Eur. J. Immunol. 2015. 45: 1043–1058

Cellular immune response

DOI: 10.1002/eji.201445125

Cell surface levels of endothelial ICAM-1 influence the transcellular or paracellular T-cell diapedesis across the blood–brain barrier Michael Abadier1,2 , Neda Haghayegh Jahromi1,2 , Ludmila Cardoso Alves1 , R´emy Boscacci1 , Dietmar Vestweber3 , Scott Barnum4 , Urban Deutsch1 , Britta Engelhardt1 and Ruth Lyck1 1

Theodor Kocher Institute, University of Bern, Bern, Switzerland Graduate School for Cellular and Biomedical Sciences, University of Bern, Bern, Switzerland 3 Max Planck Institute for Molecular Biomedicine, M¨ unster, Germany 4 Department of Medicine, University of Alabama, Birmingham, AL, USA 2

The extravasation of CD4+ effector/memory T cells (TEM cells) across the blood– brain barrier (BBB) is a crucial step in the pathogenesis of experimental autoimmune encephalomyelitis (EAE) or multiple sclerosis (MS). Endothelial ICAM-1 and ICAM-2 are essential for CD4+ TEM cell crawling on the BBB prior to diapedesis. Here, we investigated the influence of cell surface levels of endothelial ICAM-1 in determining the cellular route of CD4+ TEM -cell diapedesis across cytokine treated primary mouse BBB endothelial cells under physiological flow. Inflammatory conditions, inducing high levels of endothelial ICAM-1, promoted rapid initiation of transcellular diapedesis of CD4+ T cells across the BBB, while intermediate levels of endothelial ICAM-1 favored paracellular CD4+ T-cell diapedesis. Importantly, the route of T-cell diapedesis across the BBB was independent of loss of BBB barrier properties. Unexpectedly, a low number of CD4+ TEM cells was found to cross the inflamed BBB in the absence of endothelial ICAM-1 and ICAM-2 via an obviously alternatively regulated transcellular pathway. In vivo, this translated to the development of ameliorated EAE in ICAM-1null //ICAM-2−/− C57BL/6J mice. Taken together, our study demonstrates that cell surface levels of endothelial ICAM-1 rather than the inflammatory stimulus or BBB integrity influence the pathway of T-cell diapedesis across the BBB.

Keywords: Blood–brain barrier ICAM-1



r

CD4+ effector/memory T (TEM ) cells

r

Diapedesis

r

EAE

r

Additional supporting information may be found in the online version of this article at the publisher’s web-site

Introduction The blood–brain barrier (BBB) shields the central nervous system (CNS) from the continuously changing milieu of the blood stream [1]. The endothelial cells of the BBB display a high degree of specialization that makes them unique and different from any other endothelial cell in the body. Complex tight junctions sealing the interendothelial cell–cell contacts prohibit free diffusion of waterCorrespondence: Dr. Ruth Lyck e-mail: [email protected]  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

soluble molecules across the BBB. Furthermore, the BBB strictly controls immune cell trafficking into the CNS. Nevertheless, during autoimmune neuroinflammation such as in multiple sclerosis (MS) or in its animal model experimental autoimmune encephalomyelitis (EAE), high numbers of CD4+ T effector/memory cells (TEM cells) cross the BBB and enter the CNS parenchyma, where they induce inflammation, demyelination, and neuronal cell death [2]. Extravasation of CD4+ TEM cells across the inflamed BBB is a dynamic multistep process mediated by the sequential interaction of cell adhesion and signaling molecules expressed www.eji-journal.eu

1043

1044

Michael Abadier et al.

on the surface of the CNS microvascular endothelial cells and on the CD4+ TEM cells [3]. Endothelial ICAM-1 and VCAM-1 are critical for the successful shear resistant arrest of CD4+ TEM cells expressing the respective counter receptors LFA-1 (lymphocyte function-associated antigen 1, αLβ2-integrin: CD11a, CD18) and VLA-4 (very late antigen-4, α4β1-integrin: CD49d, CD29; reviewed in [4]). The subsequent polarization and crawling of the firmly adherent CD4+ TEM cells for long distances on the luminal surface of the CNS microvasculature against the direction of blood flow relies on endothelial ICAM-1 and in addition also on endothelial ICAM-2, the latter being constitutively expressed on the noninflamed and inflamed BBB, without an additional role for VCAM-1 [5, 6]. Thus, endothelial ICAM-1 and ICAM-2 are critical in guiding CD4+ TEM cells to sites of the BBB permissive for diapedesis [7]. It is now generally appreciated that diapedesis of CD4+ TEM cells can occur via two different routes (reviewed in [8]): The paracellular route, which is between two endothelial cells requiring displacement of their cell-to-cell junctions, or the transcellular route, which involves the formation of a pore through the body of an endothelial cell. Considering the essential role of endothelial ICAM-1 and ICAM-2 in T-cell crawling on the BBB, we here asked, if cell surface levels of ICAM-1 determine the cellular route of CD4+ TEM -cell diapedesis across the BBB. To this end, we used primary mouse brain microvascular endothelial cells (pMBMECs) as in vitro model for the BBB and induced inflammatory conditions with intermediate or high cell surface levels of endothelial ICAM-1 by stimulating with TNF-α or IL-1β. Observing CD4+ TEM -cell interaction with pMBMECs under flow by live cell imaging, we found that irrespective of the cytokine stimulus, pMBMECs expressing intermediate cell surface levels of ICAM-1 allowed for extended T-cell crawling preferentially to paracellular sites of diapedesis. In contrast, high cell surface levels of ICAM-1 limited CD4+ TEM -crawling distances and directed them rather to transcellular sites of diapedesis. Hereby, the route of T-cell diapedesis across the BBB was independent of loss of BBB barrier properties. Unexpectedly, in the complete absence of endothelial ICAM-1 and ICAM-2, and thus under conditions of reduced T-cell arrest, and in the complete absence of T-cell polarization and crawling, few CD4+ TEM cells crossed the ICAM-1null //ICAM-2−/− (where ICAM-1null //ICAM-2−/− is ICAM-1 and ICAM-2 deficient) pMBMECs monolayer preferentially via a transcellular route. Importantly, these rare events of CD4+ TEM -cell diapedesis across the BBB seem to suffice for T-cell migration across the BBB in vivo, as ICAM-1null //ICAM-2−/− C57BL/6J mice developed clinical EAE.

Results Endothelial ICAM-1 levels determine crawling speed and distance of CD4+ TEM cells on the BBB Based on the essential role of endothelial ICAM-1 and ICAM-2 for mediating crawling of CD4+ TEM cells to sites permissive for diapedesis across the inflamed BBB in vitro, we speculated that  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Eur. J. Immunol. 2015. 45: 1043–1058

