Meat Science 100 (2015) 283–290

Contents lists available at ScienceDirect

Meat Science journal homepage: www.elsevier.com/locate/meatsci

Characterisation and detection of spoilage mould responsible for black spot in dry-cured fermented sausages Daniel Lozano-Ojalvo a, Alicia Rodríguez a, Mirian Cordero a, Victoria Bernáldez a, Mariana Reyes-Prieto b, Juan J. Córdoba a,⁎ a b

Higiene y Seguridad Alimentaria, Instituto de Carne y Productos Cárnicos (IProCar), Universidad de Extremadura, Avda. de la Universidad, s/n, 10003 Cáceres, Spain Institut Cavanilles de Biodiversitat i Biologia Evolutiva, Universitat de València, 46071 València, Spain

a r t i c l e

i n f o

Article history: Received 31 May 2014 Received in revised form 23 September 2014 Accepted 5 October 2014 Available online 12 October 2014 Keywords: Black spot spoilage Dry-cured fermented sausages Cladosporium qPCR

a b s t r a c t Moulds responsible for black spot spoilage of dry-cured fermented sausages were characterised. For this purpose, samples were taken from those dry-cured fermented sausages which showed black spot alteration. Most of the mould strains were first tentatively identified as Penicillium spp. due to their morphological characteristics in different culture conditions, with one strain as Cladosporium sp. The Cladosporium strain was the only one which provoked blackening in culture media. This strain was further characterised by sequencing of ITS1-5.8S-ITS2 rRNA and β-tubulin genes. This mould strain was able to reproduce black spot formation in dry-cured fermented sausage ‘salchichón’ throughout the ripening process. In addition, a specific and sensitive real-time PCR method was also developed to detect Cladosporium oxysporum responsible for the black spot formation in sausages. This method could be of great interest for the meat industry to detect samples contaminated with this mould before spoilage of product avoiding economic losses for this sector. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Dry-cured fermented meat sausages are produced through the world (Fonseca, Ouba, Franco, & Cárballo, 2013; Krkić et al., 2013; López-Díaz, Santos, García-López, & Otero, 2001; Tabanelli et al., 2012). The environmental conditions in the manufacturing rooms for dry-cured fermented sausages production favour microbial growth, especially fungi, on the surface of products (Comi, Orlic, Redzepovic, Urso, & Iacumin, 2004; Mizakovà, Pipovà, & Turek, 2002). Some mould strains may produce undesirable effects on the quality of these products such as off-flavours, colour of conidia and floccose mycelium on the casing (Ludemann, Greco, Rodríguez, Basílico, & Pardo, 2010), with one of these undesirable effects being the formation of black spots. Black spots as a result of microbial growth in different meat products such as dry-cured “Serrano” and Iberian dry-cured hams have been previously reported (Andrade, Rodas, Durbán, Moya, & Córdoba, 2012; Garriga, Ehrmann, Arnau, Hugas, & Vogel, 1998; Hugas & Arnau, 1987). This alteration has not hitherto been reported in dry-cured fermented sausages, although lately it is usually found in this kind of products in the meat industry. Black spots are localized very superficially on the casing of the sausage. The spoiled and browned area in the sausages is not characterised by an anomalous odour or texture. However, the

⁎ Corresponding author. Tel.: +34 927 257 125; fax: +34 927 257 110. E-mail address: [email protected] (J.J. Córdoba). URL: http://higiene.unex.es/ (J.J. Córdoba).

http://dx.doi.org/10.1016/j.meatsci.2014.10.003 0309-1740/© 2014 Elsevier Ltd. All rights reserved.

presence of black spots on the surface of dry-cured fermented sausages could be an important factor for consumer acceptance when this kind of meat product is commercialized as whole pieces. As a result, black spot spoilage may provoke important economic losses for dry-cured sausages manufacturing industries. To control black spots in dry-cured fermented sausages it is first necessary to characterise micro-organisms involved in this alteration. In “Serrano” dry-cured ham black spots were caused by growth of Carnimonas nigrificans (Garriga et al., 1998; Hugas & Arnau, 1987) and in dry-cured Iberian ham Pseudomonas fluorescens were found (Andrade et al., 2012). However, in chilled meat black spots due to the growth of several species of moulds including Cladosporium cladosporioides, Cladosporium herbarum, Penicillium hirsutum and Aureobasidium pullulans have been described (Gill, Di Menna, & Lowry, 1981). Therefore, although several micro-organisms have been reported as responsible for black spot spoilage in meat products, in drycured fermented sausages micro-organisms involved in this spoilage still remain unclear. The growth of moulds over black spots on drycured fermented sausages suggests that in this product the alteration has a fungal origin. The aim of this work was to identify the moulds responsible for black spot spoilage on dry-cured fermented sausages. For an accurate characterisation of this type of spoilage, those moulds isolated from the black spots were used to reproduce the above alteration on dry-cured fermented sausages. In addition, an accurate and rapid real-time PCR (qPCR) method to detect and quantify moulds involved in this alteration was developed.

