Toxicologyhttp://tih.sagepub.com/ and Industrial Health
Changes of c-Myc and DNMT1 mRNA and protein levels in the rat livers induced by dibutyl phthalate treatment Katarzyna Urbanek-Olejnik, Monika Liszewska, Alicja Winczura and Grazyna Kostka Toxicol Ind Health published online 5 December 2013 DOI: 10.1177/0748233713512363 The online version of this article can be found at: http://tih.sagepub.com/content/early/2013/12/03/0748233713512363
Published by: http://www.sagepublications.com
Additional services and information for Toxicology and Industrial Health can be found at: Email Alerts: http://tih.sagepub.com/cgi/alerts Subscriptions: http://tih.sagepub.com/subscriptions Reprints: http://www.sagepub.com/journalsReprints.nav Permissions: http://www.sagepub.com/journalsPermissions.nav
>> OnlineFirst Version of Record - Dec 5, 2013 What is This?
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Article
Changes of c-Myc and DNMT1 mRNA and protein levels in the rat livers induced by dibutyl phthalate treatment
Toxicology and Industrial Health 1–8 © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav DOI: 10.1177/0748233713512363 tih.sagepub.com
Katarzyna Urbanek-Olejnik1, Monika Liszewska1, _ Alicja Winczura2 and Grazyna Kostka1 Abstract We investigated the relationship between dibutyl phthalate (DBP)-induced hypomethylation of the c-Myc promoter region (as evident in our early study) and the expression of c-Myc and DNMT1 genes (at messenger RNA (mRNA) and protein level) in the rat liver. Male Wistar rats received DBP in 1, 3, or 14 daily doses of 1800 mg kg1 body weight. Levels of DNMT1, c-Myc mRNA, and proteins were detected using real-time polymerase chain reaction and Western blot analysis, respectively. Our findings indicate that DBP caused an increase in mRNA levels of c-Myc at all time points. The results showed that protein levels of c-Myc in rat liver also increased significantly by DBP treatment, which were more pronounced at last time point (after 14 doses). Furthermore, overexpression of DNMT1gene have been found after one dose of DBP, which was confirmed at the protein level by Western blot analysis. Reduced levels of DNMT1mRNA and proteins (3 and 14 doses) were coordinated with depletion DNA synthesis (reported previously). Based on our previous results and those presented here, the following conclusion could be drawn: (1) DBP exerted biological activity through epigenetic modulation of c-Myc gene expression; (2) it seems possible that DBP-induced active demethylation of c-Myc gene through mechanism(s) linked to generation of reactive oxygen species by activated c-Myc; and (3) control of DNA replication was not directly dependent on c-Myc transcriptional activity and we attribute this finding to DNMT1gene expression which was tightly coordinated with DNA synthesis. Keywords Gene expression, c-Myc, DNMT1, DBP, rat, liver
Introduction In normal cells, only some of the genes are characterized by a constant transcriptional activity. These are the genes that determine the basic cellular metabolism, known as house-keeping genes. While expression of most genes is subject to regulation and is determined by nucleosomal organization of chromatin and its modifications. Main mechanisms that modulate the chromatin structure defining the organizational status of DNA genetic information within the cell include DNA methylation, covalent histone modifications, noncovalent mechanisms (histone variants and nucleosome remodeling), and noncoding RNAs including microRNAs (Kim et al., 2009; Sharma et al., 2010; Tost, 2010). These mechanisms work together to regulate the functioning of the genome by altering the local structural dynamics of chromatin, primarily regulating its accessibility and
compactness (Sharma et al., 2010). Thus, they affect genome function and determine the fate of the cell and the activity of genes. In our earlier study (Kostka et al., 2010), we assessed the methylation status of c-Myc gene following exposure of male Wistar rats to dibutyl phthalate (DBP). This compound caused a loss of
1
Department of Toxicology and Risk Assessment, National Institute of Public Health-National Institute of Hygiene, Warsaw, Poland 2 Department of Molecular Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland Corresponding author: Gra_zyna Kostka, Department of Toxicology and Risk Assessment, National Institute of Public Health-National Institute of Hygiene, Chocimska 24, 00 791 Warsaw, Poland. Email: [email protected]
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
2
Toxicology and Industrial Health
Table 1. Sequence of primers used in real-time PCR. Sequence 50 –30
Tm( C)
GenBank accession number
Amplicon size (bp)
CTGCTGTCCTCCGAGTCCTC GGGGGTTGCCTCTTTTCCAC ACTGTTCCTCCTTCTGCCATC CATCGTCCTTAGCGTCGTCG GTGGGTATGGGTCAGAAGG CAATGCCGTGTTCAATGGGG
57.9 55.9 54.4 55.9 53.2 53.8
NM_012603
149
NM_053354
112
Primer MycExp1-F MycExp1-R DNMT1Exp1-F DNMT1Exp1-R ActExp1-F ActExp1-R
V01217
95
Tm: melting temperature; F: forward; R: reverse; PCR: polymerase chain reaction.
cytosine methylation at HpaII sites, as evidenced by a decrease in the polymerase chain reaction (PCR) product recovery after pretreatment of DNA with methylation-sensitive restriction endonuclease HpaII. Since DNA methylation is involved in regulation of gene transcription, disruption in expression of DNMT1 may lead to alternations, both in DNA methylation and in DNA replication (Kanai and Hirohashi, 2007). This study was conducted to assess whether DBP-induced hypomethylation was associated with an altered expression of the c-Myc and DNMT1 transcript and protein levels in male rats liver.
Materials and methods Animals and outline of the experiments A total of 30, 5-week-old, male Wistar rats were quarantined for 1 week before the start of the experiment. They were housed in plastic cages with a 12-h light/ dark cycle, at a constant temperature of 22 + 1 C and relative humidity of 50 + 10%, and were given free access to food and water. The health status of the animals was monitored every other day. The team has been granted approval by the Local Ethics Committee of the National Medicines Institute of Warsaw, Poland, for the conduct of research studies in live vertebrates.
Experimental design The rats (200 + 10 g) were randomly divided into groups (5 rats per group). The treated groups received DBP (Sigma Chemical Company, St Louis, Missouri, USA) in dose of 1800 mg kg1 body weight (b.w.) for 1, 3, or 14 consecutive days. DBP was given by gavage in an olive oil suspension between 08:00 and 09:00 h, while the control groups received an equivalent amount of olive oil vehicle. Body weight, water, and food consumption were recorded every day. After 24 h of the last dose administered, the animals were
weighed and killed, and its liver excised and weighed. The livers were collected, rapidly frozen in liquid nitrogen, and stored at 70 C. Representative samples of liver tissue were taken from the right lobe for analysis.
Real-time PCR for c-Myc and DNMT1 genes Frozen tissues were homogenized in 0.6 ml of guanidine-thiocyanate-containing lysis buffer (RLT buffer), and then the total RNA from the animals’ liver was isolated with RNeasy extraction kit (Qiagen, Germany) according to the manufacturer’s instructions. Extracted RNA was stored at 80 C for subsequent analyses. Purified RNA was reverse transcribed using Advantage RT-for-PCR kit (Clontech, Mountain View, California, USA), following the manufacturer’s recommendations. Quantitative assessment of DNA amplification for each gene was performed by a fluorescence-based real-time detection method with a fluorescent dye SYBR Green I (Kapa Biosystems, Woburn, Massachusetts, USA). Primer sequences for c-Myc, DNMT1, and b-actin gene are presented in Table 1. Changes in concentration of the product were assessed by measuring the fluorescence level during the elongation phase of PCR. The real-time PCR conditions were as follows: 95 C for 2 min (initial denaturation), and then 40 cycles of 95 C for 30 s, 55– 60 C for 20 s, 72 C for 30 s, and 80 C for 5 s. The number of cycles had been previously estimated to be optimal for detecting the signal in the linear range. After the final cycle, melting curve analysis of all samples was performed through one cycle of 95 C/0 s, 65 C for 15 s, and ramp to 95 C at 0.5 C s1. Amplification and threshold calculations were generated using the 1.6 CFX Manager Software (Bio-Rad, Hercules, California, USA). Each analysis was conducted in the presence of negative control, indicating
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Urbanek-Olejnik et al.