cell surface levels of endothelial ICAM-1 might direct crawling T cells to transcellular versus paracellular sites of diapedesis across the BBB. To this end, we established conditions allowing for the expression of different cell surface levels of ICAM-1 by stimulating pMBMECs for 16 h with 10 ng/mL TNF-α (referred to as TNF-α) or with increasing concentrations of IL-1β (0.05, 0.5, 1.0, or 20.0 ng/mL IL-1β). While cell surface expression and subcellular localization of ICAM-2 and PECAM-1 remained unchanged (Supporting Information Fig. 1), cell surface expression of endothelial ICAM-1 and VCAM-1 was upregulated under all inflammatory conditions tested. Hereby, stimulation of pMBMECs with 1.0 or 20.0 ng/mL IL-1β induced significantly higher cell surface levels of ICAM-1 (upregulation with 20.0 ng/mL IL-1β [referred to as IL-1βhigh ]: ICAM-1: 3.6-fold) than stimulation with TNF-α (ICAM1: 2.2-fold) or with 0.05 ng/mL IL-1β (referred to IL-1βlow ; Fig. 1A and B). VCAM-1 cell surface levels were found to be generally higher after IL-1β versus TNF-α stimulation of pMBMECs (Fig. 1B). At the transcriptional level, upregulation of ICAM-1 and VCAM-1 was initiated already at 4 h after stimulation (Supporting Information Fig. 2). Taken together, stimulation of pMBMECs with either IL-1βlow or with TNF-α allowed for comparable intermediate endothelial cell surface levels of ICAM-1, while stimulating with IL-1βhigh resulted in significantly higher cell surface levels of ICAM-1 on pMBMECs. Next, we imaged extravasation of CD4+ TEM cells through TNF-α, IL-1βlow , and IL-1βhigh stimulated pMBMECs under physiological flow. Comparable numbers of CD4+ TEM cells were found to arrest under flow in all inflammatory conditions of the pMBMECs (TNF-α: 78 ± 13 CD4+ TEM cells per field of view [FOV], IL-1βlow : 79 ± 7 CD4+ TEM cells per [FOV], IL-1βhigh : 87 ± 10 CD4+ TEM cells per FOV) (Fig. 1C). On TNF-α stimulated pMBMECs, the majority of arrested CD4+ TEM cells either continuously crawled on the endothelial surface (37 ± 3.4%) or crossed the endothelial monolayer (54 ± 4.9%) within the observation period of 20 min. On IL-1βlow -stimulated pMBMECs, the dynamic behavior of the CD4+ TEM cells was indistinguishable from that on TNF-α stimulated pMBMECs (Fig. 1D). In striking contrast, on IL-1βhigh -stimulated pMBMECs, expressing high cell surface levels of ICAM-1, only a small fraction of CD4+ TEM cells (12 ± 2.7%) continuously crawled on the endothelial surface throughout the observation period, while the vast majority of CD4+ TEM cells (83 ± 3.2%) crossed the endothelial monolayer (Fig. 1D). The fractions of CD4+ TEM cells observed to remain stationary (TNF-α: 6 ± 1.7%, IL-1βlow : 7 ± 1.7%, IL-1βhigh : 7 ± 0.9%) or to detach (TNF-α: 1 ± 0.6%, IL-1βlow : 3 ± 1.8%, IL-1βhigh : 1 ± 0.3%) were identical under all inflammatory conditions (Fig. 1D). To determine if the increased diapedesis of CD4+ TEM cells observed across IL-1βhigh -stimulated pMBMECs was due to the induction of more sites permissive for diapedesis and thus shorter crawling distances of the T cells or rather due to an increased crawling speed of the T cells, we tracked individual crawling paths of the CD4+ TEM cells on IL-1βhigh -, IL-1βlow -, or TNF-α-stimulated pMBMECs prior to diapedesis. While the accumulated crawling distances of CD4+ TEM cells within 20 min after arrest were comparable on IL-1βlow -stimulated www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1043–1058

Cellular immune response

Figure 1. The expression levels of endothelial ICAM-1 influence the dynamic interaction of CD4+ TEM cells with pMBMECs. (A and B) Quantitative analysis of cell surface protein expression levels of (A) ICAM-1 and (B) VCAM-1 on TNF-α (gray bars) or IL-1β (black bars) stimulated pMBMECs. Stimulation was performed with the indicated cytokine concentrations for 16 h. Expression levels are displayed relative to the respective unstimulated sample that was set to 1.0 (white bars). Bars show the mean ± SD (n = 3) and data are from one experiment representative of three independent experiments, each performed in triplicate. (C) Mean numbers of arrested CD4+ TEM cells per FOV (438 μm × 329 μm) on WT pMBMECs stimulated with TNF-α, IL-1βhi , or IL-1βlo . (D) Postarrest dynamic behavior of CD4+ TEM cells on TNF-α-, IL-1βhi -, or IL-1βlo -stimulated pMBMECs within 20 min. The behavioral categories are expressed as percent of arrested CD4+ TEM cells per condition of the pMBMECs. (C and D) Data are shown as mean ± SEM (n = 5). (E to G) Analysis of CD4+ TEM -cell crawling on the endothelial surface prior to diapedesis. (E) Accumulated crawling distance in micrometer within 20 min. (F) Time between CD4+ TEM -cell shear resistant arrest on the surface of the pMBMECs and start of CD4+ TEM -cell diapedesis. (G) Crawling speed in micrometer per minute. (H) Crawling speed of CD4+ TEM cells on low (lo) or high (hi) density of recombinant ICAM-1. (E to H) Each data point represents one CD4+ TEM cell. Values are shown as ± SEM (n = 58 or more cells) and are pooled from three or more independent videos. (A to H) *p < 0.05; **p < 0.01; ***p < 0.001. (A to G) One-way ANOVA, followed by the Tukey multiple-comparison test; (H) unpaired Student’s t-test.

pMBMECs (79.8 ± 4.3 μm) and on TNF-α stimulated pMBMECs (80.2 ± 4.3 μm), they were significantly shorter on IL-1βhigh stimulated pMBMECs (55.9 ± 4.8 μm). According to this observation, the time from T-cell arrest until initiation of diapedesis was significantly reduced on IL-1βhigh -stimulated pMBMECs (5.1 ± 0.3 min) when compared to both IL-1βlow -stimulated pMBMECs (6.6 ± 0.4 min) or TNF-α-stimulated pMBMECs (7.7 ± 0.5 min; Fig. 1E and F; Supporting Information Videos 1 and 2). Furthermore, crawling speed of CD4+ TEM cells was significantly reduced on IL-1βhigh compared to both IL-1βlow - or TNF-α-stimulated pMBMECs (IL-1βhigh : 7.8 ± 0.3 μm/min, IL-1βlow : 8.8 ± 0.2 μm/min, TNF-α: 9.2 ± 0.2 μm/min; Fig. 1G). To determine if ICAM-1 alone suffices to determine T-cell crawling speed, we coated high and low concentrations of recombinant ICAM-1 on slides and indeed observed reduced T-cell crawling speed on highversus low-density ICAM-1 (Fig. 1H). Taken together, our observations suggest that high cell surface expression levels of endothelial ICAM-1 reduce speed and distance of T-cell crawling on the BBB,

 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

allowing for earlier onset of T-cell diapedesis across the BBB when compared to conditions with intermediate cell surface ICAM-1 expression.

Endothelial ICAM-1 rather than BBB integrity directs cellular pathway of CD4+ TEM -cell diapedesis Since high levels of endothelial ICAM-1 on IL-1βhigh -stimulated pMBMECs led to enhanced CD4+ TEM -cell diapedesis compared to IL-1βlow - and TNF-α-stimulated pMBMECs expressing intermediate ICAM-1 levels, we next asked if cell surface levels of endothelial ICAM-1 determine the pathway of CD4+ TEM -cell diapedesis across the pMBMEC monolayer. To this end, we focused on comparing IL-1βhigh with TNF-α-stimulated pMBMECs. Since impaired BBB integrity has been suggested to allow for increased paracellular CD4+ TEM -cell diapedesis across the BBB, we initially tested transendothelial electrical resistance (TEER) and permeability

www.eji-journal.eu

1045

1046

Michael Abadier et al.