284

D. Lozano-Ojalvo et al. / Meat Science 100 (2015) 283–290

2. Materials and methods 2.1. Sampling and mould isolation Samples were taken from dry-cured fermented sausages produced by a major company showing black spots. Ten grammes of sample size (1–4 mm depth) of the black spots from spoiled sausages was collected aseptically and homogenised in a Stomacher lab-blender during 1 min with 90 mL of sterile peptone water (0.1%, w/v) at room temperature. For an appropriate mould isolation, ten-fold serial dilutions were carried out with the same diluent and 0.1 mL was spread onto the surface of Potato Dextrose Agar (PDA, Scharlau Chemie S.A., Spain), Malt Extract Agar (MEA, 2% malt extract, 2% glucose, 0.1% peptone, 2% agar) and Dichloran Glycerol 18% Agar (DG18, Oxoid, Basingstoke, UK). Plates were incubated at two different temperatures (25 °C and 30 °C) for 4 days. About 20% of the colonies were randomly selected and subcultured (Ordóñez, 1979) according to morphological features including those isolates able to produce blackening in the former culture media. Successive isolation steps depended on picking a sample of hyphae or spores and placing this sample on a fresh PDA, MEA and DG18 plate as a point inoculum. Purity was subsequently judged by uniformity in appearance of the colony and pure colonies obtained were inoculated onto a slant of PDA and incubated at 25 °C for 4 days until being ready for identification. Spore dilution of each isolated mould was stored at −80 °C in glycerol solution (10%, w/v). The selected isolates were routinely cultured on the same medium on which they had been isolated for further assays. 2.2. Morphological strain identification Isolated moulds were initially examined by cellular morphology under a microscope. Each suspicious blackening-producing isolate was grown on Czapek Yeast Extract Agar (CYA), MEA and Glycerol 25% Nitrate Agar (GNA) from Oxoid for 7 days at 25 °C, and also on CYA at 5 °C and 37 °C (Núñez, Rodríguez, Bermúdez, Córdoba, & Asensio, 1996). They were tentatively characterised by morphological characteristics according to Pitt and Hocking (2009) and Núñez et al. (1996) as Penicillium spp. In addition, from the different isolates, only one different strain that produced blackening in the culture media was further tentatively characterised by the former morphological characterisation such as Cladosporium spp. This strain was named as Cladosporium BPS (Blackening Producing Strain). 2.3. Molecular identification of Blackening Producing Strain Cladosporium BPS The strain BPS, that produced blackening in the culture media, was further characterised by sequencing using β-tubulin gene and ITS15.8S-ITS2 region as targets. 2.3.1. DNA extraction Cladosporium BPS was inoculated by three-points on MEA and incubated at 25 °C for 4 days. Grown mycelium was scraped off the agar and about 50 mg of isolated mycelium was used for genomic DNA extraction following the method described by Sánchez, Rodríguez, Casado, Martín, and Córdoba (2008). DNA concentration was quantified spectrophotometrically with a Biophotometer Eppendorf (Eppendorf AG, Germany). Purified DNA was dissolved in 50 μL of sterile ultrapure water and stored at −20 °C until use for PCR reactions. 2.3.2. Sequencing of β-tubulin and ITS1-5.8S-ITS2 rRNA genes by PCR β-Tubulin and ITS1-5.8S-ITS2 rRNA gene sequences of Cladosporium BPS were amplified by PCR. PCR targeted against β-tubulin housekeeping gene was performed using Bt2a and Bt2b primers (Glass & Donaldson, 1995). The amplification program used was: 1 cycle of 5 min at 94 °C, 32 cycles of 1 min at 94 °C, 1 min at 55 °C and 1 min

at 72 °C and finally 1 cycle of 5 min at 72 °C. PCR reaction to amplify the ITS1-5.8S-ITS2 region was performed using ITS1 and ITS4 primers (White, Bruns, Lee, & Taylor, 1990). The amplification program used was: 1 cycle of 5 min at 94 °C, 40 cycles of 1 min at 94 °C, 1 min at 50 °C and 2 min at 72 °C and finally 1 cycle of 2 min at 72 °C. After amplification, PCR products along with a DNA molecular size marker of 2.1–0.15 kbp (Roche Farma, S.A., USA) were detected on 1% (w/v) agarose gels stained with ethidium bromide (0.5 μg/mL) and visualized under an UV transilluminator. Amplification products were then purified using the MinElute® PCR Purification Kit according to the manufacturer's recommendations (QIAGEN, Hilden, Germany) and sequenced with the same primers used in the amplification steps. To avoid the amplification of artefact products, sequencing was performed from both the 5′ and the 3′ ends of each PCR product. Two sense and antisense strand sequences were edited and assembled into a consensus sequence of corresponding amplicon. 2.3.3. Sequence analysis To determine the closest known relatives of the obtained β-tubulin and the ITS1-5.8S-ITS2 partial sequences, searches were performed on the GenBank database with the Basic Local Alignment Search Tool (BLAST) program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Both sequences were analysed separately and 97% similarity was used as the criterion for species identification. Phylogenetic analysis of data was performed using Bayesian inference (BI) with MrBayes version 3.2.1 software. The best nucleotide substitution model was estimated with jModeltest 2.1.3, as general time reversible with estimates of invariant sites and gamma-distribution among-site rate variation. The analysis was rooted, treating Passalora fulva as out-group. Nodal support was estimated by posterior probabilities using the sumt command. 2.4. Develop of a specific real time PCR to quantify Cladosporium BPS For a rapid and easy detection of the blackening-producing strain Cladosporium BPS, a qPCR has been optimised by using the SYBR Green methodology. To develop this method a specific pair of primers, BPS-F (5′CAACGAGGTGTGAAAATCCGA3′) and BPS-R (5′AGGCCTGTGA TGGGATGTGA3′), was designed on the basis of partial sequence alignments of the β-tubulin gene of various mould species usually present in dry-cured fermented sausages (Asefa et al., 2010) deposited at the National Center for Biotechnical Information (NCBI) and the sequenced β-tubulin partial region of the strain BPS (GenBank accession numbers: AY496000, AY495999, AF603238, JF909956, FJ004438, AY674323, JX241680, JX535302, AY819975, AY819976, AY674319, AY674317, JF521538, FJ004434, JX545088, JN394586, HQ285589, HM803081, JF521510, AY674367, JQ217372 and AY371601.1). Sequences were edited and aligned by the ClustalW2 program (www.ebi.ac.ukN/tools/ msa/clustalW2). Alignment showed nonconserved regions between the Cladosporium BPS β-tubulin partial sequence and the remaining ones which were selected to design the primer pair using the Primer Express software (Applied Biosystems, Foster City, USA). This qPCR protocol was carried out in a final volume of 12.5 μL, containing 2.5 μL of template DNA, 6.25 μL of 2× SYBR Premix Ex Taq™ (Takara Bio Inc., Japan), 0.1 μL of 50x ROX Reference Dye (Takara Bio Inc.) and 600 nM of both BPS-F and BPS-R primers. The amplification program used was: 1 cycle of 2 min at 50 °C, 1 cycle of 10 min at 95 °C and 40 cycles of 95 °C for 15 s and 70 °C for 1 min. After the final PCR cycle, melting curve analysis of the PCR products was performed by heating to 60–95 °C and continuous measurement of the fluorescence to verify the PCR product. Threshold cycle (Ct) values represent the PCR cycle in which an increase in fluorescence, over a defined threshold, first occurred for each amplification plot. The specificity of primer pair was tested on genomic DNA from selected species of Penicillium, Aspergillus and Emericella which usually are present in dry-cured fermented sausages (Table 1). To evaluate the specificity of the designed primers for the SYBR Green assay, the

