,,. x

(0.3)

E I

(0.45)

Fig. 5. Subcloning strategy of the EcoRI 2.7 kbp fragment. Details of the subcloning are described in the text. Restriction sites are B, BgllI; E, EcoRI; H, Hindlll; P, PstI. Sizes are shown in kilo base pairs.

Table 1. Transformation of S. cerevisiaeYNN27 with plasmids derived from pCcl.

B:BamHI P;pvul S:Sstll

Fig. 4. Location of the ARS sequence on the C. ellipsoidea cpDNA. The map is shown in one of two possible orientations. Asterisks indicate the map positions of the SstI fragments with D-loop.

Plasmid

Ura + transformants/ #g DNA

070

pCcl pUG515 pUG513 pCCHI00 pCCHI01 pCCH 102 no DNA

580 117 (106)* 662 8 0 0

100 20 (18)* 114 1.4 0 0

Transformations were carried out as described in Materials and methods. (*) indicates the number of very small colonies discernible only after 2 weeks (see Discussion).

249 that contained the HindlII 0.3 kbp fragment which corresponds to the connecting region of pUG515 and pUG513 inserts could transform S. cerevisiae YNN27 to a Ura ÷ phenotype (Table 1). In other words, the full ARS activity was confined within the HindlII 300 bp fragment cloned in pCCH100.

Table 2. Relatedness of Chlorella cp ARS elements to the yeast ARS consensus sequence.

Sequence analysis of the C. ellipsoidea cpDNA sequence The nucleotide sequence of the C. ellipsoidea cpDNA HindlII fragment that contains the ARS activity is presented in Fig. 6. It was found that this HindlII fragment consisting of 305 bp contained a 215 bp sequence from the right end of the pUG515 insert, a BgllI site and a 88 bp sequence from the left end of the pUG513 insert. In the 215 bp part of pUG515 insert, an element related to the yeast ARS consensus sequence of 5' A / T TTTATPuTTT A / T 3' (1, 17) was detected (Fig. 6, on the lower strand at position 5 5 - 6 5 , Table 2). This region is flanked by an inverted repeat of 8 bp (position 39-48). A GC-rich block (GCGGGGC) at position 131-137 is interposed between an inverted repeat sequence of 9 bp that contains a Hogness box-like sequence in the 5 ' - - 3 ' order (position 123-144). This is similar to the cases of yeast ARS1 and ARS2 reported by Tschumper and Carbon (19). In addition, a 16 bp sequence overlapping this region AAAGTTTTATAAGCGG is tandemly repeated upstream of the element related to the ARS consensus sequence (position 10-25).

Yeast consensus

5

Position

5

5 5 - 65* 227 - 236* 244 - 253 233-242"

A / T TTTATPuTTT A / T 3' A

TTaAgG TTT

T

3'

5

TTTAcAcTT

A

3'

5'

TTTgaG

A

3'

TTT

Pu stands for purine. Nucleotides that differ from the consensus sequence are shown in lower case letters. (*) on the lower strand in Fig. 6.

On the other hand, the 88 bp sequence of pUG513 contained three elements of 10 bp that were related to the yeast ARS consensus sequence, two of which were located on a pair of 14 bp inverted repeat that were surrounding the third one (position 227-253). These elements are listed in Table 2. Flanking this region, two GC-rich blocks of 11-13 bp were found (position 2 5 6 - 2 6 6 and 273-285).

Discussion

Location of the Chlorella cpDNA A R S The cpDNA from C. ellipsoidea is a ca. 175 kbp circular molecule consisting of a 22.5 kbp inverted repeat, a 29.5 kbp small single copy region and a 98.5 kbp large single copy region (24). The ARS se50

AAGCTT GTGAAAGTTTTATAAG CGGAGAAGACTTTCACTTTTTCTACTAC GTAG~kAACCTTAA~ACATC TTC CAACACTTTC_AT~.TAT_T__CGCCTCTTCT GAAAGTGAAAAAGATGATGCATC~TTTGGAATTA~TGTAG ,

i

ioo ATAGATT GTATTTT GGAAGTG GAAGATCTAAGTGTAAC GTAGTTACACAAAGTTTTATAAGC GGGGCTTA TATCTAACATAAAACCTT CAC CTTCTAGATTCACATTGCATCAATGTGTTTCAAAATATTCGCCCC GAAT m