3
the absence of contamination in the course of laboratory tests, and all real-time PCRs were carried out in triplicate. Changes in the messenger RNA (mRNA) levels of particular genes (c-Myc and DNMT1) were analyzed using the Pfaffl model (Pfaffl, 2001) in which the gene mRNA level in test samples is estimated relative to the level of the same gene in control samples and standardized relative to the mRNA level of a selected reference gene (b-actin), taking into account the differences in the efficacy of amplification of individual transcripts.
Western blot analysis of c-Myc and DNMT1 protein expression Proteins from the animals’ liver were isolated in T-Per Mammalian Tissue Reagent (ThermoFisher Scientific, Waltham, Massachusetts, USA) containing protease inhibitor (Complete Protease Inhibitor Cocktail; Roche, Switzerland). Bradford’s method was used to estimate protein concentration in each sample (Protein Assay Dye Reagent Concentrate, Bio-Rad). Quantified proteins (25 mg per line) were separated on 10% polyacrylamide gel in denaturing conditions, in the presence of sodium dodecyl sulfate (SDS) and bmercaptoethanol (SDS-polyacrylamide gel electrophoresis) and transferred onto Immobilon-P membranes (Millipore, Billerica, Massachusetts, USA). After semi-dry electroblotting, under the following conditions: 1 mA cm2 for 1 h, the membranes were blocked with 5% nonfat-dry milk solution in 1Trisbuffered saline with Tween-20 buffer. Membranes were probed with primary antibodies (from Santa Cruz Biotechnology, Santa Cruz, CA) against c-Myc (monoclonal mouse c-Myc, clone C-33; 1:4000 dilution in blocking solution) or DNMT1 (polyclonal goat DNMT1, K-18; 1:2000 dilution). Primary antibodies binding was performed at 4 C overnight with constant shaking. Horseradish peroxidase (HRP) conjugate donkey anti-goat and goat anti-mouse antibodies (Santa Cruz Biotechnology) were applied for 1 h at 1:5000 dilution, respectively. Immunoreactive bands were visualized with chemiluminescence system (Immobilon™ Western Chemiluminescent HRP Substrate, Millipore) and ultrasensitive photographic x-ray Kodak film according to the manufacturer’s instructions. After scanning, the signals were quantified using Image Quant software (Molecular Dynamics, version 5.2) and normalized relative to
b-actin (antibody from Santa Cruz, CA; 1: 5000 dilution).
Statistical analysis REST-384 software tool (see, www.gene-quantification.de/rest-384.html) was used to estimate the relative mRNA levels of particular genes. The software allows to compare mRNA levels in two groups (the control group and the test group) and to assess the statistical significance of demonstrated differences in mRNA levels using randomization tests (pair-wise fixed reallocation randomization test) (Pfaffl et al., 2002). For analysis of c-Myc and DNMT1 protein expressions, the data were expressed as the mean + SEM for five animals. The two-tailed Student’s t test was employed to calculate the statistical significance between control and treated groups. Differences in gene expression levels between experimental groups were considered significant when p < 0.05.
Results Effect of DBP on expression of c-Myc gene DNA methylation has essential role in the transcriptional regulation of gene expression. Generally, gene promoter hypermethylation is associated with decreased expression of the gene, while hypomethylation leads to increases in gene transcription (Esteller, 2008; Goodman and Watson, 2002). To determine whether DBP-induced hypomethylation of c-Myc gene (as shown in our earlier study) affects expression of this gene, quantitative real-time PCR assays were carried out in order to evaluate the mRNA levels of c-Myc gene in liver of rats exposed to DBP. Table 2 shows the expression changes of c-Myc gene in time-dependent manner, that is at 1, 3, or 14 doses of DBP administration. Fold change of c-Myc expression over normalized control levels is presented. mRNA expression of the c-Myc gene in the rat liver was increased in response to DBP throughout the experiment for up to 14 days. A statistically significant increase in mRNA level of c-Myc gene was observed at 24 h after single dose of DBP. There was 1.4-fold increase as compared to control. Increased level of c-Myc transcript was more pronounced at later time points. Three doses of compound resulted in 35% increases in mRNA level when compared with the single dose of DBP. Simultaneously, the relative c-Myc transcript level after three doses of
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
4
Toxicology and Industrial Health
Table 2. Quantitative real-time PCR analysis of c-Myc expression in the liver of rats exposed to DBP for 1, 3, and 14 days.a Expressionb ratio Days of treatment Gene
1
3
14
c-Myc
1.383 (0.023)
1.872 (0.019)
1.905 (0.022)
DBP: dibutyl phthalate; mRNA: messenger RNA; b.w.: body weight. a Relative mRNA quantification of c-Myc in the liver of rats treated with DBP for 1, 3, and 14 days (1800 mg kg1 b.w. day1). b Expression ratios are relative to b-actin endogenous control; p-values are given in brackets; and statistical analyses were carried out using randomization test.
Figure 1. Effect of treatment with DBP on c-Myc protein level in rat liver. (a) Representative Western immunoblot images of c-Myc protein. Liver tissue lysates were separated by SDS-PAGE and subjected to Western immunoblotting. The signal intensity from the chemiluminescent detection was analyzed by ImageQuant software. The c-Myc protein level was normalized to b-actin signal. (b) Quantitative analysis of c-Myc protein level. Control values at each time point were considered as 100%. *p < 0.05: Significantly different from the control at the same time point. DBP: dibutyl phthalate; SDS-PAGE: sodium dodecyl sulfate–polyacrylamide gel electrophoresis.
DBP was increased 1.9-fold compared with control. The increased level was maintained at day 14 and hepatic c-Myc mRNA level was elevated (1.9-fold) in rats as compared to control group.
Western blot analysis of c-Myc proteins We investigated the protein expression levels of c-Myc in the liver of rats that were treated with DBP to explore the relationship of the c-Myc mRNA and protein expression. As expected, we found that the protein levels of c-Myc were significantly higher than that in the control rats. Figure 1 shows that treating male rats with DBP resulted in prominent increase in level of c-Myc proteins at each time points. Exposure of rats to a single dose of DBP leads to increase in c-Myc protein level, which exceeded the control level by 34%. Following 3 days of the DBP
exposure in the dose of 1800 mg kg1 b.w. per day, we did not see any difference in the level of protein as compared to that after a single dose of DBP, although c-Myc level in the DBP group was shown to be increased compared with that in the control group. On the contrary, administration of DBP for prolonged exposure (14 days) produced 64% increase over control in level of c-Myc protein.
Effect of DBP on DNMT1 protein level in rat liver DNMT1 is the main cellular enzyme responsible for the maintenance of DNA methylation patterns in somatic mammalian cells. Disruption in its activity and/or expression may lead to alterations in DNA methylation (Chen and Riggs, 2011; Szyf et al., 2008). The effect of DBP on a time-dependent hepatic DNMT1 protein levels is shown in Figure 2.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Urbanek-Olejnik et al.