Eur. J. Immunol. 2015. 45: 1043–1058

Figure 2. IL-1βhigh -stimulated pMBMECs show impaired barrier integrity, but increased transcellular diapedesis of CD4+ TEM cells. (A and C) Relative TEER values and (B and D) dextran (3 kDa Alexa 680) permeability of TNF-α- or IL-1βhigh -stimulated (A and B) WT or (C and D) VE-CadGFP pMBMECs. (E) Image series from time lapse videos showing a paracellular (top) or a transcellular (bottom) CD4+ TEM -cell diapedesis event. (Top row) Overlay of the DIC and GFP channels. (Bottom row) GFP fluorescence channel. Arrows show the site of CD4+ TEM -cell diapedesis. Scale bar, 10 μm. Image series correspond to Supporting Information Videos 3 and 4. Numbers show the relative time of image acquisition in minute. (F and G) Forskolin increases TEER of (F) TNF-α (gray bars) or (G) IL-1βhigh (black bars) stimulated pMBMECs. VE-CadGFP pMBMECs were cytokine stimulated for 16 h (set to 1.0) and then treated with 10 μM forskolin for 45 min. (A to D and F to G) For normalization, TNF-α-stimulated condition was set to 1.0. Bars show the mean ± SD (n = 3) and data are (B and D) pooled from three independent experiments or (A, C, G to F) representative of three independent experiments, each performed in triplicate. (A to D and F to G) Unpaired Student’s t-test. (H) Quantification of paracellular (gray) and transcellular (black) diapedesis events. All diapedesis events per condition were set to 100%. Stimulation of pMBMECs was with TNF-α, IL-1βhigh , or IL-1 βlow . Where indicated, the cytokine stimulation was followed by a 45 min treatment with forskolin. The total number of CD4+ TEM cells (N) evaluated from at least 15 videos and set to 100% is indicated below each bar. For statistical analysis a proportion test of the total number of CD4+ TEM cells was performed. (I) Duration of diapedesis along the para- or transcellular pathway across TNF-α- or IL-1βhi -stimulated pMBMECs. Each data point represents one individual CD4+ TEM cell. Per condition at least 50 CD4+ TEM cells from at least 15 videos were evaluated. *p < 0.05; **p < 0.01; ***p < 0.001, (I) one-way ANOVA, followed by the Tukey multiple-comparison test; all p values > 0.05: no significant differences.

characteristics of IL-1βhigh - and TNF-α- stimulated pMBMECs. Cytokine-induced BBB breakdown is expected to lead to a reduced TEER and an increased permeability across the pMBMEC monolayer. Indeed, IL-1βhigh -stimulated pMBMECs monolayers showed a significantly reduced TEER (Fig. 2A) compared to TNFα-stimulated pMBMECs monolayers and permeability under IL1βhigh versus TNF-α-stimulated conditions was increased, albeit nonsignificant due to interexperimental variability, leading to high standard deviations (Fig. 2B). Thus, the enhanced rate of CD4+ TEM -cell diapedesis observed upon IL-1βhigh stimulation of pMBMECs might also be due to a facilitation of paracellular T-cell diapedesis. To address this, we employed pMBMECs isolated from C57BL/6J knockin mice expressing a C-terminal GFP fusion protein of VE-cadherin in the endogenous VE-cadherin locus (VE-CadGFP pMBMECs), allowing to visualize the endothelial junctions in live pMBMECs and thus investigate the pathway of CD4+ TEM -cell diapedesis [9] (Supporting Information Fig. 3).

 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

VE-CadGFP pMBMECs established tight endothelial monolayers (Supporting Information Fig. 4) exactly as C57BL/6J WT pMBMECs. We also confirmed that IL-1βhigh compared to TNF-α-stimulated VE-CadGFP pMBMECs displayed a significantly reduced TEER and increased permeability (Fig. 2C and D), without affecting junctional localization of VE-CadGFP, suggesting that adherens junctions remained intact under both inflammatory stimuli (Supporting Information Fig. 5). Furthermore, shear resistant arrest, crawling, and diapedesis of CD4+ TEM cells on IL-1βhigh or TNF-α-stimulated VE-CadGFP pMBMECs or WT pMBMECs were comparable (data not shown). Thus, VE-CadGFP pMBMECs were perfectly suited to identify the cellular pathway of CD4+ TEM -cell diapedesis across differentially stimulated pMBMECs, expressing high or intermediate cell surface ICAM-1 levels, respectively, by live cell imaging under physiological flow conditions (Supporting Information Videos 3 and 4; Fig. 2E). In order to distinguish paracellular from transcellular diapedesis, we qualified events that transiently interrupted the

www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1043–1058

junctional GFP signal as paracellular diapedesis and those that did not as transcellular diapedesis (Fig. 2E, Supporting Information Videos 3 and 4). A quantitative analysis of such transmigration events revealed that only 28% of CD4+ TEM cells crossed the TNF-α-stimulated VE-CadGFP pMBMEC monolayer via the transcellular pathway, while the majority, namely 72% of CD4+ TEM cell, crossed the TNF-α-stimulated pMBMEC monolayer via the paracellular pathway through the endothelial junctions (Fig. 2H). Similarly, only 30% of CD4+ TEM cells crossed the IL-1βlow stimulated VE-CadGFP pMBMEC monolayer via the transcellular pathway, while the majority of 70% of CD4+ TEM cells used the paracellular pathway (Fig. 2H). In contrast, 52% of CD4+ TEM cells migrated across the IL-1βhigh -stimulated pMBMEC monolayer via the transcellular pathway with the remaining 48% of the CD4+ TEM cells crossing via the paracellular pathway (Fig. 2H). Thus, the endothelial cell surface levels of ICAM-1 rather than the type of inflammatory stimulus or barrier permeability per se determined the cellular pathway of CD4+ TEM -cell diapedesis across the inflamed BBB in vitro. To validate that the molecular mechanisms regulating junctional tightness of brain endothelial cells did not influence the pathway of CD4+ TEM cell diapedesis across the BBB, we next analyzed the pathway of diapedesis across forskolin-treated pMBMECs. Forskolin is a well characterized stimulator of the cAMP pathway causing a stabilization of the endothelial junctions [10]. As expected, pMBMEC treatment with forskolin significantly increased TEER values (Fig. 2F and G). However, regardless of the pMBMECs monolayer tightness, ratios of paracellular versus transcellular diapedesis of CD4+ TEM cells observed for TNF-α- or IL-1βhigh -stimulated pMBMECs remained unchanged (Fig. 2H). To address if impaired barrier characteristics of IL-1βhigh stimulated pMBMECs allow for faster paracellular T-cell diapedesis when compared to TNF-α-stimulated pMBMECs, we measured the duration of paracellular and transcellular CD4+ TEM -cell diapedesis events across TNF-α- or IL-1βhigh -stimulated VE-CadGFP pMBMECs. Interestingly, the duration of T-cell diapedesis events through VE-CadGFP pMBMECs was found to be comparable irrespective of stimulation by TNF-α or IL-1βhigh or the pathway of diapedesis utilized (Fig. 2I). Taken together, our observations show that the cellular pathway of CD4+ TEM -cell diapedesis across the inflamed BBB is regulated by mechanisms distinct from those regulating loss of barrier integrity. Rather, we observed that cell surface levels of endothelial ICAM-1 determine the cellular pathway of T-cell diapedesis across the BBB such that high cell surface ICAM-1 expression promotes transcellular T-cell diapedesis across the BBB.