D. Lozano-Ojalvo et al. / Meat Science 100 (2015) 283–290 Table 1 Data from the developed qPCR by using DNA (1 μg/μL) from references fungal strains used in specificity study. Species designation

Strain Reference

a

b

Cladosporium oxysporum BPS Aspergillus aurantiogriseum A. aurantiogriseum A. aurantiogriseum A. awamori A. flavus A. foetidus A. parasiticus A. parasiticus A. vesicolor Emericella heterothallica Penicillium camemberti P. camemberti P. carneum P. commune P. griseofulvum P. griseofulvum P. nalgiovense P .nordicum P. nordicum P. nordicum P. nordicum P. nordicum P. solitum P. solitum P. solitum P. thymicola

c

20.04 ± 0.09 bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD 29.45 ± 0.32 bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD bLOD

84.30 67.00 70.40 66.30 71.85 67.35 66.65 78.15 66.80 70.80 77.10 72.40 72.60 66.30 79.05 66.80 67.35 82.90 82.90 82.90 82.90 66.80 78.70 75.30 66.80 66.80 66.65

Isolate d CECT 2320 CECT 2918 e CBS 112021 CBS 101702 CECT 2687 CBS 101708 CECT 2688 CECT 2682 CECT 2903 CBS 488.65 f AMP 61 CBS 273.97 CBS 468.95 CBS 247.32 CBS 485.84 CBS 110.420 Isolate Isolate Isolate Isolate Isolate CBS 110769 Isolate Isolate Isolate Isolate

Ct ± SD

Tm (°C)

bLOD: Under Limit of detection of method. a Data represent the mean threshold cycle (Ct) ± standard deviation (SD) of the 3 independent experiments each consisting of triplicate samples. b Melting temperature (Tm). c Isolated strain from spoiled dry-cured fermented sausages reported in this study. d Spanish type culture collection. e Centraalbureau voor Schimmencultures (The Netherlands). f Australian mycological panel.

melting temperature (Tm) was calculated and compared with that deduced from the sequence of the expected fragment. The sensitivity of the optimised qPCR to quantify Cladosporium BPS was evaluated in dry-cured fermented sausage slices inoculated with different levels of spores ranging from 1.44 to 6.44 log cfu/cm2. The standard curve which relates Ct values with log cfu/cm2 from inoculated slices was built following the procedure described by Rodríguez, Rodríguez, Luque, Justesen, and Córdoba (2011).

285

Pulsifier equipment. The filtrate which contains spores and the mycelium that grew on the dry-cured fermented sausages slices was used for determining blackening-producing mould counts (cfu/cm2) by plating after growing on MEA and incubated at 25 °C for 4 days. In addition, this filtrate was also used to determine counts of Cladosporium BPS by using the qPCR method detailed in Section 2.4. For this, DNA was extracted using the “CTAB-EZNA” method previously optimised by Rodríguez, Rodríguez, Luque, Justesen, and Córdoba (2012). Cladosporium BPS fungal load by qPCR was calculated after replacing of Ct values from the drycured fermented sausage samples in the standard curve obtained in Section 2.4.