5
Figure 2. Effect of DBP on DNMT1 protein level in rat liver. (a) Representative Western immunoblot images of DNMT1 protein. Liver tissue lysates were separated by SDS-PAGE and subjected to Western immunoblotting. The signal intensity from the chemiluminescent detection was analyzed by ImageQuant software. The DNMT1 protein level was normalized to b-actin signal. (b) Quantitative analysis of DNMT1 protein level. Control values at each time point were considered as 100%. *p < 0.05: Significantly different from the control at the same time point. DBP: dibutyl phthalate; SDS-PAGE: sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Table 3. Effect of DBP on the mRNA expression of DNMT1gene in male Wistar rats.a Expressionb ratio Days of treatment Gene DNMT1
1
3
14
2.157 (0.009)
0.376 (0.035)
0.606 (0.044)
DBP: dibutyl phthalate; mRNA: messenger RNA; b.w.: body weight. a Relative mRNA quantification of DNMT1 in the liver of rats treated with DBP for 1, 3, and 14 days (1800 mg kg1 b.w. day1). b Expression ratios are relative to b-actin endogenous control; p values are given in brackets; and statistical analyses were carried out using randomization test.
Western blot analysis showed slight but statistically significant increase of the DNMT1 protein expression after a single dose of DBP. The protein level was 20% higher compared with the control. An increase in the multiplicity of the given dose of DBP (3 doses at 24 h intervals) caused decrease in the DNMT1 protein level, by 15% compared with untreated control. Further decrease in the expression of the analyzed protein, by over 50% compared to the values obtained after 3 doses, was demonstrated after 14 doses administration of the compound. Differences in the level of the DNMT1 protein between the group of treated and control animals in the 14-day experiment exceeded 70%.
Effect of DBP on expression of DNMT1 gene To verify that changes in DNMT1 protein level by DBP, the result of transcriptional regulation of gene expression was carried out by real-time PCR to measure the levels of the DNMT1transcript. The effect of
DBP on a time-dependent hepatic DNMT1 mRNA levels is shown in Table 3. The transcript levels of DNMT1 changed during 1, 3, and 14 days of compound administration. Upon administration of a single dose of DBP, elevation of DNMT1 mRNA has been demonstrated; there was 2.2-fold increases in transcript level for of DNMT1 gene as compared to control. However, the level of DNMT1 transcript decreased after repeated administration of DBP (3 or 14 doses). Three doses of compound resulted in 80% decrease in mRNA level when compared with the single dose of DBP. Simultaneously, the relative DNMT1 transcript level after 3 doses of DBP was decreased by 60% as compared to the control group. This tendency was also observed after 14 doses administration of DBP. We found DNMT1 downexpression in the DBP-treated groups; mRNA level of DNMT1 gene was decreased to about 60% of the control values established as 100%, normalized to bactin level.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
6
Toxicology and Industrial Health
Discussion Mechanisms linked to the epigenetic control of gene expression play an important role in chemical carcinogenesis. Epigenetic phenomena are the subjects of intensive research and even though they have not yet been completely explained, their key role in the carcinogenic process, especially in its early stages, seems to be certain. Moreover, literature from the last years indicates that investigations on the response of the cellular genome to the action of chemicals give the possibility of both in-depth understanding of the mechanisms of their action and form the basis for earlier evaluation of their carcinogenic potential (Plant, 2008). In this aspect of special importance is defining the molecular effects leading to deregulation in maintenance of genome methylation. There is a growing body of evidence that supports which altered pattern of methylation is thought to play a causative role in all stages of carcinogenesis. Additionally, there is also a well-established link between c-Myc overexpression and liver cancer development by causing inappropriate gene expression that results in autonomous cellular proliferation (Fang et al., 2004; Lin et al., 2010). So, it is possible that abnormal changes in DNA methylation and expression of c-Myc gene might represent important factors in early development of hepatocarcinogenesis. DBP, a plasticizer used in polyvinyl chloride manufacture has been tested negative for mutagenicity and/or genotoxicity. With regard to carcinogenicity, DBP seems to be associated with tumor-promoting activity (Heudorf et al., 2007). We reported previously (Kostka et al., 2010) that DBP administered by gavage at 1800 mg kg1 b.w. per day to male Wistar rats for 1, 3, or 14 consecutive days induced loss of methylation in the promoter region of the c-Myc gene. The present studies, performed under analogous conditions, showed that DBP caused increase in transcriptional activity of c-Myc gene. Elevation of c-Myc mRNA has been demonstrated after single and prolonged administration of DBP. Moreover, increased c-Myc expression was confirmed at the protein level by Western blot analysis. These results indicate that there is a good relationship between the transcriptional activation of c-Myc proto-oncogene and its methylation. Thus, our results are consistent with a multitude of reports that DNA methylation is an epigenetic mechanism regulating transcription, which when disrupted can alter gene expression.
It is well established that c-Myc has a key role in cell growth, proliferation, and apoptosis (Dominguez-Sola et al., 2007; Eilers and Eisenman, 2008). It was proposed that Myc protein has a direct role in the control of DNA replication and promotes G1/S transition and DNA replication through the transcription of factors promoting S-phase entry and/or cell growth. The results of recent findings also suggest that c-Myc can stimulate DNA synthesis by directly interacting with replication origins (Sankar et al., 2009). Our data presented here indicate that the sustained increase in DBP-induced c-Myc expression was not in line with DBP-stimulated transient increase in DNA synthesis (it was found only at 24 h), as previously reported. Thus, for some reasons, which could not be explained at present we did not observe a commensurate increase in DNA synthesis with overexpression c-Myc gene. Nevertheless, our results are consistent with the study by Pogribny et al. (2008). They found that di-(2-ethylhexyl) phthalate (DEHP), known as peroxisome proliferator, administrated to rats (up to 5 months) resulted in the pronounced upregulation of c-Myc, while proliferating cell nuclear antigen (PCNA) expression was not affected by DEHP. These results also suggest a lack of direct correlation between DEHP-induced overexpression c-Myc and DNA synthesis as PCNA protein has critical functions in DNA replication and functions as a key factor necessary to maintain ongoing synthesis of DNA (Chang et al., 2006). However, it should be noted that c-Myc regulates transcription of a large number of genes, including cell cycle-related genes (Dominguez-Sola et al., 2007; Lin et al., 2010). Also, it has been proposed that c-Myc proto-oncogene overexpression can induce DNA damage through the generation of reactive oxygen species (ROS), which as a consequence may lead to mitigate or inhibition the biological function of many genes (Dominguez-Sola et al., 2007; Ray et al., 2006; Vafa et al., 2002). Since we cannot rule out or confirm this possibility, we only speculate that DBP-deregulated c-Myc expression may indirectly lead to proliferative arrest of hepatocytes. Furthermore, in the present study, we also showed that DNMT1 expression (at mRNA and protein levels) changed in time-dependent manner following treatment with DBP. The hepatic DNMT1 mRNA level was elevated in rats when DBP given in a single dose, while DNMT1 transcript levels decreased after prolonged administration (3 and 14 doses). This data were also confirmed at the protein level.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Urbanek-Olejnik et al.