Lack of ICAM-1 and -2 abrogates para- but not transcellular CD4+ TEM cell diapedesis across the BBB Considering the essential role of endothelial ICAM-1 and ICAM2 in mediating CD4+ TEM -cell polarization and crawling on the BBB and the decisive role of endothelial ICAM-1 in directing transcellular versus paracellular T-cell diapedesis across the BBB, we  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Cellular immune response

speculated that in the complete absence of endothelial ICAM-1 and ICAM-2 on pMBMECs T-cell diapedesis via the transcellular pathway would be completely abrogated. To address this, we employed VE-CadGFP pMBMECs isolated from ICAM-1null // ICAM-2−/− VE-CadGFP-C57BL/6J mice. Lack of endothelial ICAM-1 and ICAM-2 on TNF-α-stimulated ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs led to a severe reduction of CD4+ TEM -cell arrest by 54% (36 ± 4 CD4+ TEM cells per FOV) compared to TNFα-stimulated WT pMBMECs (78 ± 13 CD4+ TEM cells per FOV; Figs. 1C and 3A). In contrast, CD4+ TEM -cell arrest to IL-1βhigh stimulated ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs (62 ± 4 CD4+ TEM cells per FOV) was reduced by only 29% compared to IL-1βhigh -stimulated WT pMBMECs (87 ± 10 CD4+ TEM cells per FOV; Figs. 1C and 3A). Thus, IL-1βhigh -stimulated ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs allowed for significantly more CD4+ TEM cells to arrest under flow than TNF-α-stimulated ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs. This was due to the increased expression levels of endothelial VCAM-1 after IL-1βhigh versus TNF-α stimulation on ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs (Fig. 3B) because addition of functionblocking monoclonal antibodies against VCAM-1 and its α4-integrin ligands completely abrogated CD4+ TEM -cell arrest to either IL-1βhigh - or TNF-α-stimulated ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs (Supporting Information Videos 5 and 6). These experiments confirmed that in the absence of endothelial ICAM-1 and ICAM-2 irrespective of the inflammatory stimulus, VCAM-1 represented the only endothelial ligand mediating CD4+ TEM -cell arrest on stimulated pMBMECs. Importantly, postarrest adhesive interactions of CD4+ TEM cells on IL-1βhigh -stimulated ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs resembled those previously described for CD4+ TEM cells on TNF-α-stimulated pMBMECs, lacking endothelial ICAM-1 and ICAM-2 [5]. Under both conditions, we found adhesive T cells to remain stationary showing VCAM-1-mediated recurrent arrest (data not shown). We determined that 14.8 ± 5.5% of arrested T cells could still cross the TNF-α-stimulated ICAM-1null //ICAM2−/− pMBMECs, while 41.5 ± 4.4% of arrested T cells were able to migrate across IL-1βhigh -stimulated ICAM-1null //ICAM-2−/− pMBMECs during an observation period of 20 min (Fig. 3C). A direct comparison of the numbers of arrested T cells and the percentages of diapedesis for IL-1βhigh - or TNF-α-stimulated ICAM1null //ICAM-2−/− pMBMECs (Fig. 3A and C) to WT pMBMECs (Fig. 1C and D) substantiated the massively reduced number of CD4+ TEM cells that underwent diapedesis in the absence of endothelial ICAM-1 and ICAM-2. Next, we investigated if absence of endothelial ICAM-1, ICAM-2, or of both still allowed for paracellular or transcellular T-cell diapedesis across the inflamed BBB. As the low numbers of T cells still able to cross the TNF-α-stimulated ICAM-1null // ICAM-2−/− pMBMECs (Fig. 3C) did not allow for further analysis of the cellular pathway of diapedesis, we focused on investigating the pathways of CD4+ TEM ICAM-1null cell diapedesis across IL-1βhigh -stimulated −/− VE-CadGFP pMBMECs, ICAM-2 VE-CadGFP pMBMECs, and ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs. As described www.eji-journal.eu

1047

1048

Michael Abadier et al.

Eur. J. Immunol. 2015. 45: 1043–1058

Figure 3. Predominant transcellular diapedesis of CD4+ TEM cells across ICAM-1null //ICAM-2−/− pMBMECs. (A) Absolute numbers of arrested CD4+ TEM cells per FOV on ICAM-1null //ICAM-2−/− pMBMECs stimulated with TNF-α or IL-1βhigh . Bars represent mean + SEM of three or more independent videos. (B) Quantitative cell surface protein expression of VCAM-1 on ICAM-1null //ICAM-2−/− pMBMECs was determined by On-Cell Western and expressed relative to the respective unstimulated sample that was set to 1.0 (not shown). Graphs show the mean + SD (n = 3) of one representative of three independent experiments, each performed in triplicate. (C) Postarrest dynamic behavior of CD4+ TEM cells on TNF-α- or IL-1βhigh -stimulated ICAM-1null //ICAM-2−/− pMBMECs within 15 min. Each behavioral category is expressed in percent of arrested CD4+ TEM cells. Bars represent mean + SEM of three or more independent videos. (D and E) Quantification of paracellular (gray) and transcellular (black) diapedesis events across IL-1βhigh -stimulated VE-CadGFP pMBMECs. Total numbers of diapedesis events, N, evaluated from at least 15 independent movies per condition and set to 100% are presented at the bottom of (D) and (E). (D) ICAM-1null //ICAM-2−/− (I1null //I2−/− ), ICAM-1null (I1null ), ICAM-2−/− (I2−/− ) VE-CadGFP pMBMECs. (E) VE-CadGFP pMBMECs were incubated with anti-VCAM-1 antibody (6C7.1 or MK2.7) and CD4+ TEM cells were incubated with anti-α4 integrin antibody (PS/2) or with the respective control antibody prior to the experiment for 20 min. Significance was calculated by a proportion test for the total number of diapedesis events.**p < 0.01, ***p < 0.001; (A to C) unpaired Student’s t-test.

before, absence of endothelial ICAM-1 but not ICAM-2 significantly reduced the number of T cells able to arrest on IL-1βhigh -stimulated pMBMECs when compared to WT pMBMECs (data not shown) [5]. We found that the fractions of transcellular and paracellular CD4+ TEM -cell diapedesis on ICAM-1null VE-CadGFP pMBMECs or on ICAM-2−/− VE-CadGFP pMBMECs (Fig. 3D) were similar to that observed on IL-1βhigh stimulated WT VE-CadGFP pMBMECs (Fig. 2H). In contrast, in the absence of both, endothelial ICAM-1 and ICAM-2, 82% of arrested CD4+ TEM cells were observed to cross the IL-1βhigh -stimulated ICAM-1null //ICAM-2−/− VE-CadGFP pMBMECs monolayers via the transcellular pathway, while only a minor fraction of 18% crossed the monolayer via the paracellular pathway (Fig. 3D). Thus, in the complete absence of ICAM-1 and ICAM-2 and thus lack of T-cell polarization and crawling, a low number of CD4+ TEM cells can still cross the BBB and do so almost exclusively via the transcellular route under the inflammatory conditions studied.  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Endothelial ICAM-1 and ICAM-2 promote the formation of CD4+ TEM -cell protrusions To analyze the role of endothelial ICAM-1 and ICAM-2 on pMBMECs for the formation of cellular protrusions by the CD4+ TEM cells, we next employed scanning electron microscopy of CD4+ TEM cells fixed, while adhering to and dynamically interacting with IL-1βhigh -stimulated WT pMBMECs under flow conditions (Fig. 4A). Indeed, we observed that CD4+ TEM cells crawling on IL-1βhigh -stimulated WT pMBMECs formed high numbers of long cellular protrusions toward the endothelial surface (1.5 ± 0.1 μm in length, 15 ± 2 protrusions/cell; Fig. 4C and D).) After having observed that diapedesis of CD4+ TEM cells across the BBB occurred almost exclusively via the transcellular pathway in the absence of endothelial ICAM-1 and ICAM-2, we next investigated if lack of endothelial ICAM-1 and ICAM-2 influences protrusion formation by CD4+ TEM cells. Indeed, we observed www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1043–1058

Cellular immune response

α4-integrins does not seem to favor a specific cellular pathway of CD4+ TEM -cell diapedesis across the inflamed BBB.