150

200

TAAAGCCTAATAGAGCTAC GCC GTAGCCCAGAACACAAGGTTTCTGGGTCTTACTTTGGACTTGAACGAA ATTTC GGATTATCTC GATGC GGCATC GGGTCTTGTGTTCCAAAGAC CCAGAATGAAACCTGAACTTGCTT D

•

"

250'

C AAGT~ CTAG~EA GAqATTCAC~TT~GAGTTq~kATGT GAA~CTGGGC C CTC GGGATCCAA~GGCCC GA 300 AC GG GAAGGACCTTTTTT CTAAAAGAAGCTT T C C C CTT C CT G GAAAAAAGATTTTCTT C GAA

Fig. 6. Nucleotide sequence of the C. ellipsoidea cpDNA 300 bp HindlII fragment. Solid boxes indicate the nucleotides that are similar to the yeast ARS consensus sequence of 5' A / T TTATPuTTT A / T 3' (1, 17). A dotted box indicates the BgllI cleavage site. Solid underlines indicate GC-rich stretches. Inverted and tandem repeats are shown by horizontal solid and dotted arrows, respectively.

250 quence characterized in this report was localized in the small single copy region proximal to the 23S rRNA gene. In this respect, its relative position is similar to the cases of tobacco (10), of petunia (11) and of the Chlamydomonas 02-04-03 cluster (20). However, the position of Chlorella ARS is symmetric to that of tobacco with respect to the rbcL position; if inversion of single copy regions located between the inverted repeats (12) occur in cpDNAs, then the ARS positions in Chlorella and tobacco become very similar. So far, we have not experimentally confirmed this inversion in the Chlorella cpDNA. Since on the cpDNA of C. reinhardii, the order of rRNA genes in inverted repeats is reversed and the ARS cluster (02-04-03) is located near the rbcL gene (20), it is difficult to find out any simple relevancy on the ARS positions between the cpDNAs of C. ellipsoidea and C. reinhardii. After all, the fact that all of the three typical cpDNAs (from Chlorella, tobacco and petunia) contain an ARS in the small single copy region proximal to the 23S rRNA gene may suggest some functional or structural importance of the ARS sequence on cpDNA. In this report, only one cpDNA ARS sequence was isolated and characterized because three recombinant plasmids isolated from transformants contained the same EcoRI 2.7 kbp fragment. Other ARS sequences of Chlorella cpDNA may be isolated by analysis of additional yeast transformants or by digestion of the cpDNA with other restriction enzymes to construct various recombinant plasmids.

Structure and properties of the Chlorella cpDNA ARS Subcloning experiments suggested that most ARS activity was confined within pUG515 but some sequence of pUG513 might be needed for its full function (Table 1). Sequencing analysis revealed the 215 bp sequence of pUG515 contained a set of elements that were reported to be needed in the ARS function (1, 19). The 88 bp sequence of pUG513 in pCCH100, on the other hand, contains unique sequences that may be candidates for exhibiting the helper function: three elements related to the ARS consensus sequence in an inverted repeat structure and two flanking GC-rich blocks (Fig. 6).

The plasmid pUG513 did not efficiently transform yeast to Ura ÷, after prolonged incubation (two weeks or more) small colonies appeared on selective plates. Therefore a weak ARS activity may be contained in this plasmid. Since pCCH101 did not produce such colonies (Table 1), the 88 bp sequence in pCCH100 or the remaining 700 bp HindlII-EcoRI fragment (Fig. 1) may preserve this activity. The total AT-content of the HindlII 305 bp fragment in pCCH100 is 60%. If three GC-rich blocks (11-13 bp) are omitted, the value increases to 65°-/0. A characteristic feature of the Chlorella cpDNA is a clustering of GC bases that was previously revealed by digesting the cpDNA with SmaI (recognition sequence CCCGGG). The GC content of this cpDNA is 36°70 (23), so that it is statistically expected to be cleaved with a GC-6 base recognizing restriction enzyme at 6 sites. SmaI virtually digested the cpDNA into many fragments (23 - Fig. 6). The EcoRI 2.7 kbp fragment in pCcl contains at least 6 SmaI sites and the GC-rich blocks in the HindlII 305 bp contain 2 sites. When the EcoRI 2.7 kbp fragment was hybridized with the cpDNA restriction fragments, several hybridizing bands appeared (1.2- 20 kbp, Fig. 2). This may be caused by unique sequences existing in this fragment such as the GC-rich blocks in the HindlII 305 bp fragment.