7
The protein encodes by DNMT1 gene is a key enzyme for maintenance of proper methylation pattern through DNA replication. It catalyzes the transfer of methyl group from S-adenosylmethionine to the C-5 position of cytosines in the newly synthesized strand of DNA (Lan et al., 2010; Tost, 2010). In view of this, disruption in DNMT1 expression may lead to alternations in DNA methylation. Therefore, it is possible that reduced level of DNMT1 might impair DNA methylation. Simultaneously, since the expression level of DNMT1 gene is cell cycle dependent (Dhe-Paganon et al., 2011) and DNMT1 protein is essential for DNA replication (Spada et al., 2006), inhibition of this gene will result in inhibition of DNA replication following depletion of DNMT1 mRNA level. Indeed, for a single dose of DBP, we found a correlation between the ability to stimulate DNA synthesis (previously study) and ability to induce DNMT1 expression (this study). On the other hand, inhibition of DNMT1 (after 3 and 14 doses of DBP) has been shown to interfere with depletion of DNA replication. It is commonly accepted that inhibition of DNMT1 results in passive demethylation since nascent DNA is synthesized in the absence of DNA methylation activity. However, we have preliminary results suggesting that hypomethylation of the c-Myc may involve an active demethylation since c-Myc was demethylated in the absence of DNA replication. Active demethylation, independent of DNA replication, has been for many years ascribed to the activity of demethylases, although their contribution to the process was never unambiguously demonstrated (Ooi and Bestor, 2008), and thus, the mechanism of the active demethylation in mammals remained undefined. However, the recent discovery of 5-hydroxymethylcytosine (5-hMeC) in mammalian DNA (Kriaucionis and Heintz, 2009) demonstrated the ability of ten eleven translocation (TET) proteins to transform 5-MeC into 5-hMeC (Tahiliani et al., 2009), suggesting potential pathways of active demethylation. According to Dahl et al. (2011), 5-hMeC formed by contribution of TET proteins may be recognized by DNA repair proteins, that is, DNA glycosylases that excise 5-hMeC and replace it with cytosine (base excision repair, BER) thus leading to active demethylation. In this context, it should be stressed that the presence of 5-hMeC in cells could be the result of oxidative stress (Chia et al., 2011). On the other hand, the oxidative stress to DNA has been suggested (Klaunig et al., 2011) to be a common pathway for nongenotoxic chemical carcinogens, including peroxisome proliferators.
In summary, based on our previous results and those presented here we found that DBP exerted biological activity through epigenetic modulation of c-Myc gene expression. It seems possible that the mechanism(s) by which DBP induced active demethylation of c-Myc gene was linked to generation of ROS, by activated c-Myc. Moreover, our experiments demonstrate that control of DNA replication was not directly dependent on c-Myc transcriptional activity. We attribute this finding to DNMT1 gene expression which was tightly coordinated with DNA synthesis. Acknowledgement We would like to thank Professor Barbara Tudek from Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland, for providing access to the laboratory equipment.
Funding This research was supported by Polish Grant no. NN404 143438.
References Chang DJ, Lupardus PJ and Cimprich KA (2006) Monoubiquitination of proliferating cell nuclear antigen induced by stalled replication requires uncoupling of DNA polymerase and mini-chromosome maintenance helicase activities. Journal of Biological Chemistry 281: 32081–32088. Chen ZX and Riggs AD (2011) DNA methylation and demethylation in mammals. Journal of Biological Chemistry 286: 18347–18353. Chia N, Wang L, Lu X, Senut MC, Brenner C and Ruden DM (2011) Hypothesis: environmental regulation of 5hydroxymethyl-cytosine by oxidative stress. Epigenetics 6: 853–856. Dahl C, Grønbæk K and Guldberg P (2011) Advances in DNA methylation: 5- hydroxymethylcytosine revisited. Clinica Chimica Acta 412: 831–836. Dhe-Paganon S, Syeda F and Park L (2011) DNA methyl transferase 1: regulatory mechanisms and implications in health and disease. International Journal of Biochemistry and Molecular Biology 2: 58–66. Dominguez-Sola D, Ying CY, Grandori C, Ruggiero L, Chen B, Li M, et al. (2007) Non-transcriptional control of DNA replication by c-Myc. Nature 448: 445–451. Eilers M and Eisenman RN (2008) Myc’s broad reach. Genes and Development 22: 2755–2766. Esteller M (2008) Epigenetic in cancer. New England Journal of Medicine 358: 1148–1159.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
8
Toxicology and Industrial Health
Fang JY, Cheng ZH, Chen YX, Lu R, Yang L, Zhu HY, et al. (2004) Expression of DNMT1, demethylase, MeCP2 and methylation of tumor-related genes in human gastric cancer. World Journal of Gastroenterology 10: 3394–3398. Goodman JI and Watson RE (2002) Altered DNA methylation: a secondary mechanism involved in carcinogenesis. Annual Review of Pharmacology and Toxicology 42: 501–525. Heudorf U, Mersch-Sundermann V and Angerer J (2007) Phthalates: toxicology and exposure. International Journal of Hygiene and Environmental Health 210: 623–634. Kanai Y and Hirohashi S (2007) Alterations of DNA methylation associated with abnormalities of DNA methyltransferases in human cancers during transition from a precancerous to a malignant state. Carcinogenesis 28: 2434–2442. Kim JK, Samaranayake M and Pradhan S (2009) Epigenetic mechanisms in mammals. Cellular and Molecular Life Sciences 66: 596–612. Klaunig JE, Wang Z, Pu X and Zhou S (2011) Oxidative stress and oxidative damage in chemical carcinogenesis. Toxicology and Applied Pharmacology 254: 86–99. Kostka G, Urbanek-Olejnik K and Wiadrowska B (2010) Di-butyl phthalate-induced hypomethylation of the cmyc gene in rat liver. Toxicology and Industrial Health 26: 407–416. Kriaucionis S and Heintz N (2009) The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science 324: 929–930. Lan J, Hua S, He XX and Hang Y (2010) DNA methyltransferases and metyl-binding proteins of mammals. Acta Biochimica et Biophysica Sinica 42: 243–252. Lin CP, Liu CR, Lee CN, Chan TS and Liu HE (2010) Targeting c-Myc as a novel approach for hepatocellular carcinoma. World Journal of Hepatology 27: 16–20. Ooi SK and Bestor TH (2008) The colorful history of active DNA demethylation. Cell 133:1145–1148. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29(9): e45.
Pfaffl MW, Graham W, Horgan GW and Dempfle L (2002) Relative expression software tool (REST#) for groupwise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Research 30(9): e36. Plant N (2008) Can systems toxicology identify common biomarkers of non-genotoxic carcinogenesis? Toxicology 254: 164–169. Pogribny IP, Tryndyak VP, Boureiko A, Melnyk S, Bagnyukova TV, Montgomery B, et al. (2008) Mechanisms of peroxisome proliferator-induced DNA hypomethylation in rat liver. Mutation Research 644: 17–23. Ray S, Atkuri KR, Deb-Basu D, Adler AS, Chang HY, Herzenberg A, et al. (2006) Myc can induce DNA breaks in vivo and in vitro independent of reactive oxygen species. Cancer Research 66: 6598–6605. Sankar N, Kadeppagari RK and Thimmapaya B (2009) cMyc-induced aberrant DNA synthesis and activation of DNA damage response in p300 knockdown cells. Journal of Biological Chemistry 284: 15193–15205. Sharma S, Kelly TK and Jones PA (2010) Epigenetics in cancer. Carcinogenesis 31: 27–36. Spada F, Rothbauer U, Zolghadr K, Schermelleh L and Leonhardi H (2006) Regulation of DNA methyltransferase I. Advances in Enzyme Regulation 46: 224–234. Szyf M, McGowan P and Meaney MJ (2008) The social environment and the epigenome. Environmental and Molecular Mutagenesis 49: 46–60. Tahiliani M, Koh KP, Shen Y, Pastor WA, Bandukwala H, Brudno Y, et al. (2009) Conversion of 5-methylcytosine to 5-hydroksymethylcytosine in mammalian DNA by MLL partner TET1. Science 324: 930–935. Tost J (2010) DNA methylation an introduction to the biology and the disease-associated changes of a promising biomarker. Molecular Biotechnology 44: 71–81. Vafa O, Wade M, Kern S, Beeche M, Pandita TK, Hampton GM, et al. (2002) C-Myc can induce DNA damage, increase reactive oxygen species, and mitigate p53 function: a mechanism for oncogene-induced genetic instability. Molecular Cell 9: 1031–1044.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Changes of c-Myc and DNMT1 mRNA and protein levels in the rat livers induced by dibutyl phthalate treatment Katarzyna Urbanek-Olejnik, Monika Liszewska, Alicja Winczura and Grazyna Kostka Toxicol Ind Health published online 5 December 2013 DOI: 10.1177/0748233713512363 The online version of this article can be found at: http://tih.sagepub.com/content/early/2013/12/03/0748233713512363
Published by: http://www.sagepublications.com
Additional services and information for Toxicology and Industrial Health can be found at: Email Alerts: http://tih.sagepub.com/cgi/alerts Subscriptions: http://tih.sagepub.com/subscriptions Reprints: http://www.sagepub.com/journalsReprints.nav Permissions: http://www.sagepub.com/journalsPermissions.nav
>> OnlineFirst Version of Record - Dec 5, 2013 What is This?