ICAM-1- and ICAM-2-deficient C57BL/6J mice develop clinical EAE

Figure 4. Reduced cellular protrusions of CD4+ TEM cells adherent on ICAM–1null //ICAM-2−/− pMBMECs. (A and B) Ultrastructural analysis of shear resistant adherent CD4+ TEM cells on IL-1βhigh -stimulated (A) WT or (B) ICAM-1null //ICAM-2−/− pMBMECs. Scale bar: 5 μm. Images show representative T cells of 50 or more T cells inspected. (C and D) Analysis of cellular protrusion of CD4+ TEM cells shear resistantly adherent to IL-1βhigh -stimulated WT or ICAM-1null //ICAM-2−/− pMBMECs. (C) Average length of protrusions per CD4+ TEM cell and (D) average number of CD4+ TEM -cell protrusions. (C and D) Data are shown as mean + SEM (n = 35) and are pooled from eight FOVs (121 × 91 μm2 ). ***p< 0.001, unpaired Student’s t-test.

that on IL-1βhigh -stimulated ICAM-1null //ICAM-2−/− pMBMECs (Fig. 4B), CD4+ TEM cells remained roundish and formed less and shorter protrusions (1 ± 0.1 μm in length, 5 ± 1 protrusions/cell) than on IL-1βhigh -stimulated WT pMBMECs (Fig. 4C and D). Thus, transcellular diapedesis of T cells across BBB endothelial cells did not rely on high numbers of long T-cell protrusions.

Endothelial VCAM–1 is dispensable for CD4+ TEM cell diapedesis across IL–1βhigh stimulated pMBMECs To further analyze the alternative mechanism of transcellular diapedesis of CD4+ TEM cells in the absence of endothelial ICAM-1 and ICAM-2, we next asked if high expression levels of endothelial VCAM-1 as present on IL-1βhigh -stimulated ICAM-1null //ICAM2−/− pMBMECs would account for the relative increase in transcellular CD4+ TEM -cell diapedesis. We investigated the cellular pathway of CD4+ TEM -cell diapedesis across IL-1βhigh -stimulated VE-CadGFP pMBMECs in the presence of function-blocking antibodies directed against VCAM-1 and α4-integrins. We found that in the functional absence of VCAM-1 and α4-integrins, 55% of the CD4+ TEM cells crossed the IL-1βhigh -stimulated VE-CadGFP pMBMECs via the transcellular pathway, which is comparable to the 57% of CD4+ TEM cells observed to cross the IL-1βhigh -stimulated pMBMEC monolayer under control conditions (Fig. 3E). Thus, engagement of endothelial VCAM-1 by  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Due to our surprising observation that a limited transcellular diapedesis of CD4+ TEM cells is possible across IL-1βhigh -stimulated ICAM-1null //ICAM-2−/− pMBMECs, we next asked if CD4+ TEM cells could cross the inflamed BBB in vivo in ICAM-1null // ICAM-2−/− C57BL/6J mice. To this end, we induced active EAE (aEAE) in ICAM-1null //ICAM-2−/− C57BL/6J mice and their WT littermates by immunization with MOGaa35–55 in CFA. Confirming an important role of ICAM-1 and ICAM-2 in EAE pathogenesis, we observed a delayed onset of clinical EAE in ICAM-1null // ICAM-2−/− C57BL/6J mice compared to WT C57BL/6J mice, while disease incidence (76 ± 14.5% versus 93.3 ± 6.6% in WT versus ICAM-1null //ICAM-2−/− C57BL/6J mice) and disease severity as determined by the area under the curve (AUC) were not significantly different (Fig. 5A). This indicated that myelin oligodendrocyte glycoprotein (MOG)-specific CD4+ T cells can gain access into the CNS in the absence of both ICAM-1 and ICAM2. In fact, histological analysis revealed no significant differences in size and number of CD45+ cellular infiltrates or the increased immunostaining for endothelial VCAM-1 in WT and ICAM-1null // ICAM-2−/− C57BL/6J mice during aEAE (Supporting Information Fig. 6). Delayed onset of aEAE could be due to the involvement of ICAM-1 in the formation of the immunological synapse and thus antigen-specific activation of encephalitogenic T cells in the LNs. To specifically evaluate the effector phase of EAE and thus the role of endothelial ICAM-1 and ICAM-2 in T-cell trafficking to the CNS in neuroinflammation, we studied development of EAE after the transfer of freshly activated MOGaa35–55 -specific WT CD4+ T cells (transfer EAE [tEAE]) into ICAM-1null //ICAM-2−/− C57BL/6J mice and WT littermates. Confirming a contribution of endothelial ICAM-1 and ICAM-2 in T-cell trafficking to the CNS, we observed a significantly reduced disease incidence in ICAM-1null //ICAM-2−/− C57BL/6J recipient mice (100% in WT versus to 79 ± 9.5% in ICAM-1null //ICAM-2−/− C57BL/6J mice). Thus, a significant number of ICAM-1null //ICAM-2−/− C57BL/6J mice did not develop any clinical disease upon adoptive transfer of encephalitogenic T cells, resulting in a significantly reduced AUC for overall disease activity (Fig. 5B). However, disease onset and clinical severity of EAE in those ICAM-1null //ICAM-2−/− C57BL/6J recipient mice developing clinical EAE was not different from that observed in WT recipients (Fig. 5B). Taken together, in accordance to our in vitro observations in most but not all mice, encephalitogenic CD4+ T-cell blasts were able to invade the CNS and to cause clinical EAE symptoms despite the absence of ICAM-1 and ICAM-2. Based on our observations that ICAM-1null //ICAM-2−/− C57BL/6J mice can develop clinical EAE, we finally asked if our in vitro observations highlighting important roles of endothelial www.eji-journal.eu

1049

1050

Michael Abadier et al.

Eur. J. Immunol. 2015. 45: 1043–1058

Figure 5. ICAM-1null //ICAM-2−/− C57BL/6J mice develop EAE. (A) A representative clinical disease course of MOGaa35–55 -induced aEAE in WT C57BL/6J mice (black line, n = 6) or ICAM-1null //ICAM-2−/− C57BL/6J mice (gray line, n = 5). Average disease scores + SEM are shown as assessed twice daily. The statistical analysis of a total of three aEAE experiments comparing a total of 17 WT and 16 ICAM–1null //ICAM–2−/− C57BL/6J mice showed a highly significant difference in mean day of disease onset. The AUC as a measure of total disease activity analyzed until day 32 of all mice was not significantly different between WT and ICAM-1null //ICAM-2−/− C57BL/6J mice. (B) Clinical course of one representative EAE experiment in WT C57BL/6J (black line, n = 9) or ICAM-1null //ICAM-2−/− C57BL/6J recipient mice (gray line, n = 8). Average disease scores + SEM are shown as assessed twice daily. The statistical analysis of all three tEAE experiments with a total number of 25 WT C57BL/6J mice and 26 ICAM-1null //ICAM2−/− C57BL/6J mice did not show a significant difference in the mean day of disease onset. A significant reduction in overall disease activity as measured by the AUC was observed in ICAM-1null //ICAM-2−/− C57BL/6J recipient mice versus WT mice due to the reduced disease incidence in the ICAM-1null //ICAM-2−/− C57BL/6J recipient mice. Mean day of disease onset and AUC were calculated for each mouse. (C) Numbers of firmly adherent 2D2 TCR MOGaa35–55 T-cell blasts in inflamed spinal cord microvessels of WT, ICAM-1tm1Jcgr , or ICAM-1tm1Jcgr //ICAM-2−/− C57BL/6J mice at 10, 30, 60, and 120 min after T-cell transfer as observed by intravital micrsocopy via a spinal cord window. T cells were left untreated (black, dark gray, and white bars) or were pretreated with the anti α4-integrin antibody PS/2 (light gray bars). Data are pooled from 13 WT, five ICAM-1tm1Jcgr (I1−/− ), three ICAM-1tm1Jcgr + PS/2 (I1−/− + anti-α4), eight ICAM-1tm1Jcgr //ICAM-2−/− (I1/-2−/− ) animals per condition, and four to six FOVs per spinal cord window, respectively. Bars represent mean + SEM. *p < 0.05; **p < 0.01; ***p < 0.001, Mann–Whitney test to compare two variables.