Relationship of the ARS to the replication origin of cpDNA So far, the replication origin of cpDNA has been mapped only in two cases by electron microscopy: in Euglena gracilis (7, 13) and in Chlamydomonas reinhardii (22). In both cases, the replication origins are located upstream of the 16S rRNA gene. These results are interesting in connection with the repetition of rRNA genes on cpDNAs and, at the same time, raise the question whether the replication origins are located at the similar position in other algae and higher plants. Therefore, the position of replication origin on the Chlorella cpDNA is of interest. Our preliminary results of electron microscopical study on SstI fragments of Chlorella cpDNA showed that fragments of 11.0+0.6 kbp (N= 20) in size contained a D-loop structure at the central part (Fig. 7); these twenty fragments were observed among several hundreds of electron

251 305 b p sequence c o n t a i n s two elements that are similar, t h o u g h in reverse order, to the A R C elem e n t I ( A a A A t A g C T T T t t t . c . A t ) at position 2 8 8 - 3 0 6 a n d the element II ( A . P u T . A c C A A G T ) at p o s i t i o n 2 0 3 - 214, respectively. Therefore the Chlorella A R S sequence m a y f u n c t i o n as the replication origin o f plasmids in C h l a m y d o m o n a s cells as well as Chlorella cells.

Acknowledgements We are very grateful to Drs M a k o t o Kageyama, Kenji Sakaguchi a n d Hiroshi M i z u t a n i for helpful discussions. We also t h a n k Miss Tomoko M u k o hara for expert typing o f the m a n u s c r i p t .

References

Fig. 7. Electron micrographs showing C. ellipsoidea cpDNA Sstl fragments containing D-loops. Arrow indicates D-loop. Bar represents 1 kbp.

micrographs taken at r a n d o m o n SstI fragments of the Chlorella c p D N A . Since the 2.7 kbp E c o R I f r a g m e n t c o n t a i n i n g the A R S sequence hybridized with the clone pCCS105 from the gene library that c o n t a i n e d a 8.45 kbp SstI fragment, the A R S seq u e n c e does n o t coincide with the p r i m a r y replicat i o n origin. I n fact, the 11 kbp SstI fragment is a d o u b l e b a n d o n agarose gel electrophoresis (data not shown) a n d was m a p p e d o n the inverted repeat sequence closely linked to the r R N A o p e r o n (24) by Southern hybridization (Fig. 4). Also in C h l a m y d o m o n a s reinharclii, the p r i m a r y replicat i o n origin did n o t show A R S activity a n d neither A R S sequence so far o b t a i n e d did n o t coincide with the replication origins (8, 14, 21). A n o t h e r m a t t e r o f c o n c e r n is the possibility o f the A R S sequence p r o m o t i n g a u t o n o m o u s replicat i o n also in Chlorella cells. Rochaix et al. characterized three c p D N A segments p r o m o t i n g a u t o n o m o u s replication in C. reinhardii (ARC) (14). O n e o f t h e m also showed A R S activity. It is worth p o i n t i n g out that the Chlorella A R S H i n d I I I