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Article
Changes of c-Myc and DNMT1 mRNA and protein levels in the rat livers induced by dibutyl phthalate treatment
Toxicology and Industrial Health 1–8 © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav DOI: 10.1177/0748233713512363 tih.sagepub.com
Katarzyna Urbanek-Olejnik1, Monika Liszewska1, _ Alicja Winczura2 and Grazyna Kostka1 Abstract We investigated the relationship between dibutyl phthalate (DBP)-induced hypomethylation of the c-Myc promoter region (as evident in our early study) and the expression of c-Myc and DNMT1 genes (at messenger RNA (mRNA) and protein level) in the rat liver. Male Wistar rats received DBP in 1, 3, or 14 daily doses of 1800 mg kg1 body weight. Levels of DNMT1, c-Myc mRNA, and proteins were detected using real-time polymerase chain reaction and Western blot analysis, respectively. Our findings indicate that DBP caused an increase in mRNA levels of c-Myc at all time points. The results showed that protein levels of c-Myc in rat liver also increased significantly by DBP treatment, which were more pronounced at last time point (after 14 doses). Furthermore, overexpression of DNMT1gene have been found after one dose of DBP, which was confirmed at the protein level by Western blot analysis. Reduced levels of DNMT1mRNA and proteins (3 and 14 doses) were coordinated with depletion DNA synthesis (reported previously). Based on our previous results and those presented here, the following conclusion could be drawn: (1) DBP exerted biological activity through epigenetic modulation of c-Myc gene expression; (2) it seems possible that DBP-induced active demethylation of c-Myc gene through mechanism(s) linked to generation of reactive oxygen species by activated c-Myc; and (3) control of DNA replication was not directly dependent on c-Myc transcriptional activity and we attribute this finding to DNMT1gene expression which was tightly coordinated with DNA synthesis. Keywords Gene expression, c-Myc, DNMT1, DBP, rat, liver
Introduction In normal cells, only some of the genes are characterized by a constant transcriptional activity. These are the genes that determine the basic cellular metabolism, known as house-keeping genes. While expression of most genes is subject to regulation and is determined by nucleosomal organization of chromatin and its modifications. Main mechanisms that modulate the chromatin structure defining the organizational status of DNA genetic information within the cell include DNA methylation, covalent histone modifications, noncovalent mechanisms (histone variants and nucleosome remodeling), and noncoding RNAs including microRNAs (Kim et al., 2009; Sharma et al., 2010; Tost, 2010). These mechanisms work together to regulate the functioning of the genome by altering the local structural dynamics of chromatin, primarily regulating its accessibility and
compactness (Sharma et al., 2010). Thus, they affect genome function and determine the fate of the cell and the activity of genes. In our earlier study (Kostka et al., 2010), we assessed the methylation status of c-Myc gene following exposure of male Wistar rats to dibutyl phthalate (DBP). This compound caused a loss of
1
Department of Toxicology and Risk Assessment, National Institute of Public Health-National Institute of Hygiene, Warsaw, Poland 2 Department of Molecular Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland Corresponding author: Gra_zyna Kostka, Department of Toxicology and Risk Assessment, National Institute of Public Health-National Institute of Hygiene, Chocimska 24, 00 791 Warsaw, Poland. Email: [email protected]
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
2
Toxicology and Industrial Health
Table 1. Sequence of primers used in real-time PCR. Sequence 50 –30
Tm( C)
GenBank accession number
Amplicon size (bp)
CTGCTGTCCTCCGAGTCCTC GGGGGTTGCCTCTTTTCCAC ACTGTTCCTCCTTCTGCCATC CATCGTCCTTAGCGTCGTCG GTGGGTATGGGTCAGAAGG CAATGCCGTGTTCAATGGGG
57.9 55.9 54.4 55.9 53.2 53.8
NM_012603
149
NM_053354
112
Primer MycExp1-F MycExp1-R DNMT1Exp1-F DNMT1Exp1-R ActExp1-F ActExp1-R
V01217
95
Tm: melting temperature; F: forward; R: reverse; PCR: polymerase chain reaction.
cytosine methylation at HpaII sites, as evidenced by a decrease in the polymerase chain reaction (PCR) product recovery after pretreatment of DNA with methylation-sensitive restriction endonuclease HpaII. Since DNA methylation is involved in regulation of gene transcription, disruption in expression of DNMT1 may lead to alternations, both in DNA methylation and in DNA replication (Kanai and Hirohashi, 2007). This study was conducted to assess whether DBP-induced hypomethylation was associated with an altered expression of the c-Myc and DNMT1 transcript and protein levels in male rats liver.
Materials and methods Animals and outline of the experiments A total of 30, 5-week-old, male Wistar rats were quarantined for 1 week before the start of the experiment. They were housed in plastic cages with a 12-h light/ dark cycle, at a constant temperature of 22 + 1 C and relative humidity of 50 + 10%, and were given free access to food and water. The health status of the animals was monitored every other day. The team has been granted approval by the Local Ethics Committee of the National Medicines Institute of Warsaw, Poland, for the conduct of research studies in live vertebrates.
Experimental design The rats (200 + 10 g) were randomly divided into groups (5 rats per group). The treated groups received DBP (Sigma Chemical Company, St Louis, Missouri, USA) in dose of 1800 mg kg1 body weight (b.w.) for 1, 3, or 14 consecutive days. DBP was given by gavage in an olive oil suspension between 08:00 and 09:00 h, while the control groups received an equivalent amount of olive oil vehicle. Body weight, water, and food consumption were recorded every day. After 24 h of the last dose administered, the animals were
weighed and killed, and its liver excised and weighed. The livers were collected, rapidly frozen in liquid nitrogen, and stored at 70 C. Representative samples of liver tissue were taken from the right lobe for analysis.
Real-time PCR for c-Myc and DNMT1 genes Frozen tissues were homogenized in 0.6 ml of guanidine-thiocyanate-containing lysis buffer (RLT buffer), and then the total RNA from the animals’ liver was isolated with RNeasy extraction kit (Qiagen, Germany) according to the manufacturer’s instructions. Extracted RNA was stored at 80 C for subsequent analyses. Purified RNA was reverse transcribed using Advantage RT-for-PCR kit (Clontech, Mountain View, California, USA), following the manufacturer’s recommendations. Quantitative assessment of DNA amplification for each gene was performed by a fluorescence-based real-time detection method with a fluorescent dye SYBR Green I (Kapa Biosystems, Woburn, Massachusetts, USA). Primer sequences for c-Myc, DNMT1, and b-actin gene are presented in Table 1. Changes in concentration of the product were assessed by measuring the fluorescence level during the elongation phase of PCR. The real-time PCR conditions were as follows: 95 C for 2 min (initial denaturation), and then 40 cycles of 95 C for 30 s, 55– 60 C for 20 s, 72 C for 30 s, and 80 C for 5 s. The number of cycles had been previously estimated to be optimal for detecting the signal in the linear range. After the final cycle, melting curve analysis of all samples was performed through one cycle of 95 C/0 s, 65 C for 15 s, and ramp to 95 C at 0.5 C s1. Amplification and threshold calculations were generated using the 1.6 CFX Manager Software (Bio-Rad, Hercules, California, USA). Each analysis was conducted in the presence of negative control, indicating
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Urbanek-Olejnik et al.