ICAM-1 and ICAM-2 in CD4+ TEM -cell extravasation across the inflamed BBB could be confirmed in vivo in the presence of the multiple proinflammatory stimuli playing a role in EAE. To this end, we directly observed the interaction of fluorescently labeled 2D2 TCR MOGaa35–55 CD4+ TEM cells with the inflamed spinal cord microvasculature of anesthetized WT, ICAM-1tm1Jcgr , or ICAM-1tm1Jcgr //ICAM-2−/− mice afflicted with EAE by intravital

 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

microscopy (IVM) [11]. In all three mouse lines comparable numbers of CD4+ TEM cells made transient contact characterized as rolling or capture with the inflamed spinal cord microvasculature (data not shown). To test for prolonged shear resistant adhesion, we scanned multiple FOVs of the spinal cord windows at 10, 30, 60, and 120 min after transfer of CD4+ TEM cells and evaluated the number of permanently adhering fluorescent CD4+ TEM cells

www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1043–1058

per FOV. While lack of endothelial ICAM-1 led to a slight, but nonsignificant reduction of the total number of adherent CD4+ TEM cells per FOV, additional antibody blocking of the VCAM-1 ligand α4-integrin on CD4+ TEM cells almost completely abrogated CD4+ TEM cell adhesion in the inflamed spinal cord microvessels (Fig. 5C). Similarly, in the absence of both endothelial ICAM-1 and ICAM-2, CD4+ TEM cells almost completely failed to maintain adhesive interactions with the inflamed spinal cord microvasculature (Fig. 5C). Thus, our in vivo observations fully validated our in vitro data defining the critical roles of endothelial ICAM-1 or VCAM-1 in mediating shear resistant arrest and of endothelial ICAM-1 or ICAM-2 in mediating sustained adhesion to the inflamed BBB endothelium, respectively [5]. Intriguingly, the development of ameliorated EAE in ICAM-1null //ICAM-2−/− mice suggests that inflammatory conditions in vivo do allow for the migration of some CD4+ TEM cells across the BBB in the absence of ICAM-1 and ICAM-2 as observed by us in vitro.

Discussion In this study, we highlight the active contribution of the brain microvascular endothelium in regulating the pathway of CD4+ TEM -cell diapedesis across the inflamed BBB. Our results demonstrate that inflammatory conditions, inducing high cell surface expression levels of endothelial ICAM-1, promoted rapid initiation of transcellular diapedesis of CD4+ T cells across the BBB, while intermediate surface levels of endothelial ICAM-1 irrespective of the cytokine stimulus rather directed crawling CD4+ TEM cells to paracellular sites of diapedesis. In addition, we show that the route of CD4+ TEM cell diapedesis across the BBB was independent of the loss of its barrier properties. However, despite the essential roles of endothelial ICAM-1 and ICAM-2 in mediating CD4+ TEM -cell polarization and crawling on the BBB, a low number of CD4+ TEM cells was found to be able to cross the inflamed BBB via an ICAM-1 and ICAM-2 independent, thus alternatively regulated, transcellular pathway apparently sufficing for the induction of albeit ameliorated EAE in ICAM-1null //ICAM-2−/− C57BL/6J mice. Due to the unique complexity and continuity of the BBB tight junctions and previous observations at the ultrastructural level showing that immune cell diapedesis across the inflamed BBB occurs adjacent to morphological intact tight junctions [12–14], we hypothesized that CD4+ TEM cells would preferentially cross the inflamed BBB via a transcellular pathway. Our present findings show that T cells can cross the BBB via both, the transcellular and the paracellular pathway and that this is indeed controlled by the BBB via the cell surface expression levels of ICAM-1. This suggests that in the absence or during onset of neuroinflammation, when low levels of ICAM-1 are expressed, CD4+ TEM cells cross the BBB preferentially through the endothelial junctions, a pathway that is preferentially used by immune cells to extravasate in peripheral vascular beds. In contrast, during ongoing neuroinflammation, high cell surface expression of ICAM-1 on the brain  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Cellular immune response

endothelium significantly enhances transcellular CD4+ TEM -cell diapedesis across the BBB to more than 50%, which in this magnitude is unique to this vascular bed and might allow for efficient immune cell recruitment into the CNS, while not further impairing tight junction integrity. An active contribution of the BBB endothelium to CD4+ TEM -cell extravasation has been proposed before (reviewed in [4, 7]). Previously, we have shown that endothelial ICAM-1 and VCAM-1 mediate shear resistant arrest of CD4+ TEM cells on the inflamed BBB, while endothelial ICAM-1 and ICAM-2 are essential for CD4+ TEM -cell polarization and crawling at least in vitro [5]. Extended crawling of CD4+ TEM cells on the luminal surface of the inflamed BBB against the direction of blood flow prior to diapedesis has been observed by us in vitro [5] and by others during the onset of EAE in vivo [6]. The crawling behavior observed for CD4+ TEM cells prior to extravasation across the BBB is unique and distinct from that observed for neutrophils on the BBB, which exclusively crawl with the direction of flow [9]. In the absence of endothelial ICAM-1 and ICAM-2, CD4+ TEM cells fail to polarize and crawl and only few diapedesis events can be observed [5]. Considering this key role of endothelial ICAM-1 for the dynamic interactions of CD4+ TEM cells with the BBB endothelium, we hypothesized that endothelial ICAM-1 and probably ICAM-2 play a central role in preferentially directing T cells to rare transcellular sites for diapedesis across the BBB [7]. To this end, we established cytokine stimulation protocols of our in vitro BBB model allowing to induce intermediate and high levels of endothelial ICAM-1, with unchanged ICAM-2 and sustained high VCAM-1 on the endothelial cell surface. A number of cytokines, including TNF-α and IL-1β, have been shown to play an important role in autoimmune CNS inflammatoy diseases. TNF-α stimulation was chosen in the present study as the inflammatory condition already used by us previously [5, 11, 15], while IL-1β was ultimately chosen because it allowed titrating the cell surface levels of endothelial ICAM-1 without changing the levels of VCAM-1. Using these cytokines, we could show that irrespective of the cytokine stimulus used, intermediate cell surface expression of ICAM-1 on pMBMECs correlated with extended CD4+ TEM -cell crawling against the direction of flow toward paracellular sites of diapedesis. However, high cell surface levels of ICAM-1 correlated with shorter crawling distances and supported almost instantaneous diapedesis of the polarized CD4+ TEM cells via the transcellular pathway. Thus, extended crawling of CD4+ TEM cells over exceptionally long distances on the BBB [6] might be limited to immunosurveillance and to the onset of autoimmune neuroinflammation, when cell surface levels of ICAM-1 on the BBB are still low. The cytoplasmic domain of endothelial ICAM-1 induces multiple downstream signaling events in brain endothelial cells, which are at least in part essential for efficient lymphocyte diapedesis (reviewed in [4]). Among these events is the activation of the small GTPase Rho via the tyrosine kinase p60src, leading to the formation of cortical actin filaments [16–19]. At the endothelial junctions, ICAM-1 engagement induces tyrosine phosphorylation of the adherens junction protein, VE-cadherin, in brain endothelial cells [16, 20]. Overexpression of VE-cadherin variants www.eji-journal.eu

1051

1052

Michael Abadier et al.