2.6. Growth of Cladosporium BPS and production of the black spot alteration in dry-cured fermented sausage ‘salchichón’ throughout the ripening process The capability of Cladosporium BPS to produce black spots was further evaluated in dry-cured fermented sausages ‘salchichón’ throughout the ripening process. In this experiment, 10 sausages ‘salchichón’ were manufactured by a Spanish company following the traditional formulation: 51.67% lean pork meat, 40% pork back fat, 5% water, 2% sodium chloride, 1% lactose, 0.05% sodium ascorbate, 0.015% sodium nitrite, 0.03% potassium nitrate, 0.05% black pepper and 0.05% white pepper, were used. Sausages ‘salchichón’ were separated into two different batches of 5 sausages each one. One batch was inoculated by spraying with 100 mL of a spore solution of Cladosporium BPS containing 106 cfu/mL. Sausages from the other batch were not inoculated and they were used as controls. Inoculated and non-inoculated sausages ‘salchichón’ were ripened in the same drying room following the ripening process consists of a cold storage (4 days, temperature (T) 5 °C and relative humidity (RH) 90%), a warm storage (1 week, at increasing T from 5 to 13 °C and decreasing RH from 90 to 85%) and a drying/ ripening stage (3 weeks, T 12–14 °C and RH 82–84%). To determine mould growth, sampling was carried out at the end of ripening process. For this purpose, a surface area of 20 cm2 of each dry-cured fermented sausage ‘salchichón’ was completely scraped off by a sterilised steel scalpel and homogenised with 10 mL of Tris–HCl buffer (pH 8.0) in a filter bag BagPage (Interscience), using a Pulsifier equipment. Next, filtrate was processed for determining mould counts (cfu/cm2) by plating and by qPCR as described in Section 2.5 for slices of dry-cured fermented ‘salchichón’.

2.7. Statistical analysis 2.5. Growth of Cladosporium BPS and production of the black spot alteration in slices of dry-cured fermented ‘salchichón’ The ability of the Cladosporium BPS to reproduce black spots in drycured fermented sausages was first evaluated under sterile controlled conditions on slices of dry-cured fermented sausage “salchichón”. Hence, slices of commercial non-sterile dry-cured fermented sausages with water activity of 0.89 measured with Novasina Lab Master water activity metre from Novasina AG (Switzerland) were inoculated with the blackening-producing strain. Slices with a surface of 25 cm2 and approximately 5 g of weight were aseptically prepared and placed separately in pre-sterilised orthogonal receptacles made of methacrylate, where the humidity was kept constant by a saturated KCl solution (water activity 0.84) placed at the bottom of the receptacles. The samples were inoculated separately on the surface with spores of Cladosporium BPS at a final concentration of 4 log cfu/cm2. In addition, negative controls from non-inoculated slices of “salchichón” were also analysed. Both groups of samples were incubated for 20 days at 25 °C and sampling was carried out in triplicate. After incubation time, samples of 5 g were homogenised with 10 mL of Tris–HCl buffer (pH 8.0) in a filter bag BagPage (Interscience, Paris, France) using a

All the statistical analyses were performed with the GraphPad Prism 5.0 software. The data were analysed by one-way analysis of variance (ANOVA) to evaluate any significant difference within and between groups. Afterwards, Tukey's test was applied to compare the obtained mean values. Statistical significance was set at p ≤ 0.05.

3. Results 3.1. Characterisation by morphological tests Characterisation analyses using morphological tests of the fungi strains obtained in the former culture media showed eleven different strains. The most frequently isolated species in black spot samples of spoiled dry-cured fermented sausages belonged to the genus Penicillium (data not shown) and only one, the strain BPS, showed blackening on MEA at 25 °C. The isolated strain BPS was tentatively identified by the morphological characteristics in CYA, MEA and GNA at different culture conditions at genus level as Cladosporium. Further characterisation of this strain was achieved by DNA sequencing.

286

D. Lozano-Ojalvo et al. / Meat Science 100 (2015) 283–290

Fig. 1. Maximum likelihood phylogenetic tree of isolated Blackening Producing Strain (BPS) constructed from aligned concatenated DNA sequences of β-tubulin and ITS1-5.8S-ITS2 rRNA genes based on Bayesian inference analysis. The bootstrap values were shown as percentages (%) on each branch, strains references were indicated beside the name of the strains and scale bar represented distance values. Passalora fulva was included as an outgroup. Fungal Type Culture Collections were: CBS: Centraalbureau voor Schimmencultures (The Netherlands); EXF: Culture Collection of Extremophilic Fungi (Slovenia); CPC: Culture Collection of Pedro Crous, housed at CBS (The Netherlands); ATCC: American Type Culture Collection; dH: de Hoog Culture Collection, housed at CBS (The Netherlands); FSU: Pilz-Referenz-Zentrum Jena (Germany).

D. Lozano-Ojalvo et al. / Meat Science 100 (2015) 283–290

287

45

y = -3.399x + 44.959 R² = 0.9813

Threshold cycle (Ct)

40 35 30 25 20 15 10 5 0

0

1

2

3

4

5

6

7

Log10 cfu/cm2 Fig. 2. Standard curve showing the log cfu/cm2 versus threshold cycle (Ct) values of developed qPCR method designed for detection and quantification of Cladosporium oxysporum Blackening Producing Strain (BPS). This curve was generated with DNA extracted from inoculated slices of dry-cured fermented ‘salchichón’.