3
the absence of contamination in the course of laboratory tests, and all real-time PCRs were carried out in triplicate. Changes in the messenger RNA (mRNA) levels of particular genes (c-Myc and DNMT1) were analyzed using the Pfaffl model (Pfaffl, 2001) in which the gene mRNA level in test samples is estimated relative to the level of the same gene in control samples and standardized relative to the mRNA level of a selected reference gene (b-actin), taking into account the differences in the efficacy of amplification of individual transcripts.
Western blot analysis of c-Myc and DNMT1 protein expression Proteins from the animals’ liver were isolated in T-Per Mammalian Tissue Reagent (ThermoFisher Scientific, Waltham, Massachusetts, USA) containing protease inhibitor (Complete Protease Inhibitor Cocktail; Roche, Switzerland). Bradford’s method was used to estimate protein concentration in each sample (Protein Assay Dye Reagent Concentrate, Bio-Rad). Quantified proteins (25 mg per line) were separated on 10% polyacrylamide gel in denaturing conditions, in the presence of sodium dodecyl sulfate (SDS) and bmercaptoethanol (SDS-polyacrylamide gel electrophoresis) and transferred onto Immobilon-P membranes (Millipore, Billerica, Massachusetts, USA). After semi-dry electroblotting, under the following conditions: 1 mA cm2 for 1 h, the membranes were blocked with 5% nonfat-dry milk solution in 1Trisbuffered saline with Tween-20 buffer. Membranes were probed with primary antibodies (from Santa Cruz Biotechnology, Santa Cruz, CA) against c-Myc (monoclonal mouse c-Myc, clone C-33; 1:4000 dilution in blocking solution) or DNMT1 (polyclonal goat DNMT1, K-18; 1:2000 dilution). Primary antibodies binding was performed at 4 C overnight with constant shaking. Horseradish peroxidase (HRP) conjugate donkey anti-goat and goat anti-mouse antibodies (Santa Cruz Biotechnology) were applied for 1 h at 1:5000 dilution, respectively. Immunoreactive bands were visualized with chemiluminescence system (Immobilon™ Western Chemiluminescent HRP Substrate, Millipore) and ultrasensitive photographic x-ray Kodak film according to the manufacturer’s instructions. After scanning, the signals were quantified using Image Quant software (Molecular Dynamics, version 5.2) and normalized relative to
b-actin (antibody from Santa Cruz, CA; 1: 5000 dilution).
Statistical analysis REST-384 software tool (see, www.gene-quantification.de/rest-384.html) was used to estimate the relative mRNA levels of particular genes. The software allows to compare mRNA levels in two groups (the control group and the test group) and to assess the statistical significance of demonstrated differences in mRNA levels using randomization tests (pair-wise fixed reallocation randomization test) (Pfaffl et al., 2002). For analysis of c-Myc and DNMT1 protein expressions, the data were expressed as the mean + SEM for five animals. The two-tailed Student’s t test was employed to calculate the statistical significance between control and treated groups. Differences in gene expression levels between experimental groups were considered significant when p < 0.05.
Results Effect of DBP on expression of c-Myc gene DNA methylation has essential role in the transcriptional regulation of gene expression. Generally, gene promoter hypermethylation is associated with decreased expression of the gene, while hypomethylation leads to increases in gene transcription (Esteller, 2008; Goodman and Watson, 2002). To determine whether DBP-induced hypomethylation of c-Myc gene (as shown in our earlier study) affects expression of this gene, quantitative real-time PCR assays were carried out in order to evaluate the mRNA levels of c-Myc gene in liver of rats exposed to DBP. Table 2 shows the expression changes of c-Myc gene in time-dependent manner, that is at 1, 3, or 14 doses of DBP administration. Fold change of c-Myc expression over normalized control levels is presented. mRNA expression of the c-Myc gene in the rat liver was increased in response to DBP throughout the experiment for up to 14 days. A statistically significant increase in mRNA level of c-Myc gene was observed at 24 h after single dose of DBP. There was 1.4-fold increase as compared to control. Increased level of c-Myc transcript was more pronounced at later time points. Three doses of compound resulted in 35% increases in mRNA level when compared with the single dose of DBP. Simultaneously, the relative c-Myc transcript level after three doses of
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
4
Toxicology and Industrial Health
Table 2. Quantitative real-time PCR analysis of c-Myc expression in the liver of rats exposed to DBP for 1, 3, and 14 days.a Expressionb ratio Days of treatment Gene
1
3
14
c-Myc
1.383 (0.023)
1.872 (0.019)
1.905 (0.022)
DBP: dibutyl phthalate; mRNA: messenger RNA; b.w.: body weight. a Relative mRNA quantification of c-Myc in the liver of rats treated with DBP for 1, 3, and 14 days (1800 mg kg1 b.w. day1). b Expression ratios are relative to b-actin endogenous control; p-values are given in brackets; and statistical analyses were carried out using randomization test.
Figure 1. Effect of treatment with DBP on c-Myc protein level in rat liver. (a) Representative Western immunoblot images of c-Myc protein. Liver tissue lysates were separated by SDS-PAGE and subjected to Western immunoblotting. The signal intensity from the chemiluminescent detection was analyzed by ImageQuant software. The c-Myc protein level was normalized to b-actin signal. (b) Quantitative analysis of c-Myc protein level. Control values at each time point were considered as 100%. *p < 0.05: Significantly different from the control at the same time point. DBP: dibutyl phthalate; SDS-PAGE: sodium dodecyl sulfate–polyacrylamide gel electrophoresis.
DBP was increased 1.9-fold compared with control. The increased level was maintained at day 14 and hepatic c-Myc mRNA level was elevated (1.9-fold) in rats as compared to control group.
Western blot analysis of c-Myc proteins We investigated the protein expression levels of c-Myc in the liver of rats that were treated with DBP to explore the relationship of the c-Myc mRNA and protein expression. As expected, we found that the protein levels of c-Myc were significantly higher than that in the control rats. Figure 1 shows that treating male rats with DBP resulted in prominent increase in level of c-Myc proteins at each time points. Exposure of rats to a single dose of DBP leads to increase in c-Myc protein level, which exceeded the control level by 34%. Following 3 days of the DBP
exposure in the dose of 1800 mg kg1 b.w. per day, we did not see any difference in the level of protein as compared to that after a single dose of DBP, although c-Myc level in the DBP group was shown to be increased compared with that in the control group. On the contrary, administration of DBP for prolonged exposure (14 days) produced 64% increase over control in level of c-Myc protein.
Effect of DBP on DNMT1 protein level in rat liver DNMT1 is the main cellular enzyme responsible for the maintenance of DNA methylation patterns in somatic mammalian cells. Disruption in its activity and/or expression may lead to alterations in DNA methylation (Chen and Riggs, 2011; Szyf et al., 2008). The effect of DBP on a time-dependent hepatic DNMT1 protein levels is shown in Figure 2.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Urbanek-Olejnik et al.