mutated with tyrosine to phenylalanine exchanges in the cytoplasmic domain in brain endothelial cells demonstrated an important role of VE-cadherin tyrosine phosphorylation for diapedesis of lymphocytes mainly affecting the paracellular pathway [20]. Furthermore, dephosphorylation of VE-cadherin at Y731—presumably being independent of ICAM-1—is required for the diapedesis of CD4+ TEM cells across brain endothelial cells in vitro [21]. In addition, density of endothelial ICAM-1 is important for CD4+ TEM cell sustained shear resistant adhesion. We have recently shown that high, but not low concentrations of immobilized ICAM-1 can support shear resistant adhesion of effector T cells lacking the integrin activator Kindlin-3 [22]. This finding might be related to the previous observation of others that only high but not low densities of immobilized ICAM-1 allow high-affinity lymphocyte LFA-1 to efficiently bind without prior activation of phosphatidylinositol 3-OH kinase (PI(3)K) required for lateral integrin mobility, leading to LFA-1 clustering and increased avidity [23]. In summary, one might speculate that at low concentrations of endothelial ICAM-1, the signaling events induced by the crawling T cell on ICAM-1 are required to allow for changes in the tight junction architecture favoring paracellular diapedesis. High densities of ICAM-1, triggering high-avidity LFA-1 might, however, promote immediate transcellular diapedesis. But how do cell surface levels of endothelial ICAM-1 direct T-cell diapedesis to paracellular or transcellular routes? During crawling, lymphocytes dynamically form and retract invasive protrusions toward the endothelial cell. Studies on peripheral vascular beds have shown that hereby lymphocyte invaginations are forced into the endothelial surface, which are supposed to precede specifically their transcellular diapedesis [24–26]. Obviously, invaginations and pore formation require membrane plasticity and fusion activities of the endothelial cell—an assumption supported by the enrichment of caveolae markers and fusogenic proteins at the site of invaginations [24, 25]. Previous imaging studies demonstrating a translocation of ICAM-1 from the luminal to the abluminal surface of endothelial cells suggested a possible role of ICAM-1 in the process of transcellular diapedesis [24]. While diapedesis of human neutrophils or monocytes across either immortalized brain endothelial cells or BBB-like TNF-α-stimulated HUVECs was demonstrated to occur predominantly via the paracellular pathway [27], overexpression of ICAM-1 in HUVECs has indeed been shown to increase transcellular over paracellular diapedesis of neutrophils across these endothelial cells [28]. However, as HUVECs are neither barrier forming nor mature nor microvascular endothelial cells and because we have observed that the multistep extravasation of neutrophils across our in vitro BBB model is fundamentally different from that observed for T cells [9], these observations do not allow to draw any conclusions on the cellular pathway of CD4+ TEM diapedesis across the inflamed BBB [9, 29]. In our study, we observed that CD4+ TEM -cell crawling on pMBMECs with high cell surface levels of ICAM-1 under flow correlated with the formation of many cellular protrusions oriented toward the endothelial surface, while the number and length of these protrusions were reduced in the absence of endothelial ICAM-1 and ICAM-2. This might be due to the lack of endothelial ligand for  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Eur. J. Immunol. 2015. 45: 1043–1058

LFA-1, which has been found on invasive protrusions of human CD3+ T cells contacting clustered endothelial ICAM-1 [25, 30]. Thus, like in peripheral vascular beds, endothelial ICAM-1 and ICAM-2 on the BBB seem to be critically involved in allowing for the formation of cellular protrusions of CD4+ TEM cells. The IL-1βhigh induced inflammatory conditions used in this study to trigger high cell surface levels of endothelial ICAM-1 on pMBMECs also impaired barrier characteristics of pMBMEC monolayers as determined by increased paracellular permeability and reduced TEER. In accordance to our previous observations [15], TNF-α stimulation of pMBMECs failed to compromise barrier function. As the percentage of T cells crossing IL-1βhigh -stimulated pMBMECs via the transcellular pathway was significantly higher than TNF-α-stimulated pMBMECs, the loss of junctional integrity of the BBB is regulated by mechanisms other than those influencing the cellular pathway of T-cell diapedesis. Forskolin-induced tightening of the inflamed pMBMEC monolayers further substantiated that BBB permeability and cellular pathways of diapedesis are regulated by independent mechanisms. The diterpene forskolin raises the intracellular cAMP level via an activation of the adenylate cyclase. In vascular endothelial cells, elevated cAMP levels are known to increase monolayer barrier properties via Epac1 and Protein kinase A (PKA) downstream events [10]. Junctional VE-cadherin is stabilized via the activity of Epac1, and PKA activity stabilizes microtubules and reduces Rho GTPase-induced actomyosin contractility. Thereby, forskolin counteracts ICAM1-induced Rho GTPase activation and actomyosin contractility. As treatment of IL-1βhigh - and TNF-α-stimulated pMBMECs with forskolin resulted in a significant increase in the TEER, but also failed to influence the cellular pathway of CD4+ TEM cell diapedesis across pMBMEC monolayers, we conclude from our observations that the cell surface levels of endothelial ICAM-1 rather than the loss of barrier function of the BBB endothelium seem to influence the cellular route of CD4+ TEM cells diapedesis across the BBB. If transcellular T-cell diapedesis across the inflamed BBB is due to unique regulatory mechanisms of the actomyosin cytoskeleton in inflamed BBB endothelium or is rather owed to alterations of the unique BBB tight junctions in inflamed BBB endothelium remains to be shown. Having established that high cell surface levels of endothelial ICAM-1 direct CD4+ TEM cells preferentially to transcellular sites of diapedesis, we were very surprised that the low number of CD4+ TEM cells still able to cross the BBB in the complete absence of endothelial ICAM-1 and ICAM-2 almost exclusively chose a transcellular pathway. This diapedesis event occurred without prior crawling and lack of intense palpation of the endothelial surface by invasive protrusions of the T cells as evidenced by our scanning EM analysis. The dramatic change in the dynamic interaction of CD4+ TEM cells with ICAM-1null //ICAM-2−/− pMBMECs versus WT pMBMECs therefore seems to promote an alternative, almost exclusively, transcellular T-cell diapedesis pathway across the BBB that is independent of ICAM-1/ICAM-2 and LFA-1. A similar phenomenon has been observed previously when studying neutrophil extravasation in inflamed cremaster muscle venules, where neutrophils were found to crawl on the endothelium using Mac-1. Yet, www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1043–1058

in the absence of Mac-1, a reduced number of neutrophils were still able to bind to the vascular wall via LFA-1 and could then cross the endothelium via a transcellular pathway [29]. Endothelial VCAM-1 allowed increased accumulation of CD4+ TEM cells on IL-1βhigh versus TNF-α-stimulated ICAM-1null // ICAM-2−/− pMBMECs. However, a significant role of VCAM-1 for directing the transcellular pathway of CD4+ TEM cells across IL-1βhigh -stimulated ICAM-1null //ICAM-2−/− pMBMECs was ruled out by antibody blocking experiments of VCAM-1 on IL-1βhigh or TNF-α-stimulated WT pMBMECs. Currently, it is a matter of speculation if IL-1β induces the utilization of the transcellular pathway via additional mechanisms distinct from the modulation of ICAM-1 expression levels that could be revealed during diapedesis across ICAM-1null //ICAM-2−/− pMBMECs and therefore likely be also operative in WT pMBMECs. Possible factors could be endothelial chemokines or lipid mediators that were demonstrated to be essential for diapedesis, but not for arrest or crawling of effector T cells across endothelial cells of peripheral vascular beds in vitro [26]. Considering that some T cells can cross the BBB in the absence of endothelial ICAM-1 and ICAM-2, we finally asked if encephalitogenic T cells can cross the BBB and induce EAE in mice lacking ICAM-1 and ICAM-2. To this end, we cross-bred ICAM-1null mice, devoid of all ICAM-1 splice isoforms [31], and the ICAM-2−/− mice [32] and backcrossed these mice for at least eight generations into C57BL/6J mice to ensure a homogenous EAE-susceptible genetic background [9]. As expected, we observed delayed onset of MOGaa35–55 -induced EAE (aEAE) in ICAM-1null //ICAM-2−/− C57BL/6J mice, when compared to WT C57BL/6J mice. However, once clinical disease had started, we failed to observe any difference in clinical severity of EAE in the presence or absence of ICAM-1 and ICAM-2. As this suggested an essential role of ICAM-1 and ICAM-2 in in vivo T-cell activation, rather than in interaction with the BBB endothelium, we next investigated development of EAE in ICAM-1null //ICAM-2−/− mice versus WT mice upon the transfer of MOG-specific TEM cells. Confirming a role of endothelial ICAM-1 and ICAM-2 in the effector phase of the disease and thus most probably in T-cell trafficking to the CNS in mice lacking ICAM-1 and ICAM-2 when compared to WT C57BL/6J mice, we found a significantly decreased disease incidence. Notably, in those ICAM-1null //ICAM-2−/− mice developing clinical EAE upon T-cell transfer, disease severity was found to be comparable to WT mice. In apparent contrast to previous studies, which demonstrated a complete resistance of ICAM-1null mice for the development of tEAE [33], we here observed that some but not all ICAM-1null //ICAM-2−/− mice were resistant to tEAE. Like ICAM1, ICAM-2 is expressed on many different cell types fulfilling different functions. Considering previous findings that ICAM-1null T cells show an altered cytokine profile [33], lack of ICAM-1 in C3−/− mice worsens the clinical course of aEAE compared to C3−/− C57BL/6J mice developing attenuated EAE [34] and transfer of encephalitogenic WT T cells into CD11a−/− C57BL/6J mice lacking LFA-1—the T-cell ligand of ICAM-1 and ICAM-2—induces more severe tEAE [35], it is tempting to speculate that absence of both ICAM-1 and ICAM-2 might alter characteristics of a variety of host cells allowing for the development of EAE.  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Cellular immune response