3.2. Identification by β-tubulin and ITS genes sequencing The almost complete sequence of β-tubulin (638 bp) gene (GenBank accession number KM510514) was used to determine its taxonomic affiliation. According to the alignments and the high scores obtained after BLAST analysis, Cladosporium BPS displayed identical similarity scores (95%) with the β-tubulin gene sequence of Cladosporium sp. Since the β-tubulin gene sequence was not sufficient to identify BPS at species level, its ITS1-5.8S-ITS2 region (GenBank accession number KM276818) was obtained (534 bp) and an alignment using BLAST analysis exhibited the same sequence identity (100%) with the ITS1-5.8SITS2 rRNA gene sequences of several species of Cladosporium genus within C. cladosporioides and Cladosporium uredinicola, among others. In order to obtain a more suitable identification of the strain BPS affiliated with the Cladosporium genus, the phylogenetic position of this strain was analysed by comparing β-tubulin gene partial sequences as well as ITS1-5.8S-ITS2 region sequences with those of phylogenetically related fungi included. The resulting alignments consisted of 456 positions for the ITS rDNA sequences and of 571 positions for the β-tubulin gene sequences. Some discrepancies between the two phylogenies were found in the relationship among the strains included in the analysis and several Cladosporium species were seen as polyphyletic. The strain BPS was placed in an unresolved group with other Cladosporium strains in the two phylogenies (Fig. 1). For β-tubulin gene the bootstraps ranged from 63 to 100% and its closed relative was Cladosporium oxysporum (data not shown). According to ITS1-5.8S-ITS2 tree, BPS was closely related to several Cladosporium species such as C. cladosporioides or C. oxysporum (data not shown). To achieve full exploitation of the information obtained from the sequences of the ITS1-5.8S-ITS2 and the β-tubulin genes, a tree was constructed based on the concatenated datasets (Fig. 1). This tree showed an excellent bootstrap support (100%) being the strain BPS closely related to several C. oxysporum (Fig. 1). From these results the strain BPS was tentatively characterised as C. oxysporum.

3.3. Specificity and sensitivity of a real-time PCR method to evaluate the implantation of mould responsible for black spots The best primer pair concentration showing the lowest Ct values with an adequate fluorescence for a given target concentration was selected for further analyses. Optimal BPS-R and BPS-F concentrations used were 600 nM. With the optimised conditions detailed in Section 2.4, the analysis of the melting curve showed just one amplified product (83 bp) being the Tm value 84.30 ± 0.40 °C. The specific qPCR product was only obtained when DNA from C. oxysporum BPS was used. In addition, only C. oxysporum BPS showed

Ct values lower than 20 and a Tm value of 84.3 °C whilst the remaining assayed strains showed Tm values ranged from 66.3 to 82.9 °C and they showed Ct values higher than 29 (Table 1). The sensitivity of the optimised qPCR to quantify the strain BPS was evaluated on inoculated dry-cured fermented sausages slices. The standard curve constructed using the Ct values and log cfu/cm2 of C. oxysporum BPS (Fig. 2). The linear regression equation was y = −3.39x + 44.95 and a good linear correlation was also obtained over the range 6.4 log to 1.4 log cfu/cm2 (R2 = 0.98). The efficiency value for this qPCR was 97.23%. 3.4. Growth of Cladosporium BPS strain and formation of black spots in slices of dry-cured fermented ‘salchichón’ C. oxysporum BPS inoculated slices of dry-cured fermented ‘salchichón’ showed similar levels of mould total counts than noninoculated control slices after 20 days of incubation time. Levels of C. oxysporum BPS were higher than 6 log cfu/cm2 in inoculated samples whilst no blackening-producing colonies were detected in control samples (Table 2). The level of C. oxysporum BPS determined by qPCR in inoculated samples was very close to that obtained by plating (Table 2). No significant differences between counts obtained by these two ways were obtained (p N 0.05). Furthermore, DNA extracted from noninoculated control samples amplified faint non-specific products (Tm values ranged between 77.6 and 83.2 °C) by means the optimised qPCR. After 20 days of incubation inoculated slices showed black spot alteration below mould mycelium growth (Fig. 3) whilst any black spot was detected in control samples at this time of incubation. 3.5. Growth of Cladosporium BPS strain and formation of black spots in dry-cured fermented sausage ‘salchichón’ throughout the ripening process Total mould counts determined by plate counting showed higher levels in inoculated ‘salchichón’ (8.45 log cfu/cm2) than in uninoculated Table 2 Quantification of total moulds load by counting plate (log cfu/cm2) and quantification of the strain Cladosporium oxysporum Blackening Producing Strain (BPS) load by counting plate and by qPCR in inoculated and uninoculated slices of dry-cured fermented sausage after 20 days of incubation at 25 °C (initial inoculum was 4.0 log cfu/cm2). Slices of dry-cured fermented sausage Inoculated Non-inoculated

Average total counts (log cfu/cm2) Moulds load by plate

BPS by plate

BPS by qPCR

9.62 ± 0.61a,1 8.70 ± 0.90 a,1

6.37 ± 0.21 a,2 ND b,2

6.80 ± 0.39 a,2 ND b,2

ND: Not detected. Values with different letters as superscript along a column are significantly different (p ≤ 0.05). Values of total fungal counts as well as Cladosporium oxysporum BPS load by counting plate and by qPCR with different numbers along a row are significantly different (p ≤ 0.05).