5
Figure 2. Effect of DBP on DNMT1 protein level in rat liver. (a) Representative Western immunoblot images of DNMT1 protein. Liver tissue lysates were separated by SDS-PAGE and subjected to Western immunoblotting. The signal intensity from the chemiluminescent detection was analyzed by ImageQuant software. The DNMT1 protein level was normalized to b-actin signal. (b) Quantitative analysis of DNMT1 protein level. Control values at each time point were considered as 100%. *p < 0.05: Significantly different from the control at the same time point. DBP: dibutyl phthalate; SDS-PAGE: sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Table 3. Effect of DBP on the mRNA expression of DNMT1gene in male Wistar rats.a Expressionb ratio Days of treatment Gene DNMT1
1
3
14
2.157 (0.009)
0.376 (0.035)
0.606 (0.044)
DBP: dibutyl phthalate; mRNA: messenger RNA; b.w.: body weight. a Relative mRNA quantification of DNMT1 in the liver of rats treated with DBP for 1, 3, and 14 days (1800 mg kg1 b.w. day1). b Expression ratios are relative to b-actin endogenous control; p values are given in brackets; and statistical analyses were carried out using randomization test.
Western blot analysis showed slight but statistically significant increase of the DNMT1 protein expression after a single dose of DBP. The protein level was 20% higher compared with the control. An increase in the multiplicity of the given dose of DBP (3 doses at 24 h intervals) caused decrease in the DNMT1 protein level, by 15% compared with untreated control. Further decrease in the expression of the analyzed protein, by over 50% compared to the values obtained after 3 doses, was demonstrated after 14 doses administration of the compound. Differences in the level of the DNMT1 protein between the group of treated and control animals in the 14-day experiment exceeded 70%.
Effect of DBP on expression of DNMT1 gene To verify that changes in DNMT1 protein level by DBP, the result of transcriptional regulation of gene expression was carried out by real-time PCR to measure the levels of the DNMT1transcript. The effect of
DBP on a time-dependent hepatic DNMT1 mRNA levels is shown in Table 3. The transcript levels of DNMT1 changed during 1, 3, and 14 days of compound administration. Upon administration of a single dose of DBP, elevation of DNMT1 mRNA has been demonstrated; there was 2.2-fold increases in transcript level for of DNMT1 gene as compared to control. However, the level of DNMT1 transcript decreased after repeated administration of DBP (3 or 14 doses). Three doses of compound resulted in 80% decrease in mRNA level when compared with the single dose of DBP. Simultaneously, the relative DNMT1 transcript level after 3 doses of DBP was decreased by 60% as compared to the control group. This tendency was also observed after 14 doses administration of DBP. We found DNMT1 downexpression in the DBP-treated groups; mRNA level of DNMT1 gene was decreased to about 60% of the control values established as 100%, normalized to bactin level.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
6
Toxicology and Industrial Health
Discussion Mechanisms linked to the epigenetic control of gene expression play an important role in chemical carcinogenesis. Epigenetic phenomena are the subjects of intensive research and even though they have not yet been completely explained, their key role in the carcinogenic process, especially in its early stages, seems to be certain. Moreover, literature from the last years indicates that investigations on the response of the cellular genome to the action of chemicals give the possibility of both in-depth understanding of the mechanisms of their action and form the basis for earlier evaluation of their carcinogenic potential (Plant, 2008). In this aspect of special importance is defining the molecular effects leading to deregulation in maintenance of genome methylation. There is a growing body of evidence that supports which altered pattern of methylation is thought to play a causative role in all stages of carcinogenesis. Additionally, there is also a well-established link between c-Myc overexpression and liver cancer development by causing inappropriate gene expression that results in autonomous cellular proliferation (Fang et al., 2004; Lin et al., 2010). So, it is possible that abnormal changes in DNA methylation and expression of c-Myc gene might represent important factors in early development of hepatocarcinogenesis. DBP, a plasticizer used in polyvinyl chloride manufacture has been tested negative for mutagenicity and/or genotoxicity. With regard to carcinogenicity, DBP seems to be associated with tumor-promoting activity (Heudorf et al., 2007). We reported previously (Kostka et al., 2010) that DBP administered by gavage at 1800 mg kg1 b.w. per day to male Wistar rats for 1, 3, or 14 consecutive days induced loss of methylation in the promoter region of the c-Myc gene. The present studies, performed under analogous conditions, showed that DBP caused increase in transcriptional activity of c-Myc gene. Elevation of c-Myc mRNA has been demonstrated after single and prolonged administration of DBP. Moreover, increased c-Myc expression was confirmed at the protein level by Western blot analysis. These results indicate that there is a good relationship between the transcriptional activation of c-Myc proto-oncogene and its methylation. Thus, our results are consistent with a multitude of reports that DNA methylation is an epigenetic mechanism regulating transcription, which when disrupted can alter gene expression.
It is well established that c-Myc has a key role in cell growth, proliferation, and apoptosis (Dominguez-Sola et al., 2007; Eilers and Eisenman, 2008). It was proposed that Myc protein has a direct role in the control of DNA replication and promotes G1/S transition and DNA replication through the transcription of factors promoting S-phase entry and/or cell growth. The results of recent findings also suggest that c-Myc can stimulate DNA synthesis by directly interacting with replication origins (Sankar et al., 2009). Our data presented here indicate that the sustained increase in DBP-induced c-Myc expression was not in line with DBP-stimulated transient increase in DNA synthesis (it was found only at 24 h), as previously reported. Thus, for some reasons, which could not be explained at present we did not observe a commensurate increase in DNA synthesis with overexpression c-Myc gene. Nevertheless, our results are consistent with the study by Pogribny et al. (2008). They found that di-(2-ethylhexyl) phthalate (DEHP), known as peroxisome proliferator, administrated to rats (up to 5 months) resulted in the pronounced upregulation of c-Myc, while proliferating cell nuclear antigen (PCNA) expression was not affected by DEHP. These results also suggest a lack of direct correlation between DEHP-induced overexpression c-Myc and DNA synthesis as PCNA protein has critical functions in DNA replication and functions as a key factor necessary to maintain ongoing synthesis of DNA (Chang et al., 2006). However, it should be noted that c-Myc regulates transcription of a large number of genes, including cell cycle-related genes (Dominguez-Sola et al., 2007; Lin et al., 2010). Also, it has been proposed that c-Myc proto-oncogene overexpression can induce DNA damage through the generation of reactive oxygen species (ROS), which as a consequence may lead to mitigate or inhibition the biological function of many genes (Dominguez-Sola et al., 2007; Ray et al., 2006; Vafa et al., 2002). Since we cannot rule out or confirm this possibility, we only speculate that DBP-deregulated c-Myc expression may indirectly lead to proliferative arrest of hepatocytes. Furthermore, in the present study, we also showed that DNMT1 expression (at mRNA and protein levels) changed in time-dependent manner following treatment with DBP. The hepatic DNMT1 mRNA level was elevated in rats when DBP given in a single dose, while DNMT1 transcript levels decreased after prolonged administration (3 and 14 doses). This data were also confirmed at the protein level.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
Urbanek-Olejnik et al.