1. Broach JR, Li YY, Feldman J, Jayaram M, Abraham J, Nasmyth KA, Hicks JB: Localization and sequence analysis of yeast origins of DNA replication. Cold Spring Harbor Symp Quant Biol 47:1165- 1173, 1982. 2. Davis RW, Botstein D, Roth JR: Advanced bacterial genetics: a manual for genetic engineering. Cold Spring Harbor Laboratory, New York, 1980, pp 228- 230. 3. Fukuda Y, Yamada T, Yamasaki M, Tamura G, Sakaguchi K: Cloning of DNA replicational origins of Vinca rosea chromosomal DNA and Chlorella ellipsoidea chloroplast DNA. In: Fujiwara A (ed) Plant Tissue and Cell Culture: Proc 5th Intl Cong Plant Tissue and Cell Culture. Maruzen Co., Tokyo, 1982, pp 521- 522. 4. Fukuda Y: Isolation of replicational origins and promoter regions for the transcription from plant DNA. Ph.D. Thesis of the University of Tokyo, 1983. 5. Horrander 3, Kempe T, Messing J: Construction of improved M13 vectors using oligonucleotide-directed mutagenesis. Gene 26:101 - 106, 1983. 6. Ito H, Fukuda Y, Murata K, Kimura A: Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153:163 - 168, 1983. 7. Koller B, Delius H: Origin of replication in chloroplast DNA of Euglena gracilis located close to the region of variable size. EMBO J 1:995-998, 1982. 8. Loppes R, Denis C: Chloroplast and nuclear DNA fragments from Chlamyclomonas promoting high frequency transformation of yeast. Curr Genet 7:473-480, 1983. 9. Maniatis T, Fritsch EF, Sambrook J: Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, New York, 1982. 10. Ohtani T, Uchimiya H, Kato A, Harada H, Sugita M, Sugiura M: Location and nucleotide sequence of a tobacco chloroplast DNA segment capable of replication in yeast. Mol Gen Genet 195:1-4, 1984. 11. Overbeeke N, Haring MA, John H, Nijkamp J, Kool AJ:

252

12. 13.

14.

15.

16.

17.

18.

19.

Cloning of Petunia hybrida chloroplast DNA sequence capable of autonomous replication in yeast. Plant Mol Biol 3:235-241, 1984. Palmer JD: Chloroplast DNA exists in two orientations. Nature 301:92-93, 1983. Ravel-Capius P, Heizmann P, Nigon V: Electron microscopic localization of the replication origins of Euglena gracilis chloroplast DNA. Nature 300:78-81, 1982. Rochaix J-D, van Dillewijin J, Rahire M: Construction and characterization of autonomously replicating plasmids in the green unicellular alga Chlamydomonas reinhardii. Cell 36:925-931, 1984. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463 - 5467, 1977. Southern EM: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503 - 517, 1975. Stinchcomb DT, Thomas M, Kelly J, Selker E, Davis RW: Eukaryotic DNA segments capable of autonomous replication in yeast. Proc Natl Acad Sci USA 77:4559-4563, 1980. Struhl K, Stinchcomb DT, Scherer S, Davis RW: High frequency transformation of yeast: Autonomous replication of hybrid DNA molecules. Proc Natl Acad Sci USA 76:1035- 1039, 1979. Tschumper G, Carbon J: Delta sequences and double symmetry in a yeast chromosomal replicator region. J Mol Biol

156:293 - 307, 1982. 20. Vallet J-M, Rahire M, Rochaix J-D: Localization and sequence analysis of chloroplast DNA sequences of Chlamydomonas reinhardii that promote autonomous replication in yeast. EMBO J 3:415-421, 1984. 21. Vallet J-M, Rochaix J-D: Chloroplast origins of DNA replication are distinct from chloroplast ARS sequences in two green algae. Curr Genet 9:321- 324, 1985. 22. Waddell J, Wang X-M, Wu M: Electron microscopic localization of the chloroplast DNA replicative origins in Chlamydomonas reinhardii. Nucl Acid Res 12:3843 - 3856, 1984. 23. Yamada T: Isolation and characterization of chloroplast DNA from Chlorella ellipsoidea. Plant Physiol 70:92- 96, 1982. 24. Yamada T: Characterization of inverted repeat sequence and ribosomal RNA genes of chloroplast DNA from Chlorella eflipsoidea. Curr Genet 7:481- 487, 1983. 25. Yamada T, Fukuda Y, Sakaguchi K: Protoplast and chloroplast of Chlorella: The ARS gene of Chlorella chloroplast replicates in yeast. In: Potrykus I, Harms CT, Hinnen A, Hutter R, King JP, Shillito RD (eds) Protoplast 1983. Proc 6th Intl Protoplast Symp. Birkhauser Verlag, Basel, 1983, pp 135- 136.

Received 21 August 1985; in revised form 11 December 1985; accepted 16 December 1985.