288

D. Lozano-Ojalvo et al. / Meat Science 100 (2015) 283–290

B

A

Fig. 3. Reproduction of black spots alteration caused by Cladosporium oxysporum Blackening Producing Strain (BPS) in slices of dry-cured fermented ‘salchichón’ inoculated with the above strain and incubated for 20 days at 25 °C. (A) Slice of ‘salchichón’ with fungal growth after 20 days of incubation. (B) Slice of ‘salchichón’ after 20 days of incubation showing blackening below after scraping the mould mycelium growth of the surface. Initial inoculum of BPS strain was 4 log cfu/cm2.

samples (7.81 log cfu/cm2) (Table 3). C. oxysporum BPS counts determined by plating reached significantly higher levels in inoculated (7.57 log cfu/cm2) than in control (4.70 log cfu/cm2) ‘salchichón’ (Table 3). The quantification of the strain BPS load by the designed qPCR reached levels very similar to those found by plating. No differences (p N 0.05) between counts obtained by these two methods were observed in both inoculated and control sausages. After 32 days of ripening of dry-cured fermented sausages ‘salchichón’ were observed an important amount of black spots below fungal mycelium in those samples inoculated with C. oxysporum BPS whilst none was detected in those non-inoculated ones (Fig. 4).

4. Discussion In this work micro-organisms responsible for black spot spoilage in dry-cured fermented sausages were investigated. Most of the isolated strains from black spots were first tentatively characterised at genus level as Penicillium and only some of the isolates were identified as Cladosporium sp. according to the morphological characteristics in CYA, MEA and GNA at different culture conditions (Núñez et al., 1996; Pitt & Hocking, 2009). Penicillium sp. have been reported as the most habitually found moulds in dry-cured meat products and fermented sausages due to its tolerance to high level of salt concentration present in these products (Asefa et al., 2010; Sonjak, Ličen, Frisvad, & Gunde-Cimerman, 2011). In addition, many species of Cladosporium sp. are distributed worldwide and they are common in indoor environments, air and foods (Samson, Hoeskstra, Frisvad, & Filtenborg, 2002). In contrast to Penicillium genus, Cladosporium sp. is generally not recognised as a mould genus which colonises dry-cured meat products.

Table 3 Quantification of total moulds load by counting plate (log cfu/cm2) and quantification of Cladosporium oxysporum Blackening Producing Strain (BPS) load (log cfu/cm2) by counting plate and by developed qPCR in inoculated and uninoculated dry-cured fermented sausage ‘salchichón’ after 32 days of ripening (initial spray inoculation: 100 mL of a solution of spores of Cladosporium oxysporum BPS containing 6.0 log cfu/mL). Dry-cured fermented sausage ‘salchichón’ Inoculated Non-inoculated

Average total counts (log cfu/cm2) Moulds load by plate a,1

8.45 ± 0.25 7.81 ± 0.60 b,1

BPS by plate

BPS by qPCR a,2

7.57 ± 0.04 4.70 ± 0.01 b,2

7.09 ± 0.07 a,2 4.23 ± 0.17 b,2

Values with different letters as superscript along a column are significantly different (p ≤ 0.05). Values of total fungal counts as well as Cladosporium oxysporum BPS load by counting plate and by qPCR with different numbers along a row are significantly different (p ≤ 0.05).

However, xerotolerant and halotolerant Cladosporium sp. have been also isolated in dry-cured fermented sausages or in processing plants of these products (Canel, Wagner, Stenglein, & Ludemann, 2013; Sonjak et al., 2011; Sørensen, Jacobsen, Nielsen, Frisvad, & Koch, 2008). Isolates of Cladosporium producers of black spots were morphologically characterised in CYA, MEA and GNA such as the same strain (Cladosporium BPS). This strain was further characterised by sequencing of ITS1-5.8S-ITS2 rRNA and β-tubulin genes. Sequence analysis of these two genes confirmed that the strain BPS came from Cladosporium genus, and its concatenated phylogenetic analysis of the ITS1-5.8s-ITS2 rRNA and β-tubulin genes showed to be closely related to C. oxysporum. These genes have been previously used for molecular identification and phylogenetic analysis of concatenated mitochondrial genes proposed as a useful tool to fungal identification (Krimitzas et al., 2013). Therefore, presumptively the causative agent of black spots in drycured fermented sausages was characterised as C. oxysporum. Prior to the present work, this strain has not been reported as a producer of black spots in dry-cured meat products, though Gill and Lowry (1982) reported black spot spoilage in frozen meat caused by growth of Cladosporium sp. A qPCR method was developed to quantify C. oxysporum BPS in the dry-cured fermented sausages to be used as useful tool for evaluating contamination of this mould in processing plant. This method was also used to quantify the strain C. oxysporum BPS in the subsequent assay designed to evaluate the ability of this strain to reproduce black spots spoilage in inoculated sausages. Once known partial sequence of β-tubulin gene of C. oxysporum BPS, a pair of primers was designed after alignment of this sequence and those of several mould species usually present in dry-fermented sausages (Asefa et al., 2010). β-Tubulin gene has been recently used to develop qPCR methods to quantify total fungal counts (Rodríguez, Rodríguez, Luque, Justesen, & Córdoba, 2012; Rodríguez, Rodríguez, Martín, Delgado, & Córdoba, 2012) and also to quantify specific species such as Cladosporium fulvum (Yan, Zhang, Dung, & Ma, 2008). However, it has not been reported any qPCR method to detect C. oxysporum. Concentration of primers was optimised to avoid primer-dimers formation and to increase efficiency and specificity of the amplification process. In addition, the emphasis was on generating positive results using the most efficient combination of them and thermal cycler temperature profile. The most appropriate concentrations and conditions are in the range level as other reported SYBR Green qPCR method to quantify fungal species (Yang, Van der Lee, Yang, Yu, & Waalwijk, 2008). Specificity of the developed qPCR method was confirmed since it provided a good discrimination between C. oxysporum BPS and nonproducing blackening species tested. Only an 83 bp-product with a Tm