7
The protein encodes by DNMT1 gene is a key enzyme for maintenance of proper methylation pattern through DNA replication. It catalyzes the transfer of methyl group from S-adenosylmethionine to the C-5 position of cytosines in the newly synthesized strand of DNA (Lan et al., 2010; Tost, 2010). In view of this, disruption in DNMT1 expression may lead to alternations in DNA methylation. Therefore, it is possible that reduced level of DNMT1 might impair DNA methylation. Simultaneously, since the expression level of DNMT1 gene is cell cycle dependent (Dhe-Paganon et al., 2011) and DNMT1 protein is essential for DNA replication (Spada et al., 2006), inhibition of this gene will result in inhibition of DNA replication following depletion of DNMT1 mRNA level. Indeed, for a single dose of DBP, we found a correlation between the ability to stimulate DNA synthesis (previously study) and ability to induce DNMT1 expression (this study). On the other hand, inhibition of DNMT1 (after 3 and 14 doses of DBP) has been shown to interfere with depletion of DNA replication. It is commonly accepted that inhibition of DNMT1 results in passive demethylation since nascent DNA is synthesized in the absence of DNA methylation activity. However, we have preliminary results suggesting that hypomethylation of the c-Myc may involve an active demethylation since c-Myc was demethylated in the absence of DNA replication. Active demethylation, independent of DNA replication, has been for many years ascribed to the activity of demethylases, although their contribution to the process was never unambiguously demonstrated (Ooi and Bestor, 2008), and thus, the mechanism of the active demethylation in mammals remained undefined. However, the recent discovery of 5-hydroxymethylcytosine (5-hMeC) in mammalian DNA (Kriaucionis and Heintz, 2009) demonstrated the ability of ten eleven translocation (TET) proteins to transform 5-MeC into 5-hMeC (Tahiliani et al., 2009), suggesting potential pathways of active demethylation. According to Dahl et al. (2011), 5-hMeC formed by contribution of TET proteins may be recognized by DNA repair proteins, that is, DNA glycosylases that excise 5-hMeC and replace it with cytosine (base excision repair, BER) thus leading to active demethylation. In this context, it should be stressed that the presence of 5-hMeC in cells could be the result of oxidative stress (Chia et al., 2011). On the other hand, the oxidative stress to DNA has been suggested (Klaunig et al., 2011) to be a common pathway for nongenotoxic chemical carcinogens, including peroxisome proliferators.
In summary, based on our previous results and those presented here we found that DBP exerted biological activity through epigenetic modulation of c-Myc gene expression. It seems possible that the mechanism(s) by which DBP induced active demethylation of c-Myc gene was linked to generation of ROS, by activated c-Myc. Moreover, our experiments demonstrate that control of DNA replication was not directly dependent on c-Myc transcriptional activity. We attribute this finding to DNMT1 gene expression which was tightly coordinated with DNA synthesis. Acknowledgement We would like to thank Professor Barbara Tudek from Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland, for providing access to the laboratory equipment.
Funding This research was supported by Polish Grant no. NN404 143438.
References Chang DJ, Lupardus PJ and Cimprich KA (2006) Monoubiquitination of proliferating cell nuclear antigen induced by stalled replication requires uncoupling of DNA polymerase and mini-chromosome maintenance helicase activities. Journal of Biological Chemistry 281: 32081–32088. Chen ZX and Riggs AD (2011) DNA methylation and demethylation in mammals. Journal of Biological Chemistry 286: 18347–18353. Chia N, Wang L, Lu X, Senut MC, Brenner C and Ruden DM (2011) Hypothesis: environmental regulation of 5hydroxymethyl-cytosine by oxidative stress. Epigenetics 6: 853–856. Dahl C, Grønbæk K and Guldberg P (2011) Advances in DNA methylation: 5- hydroxymethylcytosine revisited. Clinica Chimica Acta 412: 831–836. Dhe-Paganon S, Syeda F and Park L (2011) DNA methyl transferase 1: regulatory mechanisms and implications in health and disease. International Journal of Biochemistry and Molecular Biology 2: 58–66. Dominguez-Sola D, Ying CY, Grandori C, Ruggiero L, Chen B, Li M, et al. (2007) Non-transcriptional control of DNA replication by c-Myc. Nature 448: 445–451. Eilers M and Eisenman RN (2008) Myc’s broad reach. Genes and Development 22: 2755–2766. Esteller M (2008) Epigenetic in cancer. New England Journal of Medicine 358: 1148–1159.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
8
Toxicology and Industrial Health
Fang JY, Cheng ZH, Chen YX, Lu R, Yang L, Zhu HY, et al. (2004) Expression of DNMT1, demethylase, MeCP2 and methylation of tumor-related genes in human gastric cancer. World Journal of Gastroenterology 10: 3394–3398. Goodman JI and Watson RE (2002) Altered DNA methylation: a secondary mechanism involved in carcinogenesis. Annual Review of Pharmacology and Toxicology 42: 501–525. Heudorf U, Mersch-Sundermann V and Angerer J (2007) Phthalates: toxicology and exposure. International Journal of Hygiene and Environmental Health 210: 623–634. Kanai Y and Hirohashi S (2007) Alterations of DNA methylation associated with abnormalities of DNA methyltransferases in human cancers during transition from a precancerous to a malignant state. Carcinogenesis 28: 2434–2442. Kim JK, Samaranayake M and Pradhan S (2009) Epigenetic mechanisms in mammals. Cellular and Molecular Life Sciences 66: 596–612. Klaunig JE, Wang Z, Pu X and Zhou S (2011) Oxidative stress and oxidative damage in chemical carcinogenesis. Toxicology and Applied Pharmacology 254: 86–99. Kostka G, Urbanek-Olejnik K and Wiadrowska B (2010) Di-butyl phthalate-induced hypomethylation of the cmyc gene in rat liver. Toxicology and Industrial Health 26: 407–416. Kriaucionis S and Heintz N (2009) The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science 324: 929–930. Lan J, Hua S, He XX and Hang Y (2010) DNA methyltransferases and metyl-binding proteins of mammals. Acta Biochimica et Biophysica Sinica 42: 243–252. Lin CP, Liu CR, Lee CN, Chan TS and Liu HE (2010) Targeting c-Myc as a novel approach for hepatocellular carcinoma. World Journal of Hepatology 27: 16–20. Ooi SK and Bestor TH (2008) The colorful history of active DNA demethylation. Cell 133:1145–1148. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29(9): e45.
Pfaffl MW, Graham W, Horgan GW and Dempfle L (2002) Relative expression software tool (REST#) for groupwise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Research 30(9): e36. Plant N (2008) Can systems toxicology identify common biomarkers of non-genotoxic carcinogenesis? Toxicology 254: 164–169. Pogribny IP, Tryndyak VP, Boureiko A, Melnyk S, Bagnyukova TV, Montgomery B, et al. (2008) Mechanisms of peroxisome proliferator-induced DNA hypomethylation in rat liver. Mutation Research 644: 17–23. Ray S, Atkuri KR, Deb-Basu D, Adler AS, Chang HY, Herzenberg A, et al. (2006) Myc can induce DNA breaks in vivo and in vitro independent of reactive oxygen species. Cancer Research 66: 6598–6605. Sankar N, Kadeppagari RK and Thimmapaya B (2009) cMyc-induced aberrant DNA synthesis and activation of DNA damage response in p300 knockdown cells. Journal of Biological Chemistry 284: 15193–15205. Sharma S, Kelly TK and Jones PA (2010) Epigenetics in cancer. Carcinogenesis 31: 27–36. Spada F, Rothbauer U, Zolghadr K, Schermelleh L and Leonhardi H (2006) Regulation of DNA methyltransferase I. Advances in Enzyme Regulation 46: 224–234. Szyf M, McGowan P and Meaney MJ (2008) The social environment and the epigenome. Environmental and Molecular Mutagenesis 49: 46–60. Tahiliani M, Koh KP, Shen Y, Pastor WA, Bandukwala H, Brudno Y, et al. (2009) Conversion of 5-methylcytosine to 5-hydroksymethylcytosine in mammalian DNA by MLL partner TET1. Science 324: 930–935. Tost J (2010) DNA methylation an introduction to the biology and the disease-associated changes of a promising biomarker. Molecular Biotechnology 44: 71–81. Vafa O, Wade M, Kern S, Beeche M, Pandita TK, Hampton GM, et al. (2002) C-Myc can induce DNA damage, increase reactive oxygen species, and mitigate p53 function: a mechanism for oncogene-induced genetic instability. Molecular Cell 9: 1031–1044.
Downloaded from tih.sagepub.com at Universitats-Landesbibliothek on January 16, 2014