D. Lozano-Ojalvo et al. / Meat Science 100 (2015) 283–290

A

C

289

B

D

Fig. 4. Reproduction of black spots alteration caused by Cladosporium oxysporum Blackening Producing Strain (BPS) in dry-cured fermented sausages ‘salchichón’ throughout the ripening process. (A) non-inoculated control batch with fungal growth after ripening. (B) non-inoculated control batch after scraping moulds on the surface of samples. (C) C. oxysporum BPS inoculated sausages batch with fungal growth after ripening. (D) C. oxysporum BPS inoculated sausages batch showing blackening below after scraping moulds on the surface of samples. Initial inoculum was 100 mL per sausage of a spore solution of 106 cfu/mL.

value of 84.30 ± 0.40 °C was found when DNA from C. oxysporum BPS was used. In most cases the remaining mould strains tested did not show any amplification. In those cases where some amplification was observed, they gave PCR products of non-expected sizes with dissimilar Tm values (66.30 to 82.90 °C) relative to C. oxysporum. Although no guidelines have been established for standard curves used in qPCR assays to measure fungi those established by Fredlund et al. (2008) could be used, where the slope of the standard curve should range between −3.1 and −3.6 and, the PCR efficiency between 80 and 110% and the R2 value should be ≥0.98. In the present work, the optimised method for fungal DNA extracted from inoculated slices with C. oxysporum BPS had a R2 value of 0.98 and showed appropriate slope value within the optimum range. These results indicated that the qPCR method could be applied to quantifying C. oxysporum BPS in

meat products. Therefore, this method could be a useful tool in the meat industry for avoiding this type of spoilage micro-organisms in dry-cured meat products before blackening occurs and devalues the product. In this study, an experimental assay was designed to evaluate the ability of C. oxysporum BPS to reproduce black spot spoilage in dry-cured fermented sausages. In addition, this assay was used to test the suitability of the qPCR method to detect the colonization of C. oxysporum BPS on this type of meat product. From the obtained results, C. oxysporum BPS was able to grow and produce black spots on slices and also on sausages ‘salchichón’ throughout the ripening process. Thus these findings confirmed that C. oxysporum BPS was able to provoke black spots on this meat product resulting in an alteration related to mould population, which has never been described.

290

D. Lozano-Ojalvo et al. / Meat Science 100 (2015) 283–290

Furthermore, the usefulness of the developed qPCR method to detect the presence of C. oxysporum BPS was ratified in dry-cured fermented ‘salchichón’ (slices and sausages) since no significant differences (p N 0.05) between counts by this method and by plating in culture medium was observed. In conclusion C. oxysporum BPS was characterised as microorganism responsible for black spot formation in dry-cured fermented ‘salchichón’. This mould strain was able to reproduce this alteration in slices of ‘salchichón’ and in dry-cured fermented sausage ‘salchichón’ throughout the ripening process. In addition, a qPCR method was also developed to detect and quantify C. oxysporum BPS. This method could be of great interest in the dry-cured meat industry for an early detection of samples contaminated with this mould before spoilage of product. Conflict of interest There is no conflict of interest. Acknowledgements This work has been funded by the Spanish Comisión Interministerial de Ciencia y Tecnología, Carnisenusa CSD2007-00016, Consolider Ingenio 2010 and GRU08100 and GRU09158 of the Junta de Extremadura and FEDER. Authors are grateful to M.M. García for her technical collaboration during the development of this research. References Andrade, M. J., Rodas, E., Durbán, A., Moya, A., & Córdoba, J. J. (2012). Characterization and control of microbial black spot spoilage in dry-cured Iberian ham. Food Control, 23, 128–136. Asefa, D. T., Kure, C. F., Gjerde, R. O., Omer, M. K., Langsrud, S., Nesbakken, T., & Skaar, I. (2010). Fungal growth pattern, sources and factors of mould contamination in a dry-cured meat production facility. International Journal of Food Microbiology, 140, 131–135. Canel, R. S., Wagner, J. R., Stenglein, S. A., & Ludemann, V. (2013). Indigenous filamentous fungi on the surface of Argentinean dry fermented sausages produced in Colonia Caroya (Córdoba). International Journal of Food Microbiology, 164, 81–86. Comi, G., Orlic, S., Redzepovic, S., Urso, R., & Iacumin, L. (2004). Moulds isolated from Istrian dried ham at the pre-ripening and ripening level. International Journal of Food Microbiology, 96, 29–34. Fonseca, S., Ouba, L. I., Franco, I., & Cárballo, J. (2013). Use of molecular methods to characterize the bacterial community and to monitor different native starter cultures throughout the ripening of Galician chorizo. Food Microbiology, 34, 215–226. Fredlund, E., Gidlund, A., Olsen, M., Börjesson, T., Spliid, N. H., & Simonsson, M. (2008). Method evaluation of Fusarium DNA extraction from mycelia and wheat for downstream real-time PCR quantification and correlation to mycotoxin levels. Journal of Microbiological Methods, 73, 33–40. Garriga, M., Ehrmann, M. A., Arnau, J., Hugas, M., & Vogel, R. F. (1998). Carnimonas nigrificans gen. nov., sp. nov., a bacterial causative agent for black spot formation on cured meat products. International Journal of Systematic Bacteriology, 48, 677–686. Gill, C. O., Di Menna, M. E., & Lowry, P. D. (1981). A Note on the identities of organisms causing black spot spoilage of meat. Journal of Applied Bacteriology, 51, 183–187. Gill, C. O., & Lowry, P. D. (1982). Growth at sub-zero temperatures of black spot fungi from meat. Journal of Applied Bacteriology, 52, 245–250.

Glass, N. L., & Donaldson, G. C. (1995). Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous Ascomycetes. Applied and Environmental Microbiology, 61, 1323–1330. Hugas, M., & Arnau, J. (1987). Aparición de manchas de color marrón en la corteza y grasa del jamón durante el post-salado. In J. Arnau, M. Hugas, & J. M. Monfort (Eds.), Jamón Curado. Aspectos Técnicos (pp. 179–182). Monells, Spain: Institut de Recerca i Tecnologia Agroalimentáries. Krimitzas, A., Pyrri, I., Kouvelis, V. N., Kapsanaki-Gotsi, E., Milton, A., & Typas, M. A. (2013). A phylogenetic analysis of greek isolates of Aspergillus species based on morphology and nuclear and mitochondrial gene sequences. BioMed Research International, 2013, 260395. Krkić, N., Šojić, B., Lazić, V., Petrović, L., Mandić, A., Sedej, I., & Tomović, V. (2013). Lipid oxidative changes in chitosan-oregano coated traditional dry fermented sausage Petrovská klobása. Meat Science, 93, 767–770. López-Díaz, T. M., Santos, J. A., García-López, M. L., & Otero, A. (2001). Surface mycoflora of a Spanish fermented meat sausage and toxigenicity of Penicillium isolates. International Journal of Food Microbiology, 68, 69–74. Ludemann, V., Greco, M., Rodríguez, M. P., Basílico, J. C., & Pardo, A. G. (2010). Conidial production by Penicillium nalgiovense for use as starter cultures in dry fermented sausages by solid state fermentation. Food Science and Technology, 43, 315–318. Mizakovà, A., Pipovà, M., & Turek, P. (2002). The occurrence of moulds in fermented raw meat products. Czech Journal of Food Sciences, 20, 89–94. Núñez, F., Rodríguez, M. M., Bermúdez, M. E., Córdoba, J. J., & Asensio, M. A. (1996). Composition and toxigenic potential of the mould population on dry-cured ham. International Journal of Food Microbiology, 32, 185–197. Ordóñez, J. A. (1979). Random number sampling method for estimation of lactic acid bacteria. Journal of Applied Bacteriology, 46, 351–353. Pitt, J. I., & Hocking, A. D. (2009). Fungi and food spoilage. New York: Springer, 53–143. Rodríguez, A., Rodríguez, M., Luque, M. I., Justesen, A. M., & Córdoba, J. J. (2011). Quantification of ochratoxin A-producing molds in food products by SYBR Green and TaqMan real-time PCR methods. International Journal of Food Microbiology, 149, 226–235. Rodríguez, A., Rodríguez, M., Luque, M. I., Justesen, A. F., & Córdoba, J. J. (2012). A comparative study of DNA extraction methods to be used in real-time PCR based quantification of ochratoxin A-producing molds in food products. Food Control, 25, 666–672. Rodríguez, A., Rodríguez, M., Martín, A., Delgado, J., & Córdoba, J. J. (2012). Presence of ochratoxin A on the surface of dry-cured Iberian ham after initial fungal growth in the drying stage. Meat Science, 90, 728–734. Samson, R. A., Hoeskstra, E. S., Frisvad, J. C., & Filtenborg, O. (2002). Introduction to Food and airborne fungi. Utrecht: Centraalbureau voor Schimmelcultures. Sánchez, B., Rodríguez, M., Casado, E. M., Martín, A., & Córdoba, J. J. (2008). Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA–PCR analysis to differentiate cyclopiazonic acid mold producers. Journal of Food Protection, 71, 2497–2503. Sonjak, S., Ličen, M., Frisvad, J. C., & Gunde-Cimerman, N. (2011). The mycobiota of three dry-cured meat products from Slovenia. Food Microbiology, 28, 373–376. Sørensen, L. M., Jacobsen, T., Nielsen, P. V., Frisvad, J. C., & Koch, A. G. (2008). Mycobiota in the processing areas of two different meat products. International Journal of Food Microbiology, 124, 58–64. Tabanelli, G., Coloretti, F., Chiavari, C., Grazia, L., Lanciotti, R., & Lanciotti, R. (2012). Effects of starter cultures and fermentation climate on the properties of two types of typical Italian dry fermented sausages produced under industrial conditions. Food Control, 26, 416–426. White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetic. In M. A. Innis, D. H. Gelgard, J. J. Sninsky, & T. J. White (Eds.), PCR Protocols: A Guide to Methods and Applications (pp. 315–322). New York: Academic Press. Yan, L., Zhang, C., Dung, L., & Ma, Z. (2008). Development of a real-time PCR assay for the detection of Cladosporium fulvum in tomato leaves. Journal of Applied Microbiology, 104, 1417–1424. Yang, L., Van der Lee, T., Yang, X., Yu, D., & Waalwijk, C. (2008). Fusarium populations on Chinese barley show a dramatic gradient in mycotoxin profiles. Phytopathology, 98, 719–727.