Our IVM imaging of the interaction of encephalitogenic T cells with the inflamed spinal cord microvasculature of ICAM-1 tm1Jcgr mice treated with an anti-α4-integrin antibody or ICAM1tm1Jcgr //ICAM-2−/− mice suffering from EAE were in confirmation to our previous in vitro observations and revealed that endothelial VCAM-1 and ICAM-1 or ICAM-1 and ICAM-2 are essential for sustained T-cell adhesion to the inflamed BBB in vivo [5]. This therefore suggests that—as observed in vitro—at least in the majority of mice a low number of CD4+ TEM cells is able to cross the inflamed BBB in the absence of ICAM-1 and ICAM-2 and can gain access to the CNS parenchyma allowing for the development of EAE. Nevertheless, the reduced incidence of clinical tEAE observed in ICAM-1null //ICAM-2−/− mice emphasizes that in some of these animals absence of ICAM-1/ICAM-2 mediated T-cell polarization and crawling becomes rate limiting, resulting in too few CD4+ TEM cells crossing the BBB in order to trigger EAE. Taken together, we here show for the first time that the cell surface level of endothelial ICAM-1 rather than the loss of barrier properties of the BBB seem to be most critical in directing the cellular pathway of CD4+ TEM -cell diapedesis across the BBB. We further show that despite their prominent role in T-cell trafficking, complete absence of endothelial ICAM-1 and ICAM-2 allows for rare transcellular diapedesis events across the BBB in vitro and likely in vivo. This finding might explain why blocking LFA-1/ICAM-1 in MS patients failed to ameliorate disease [36, 37], presumably because invasion of encephalitogenic CD4+ TEM cells into the CNS was never completely abrogated. In contrast, the antiα4-integrin antibody natalizumab [38] might be successful in the treatment of MS patients because it is blocking a step preceding the role of LFA-1/ICAM-1 and ICAM-2 [39].

Materials and methods Antibodies and cytokines Recombinant murine TNF-α was from PromoKine (Vitaris AG, Baar, Switzerland), recombinant murine IL-1β and recombinant murine IL-12 were from PeproTech (Rocky Hill, NJ, USA), and recombinant murine IL-23 was from R&D Systems (Minneapolis, MN, USA). The rat anti-mouse hybridoma supernatants containing antibodies to ICAM-1 (29G1), VCAM-1 (9DB3, 6C7.1, MK2.7), PECAM-1 (MEC13.3), ICAM-2 (3C4), CD45 (M1/9), and antihuman CD44 (9B5) were described before [5]. The rat anti-IFN-γ monoclonal antibody was produced from the hybridoma XMG1.2, kindly provided by Jean-Charles Guery (Toulouse, France) [40]. Goat anti-rat IgG Alexa Fluor 680 was from Life Technologies (Invitrogen, Lucerne, Switzerland).

Mice C57BL/6J mice were obtained from Harlan (Horst, Netherlands) and Janvier (Genest Saint Isle, France). 2D2 TCR MOG transgenic C57BL/6J mice expressing a T-cell receptor www.eji-journal.eu

1053

1054

Michael Abadier et al.

recognizing MOGaa35–55 in the context of MHC class II (IAb ) were obtained from V. K. Kuchroo (Boston, MA, USA) [41]. ICAM-1−/− (ICAM-1tm1Jcgr ) mice were generated by insertion of a neomycin resistance gene into the fourth exon of the ICAM-1 gene [42]. ICAM-1null (Icam1tm1Alb ) mice, generated by deletion of the entire coding region of the ICAM-1 gene [33], were kindly provided by D. C. Bullard (Birmingham, Alabama, USA). ICAM-2−/− (Icam2tm1Jcgr ) mice were described previously [32]. ICAM-1null //ICAM-2−/− mice were created by cross-breeding [9]. VE-CadGFP knockin mice were provided by D. Vestweber (M¨ unster, Germany) [9, 43]. ICAM-1null VE-CadGFP, ICAM-2−/− VE-CadGFP, ICAM-1null //ICAM-2−/− VE-CadGFP were created by cross-breeding the respective gene targeted mice with VE-CadGFP mice as described before [9]. Prior to use in the experiments shown here, all gene-targeted mice were back-crossed to the C57BL/6J background for at least eight generations and all alleles were bred to homozygosity. Mice were housed in individually ventilated cages under specific pathogen-free conditions. Animal procedures were performed in accordance with the Swiss legislation on the protection of animals and were approved by the veterinary office of the Kanton of Bern.

pMBMECs Isolation and culture of pMBMECs was performed exactly as described before [5, 44]. Cytokine stimulation of pMBMECs was done for 16–20 h with TNF-α at 10 ng/mL or in case of IL-1β at concentrations between 0.05 and 20 ng/mL as indicated, with 20 ng/mL used in most experiments. All experiments were performed in migration assay medium (MAM: DMEM, 5% calf serum, 25 mM HEPES) at 37°C.

Eur. J. Immunol. 2015. 45: 1043–1058

ThinCertTM , Greiner Bio-One, Vitaris AG, Baar, Switzerland) R , were assessed by impedance TEER measurements (CellZscope Nanoanalytics, Muenster, Germany) according to the manufacturer’s instructions.

T cells T cells for in vitro live cell imaging For in vitro experiments, we used the encephalitogenic CD4+ TH1 effector/memory proteolipid protein (PLP) peptide aa139–153 specific T-cell line SJL.PLP7 (CD4+ TEM cells) [45] as described previously [5].

T cells for IVM For IVM, 2D2 MOG-specific T lymphocytes were isolated from spleen and PLN of 2D2 TCR–MOG transgenic C57BL/6J mice. In total, 1 × 107 2D2 T cells were cocultured with 0.5–1 × 107 sublethally irradiated (45 Gy) WT splenocytes in 5 mL restimulation medium (RPMI-1640, 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 1 mM nonessential amino acids, 100 U penicillin–streptomycin, 0.05 mM 2-mercaptoethanol) supplemented with 40 μg/mL MOGaa35–55 for 96 h. Then, freshly activated 2D2 T lymphoblasts were isolated by Nycoprep 1.077 A (Axis-Shield, Dundee, UK) density gradient centrifugation. Successful restimulation and specificity to the MOGaa35–55 antigen was always controlled by 3 H-thymidine incorporation experiments as described before [46].

In vitro live cell imaging Coating of cell culture dishes with recombinant ICAM-1 Coating of recombinant murine ICAM-1-Fc on cell culture surfaces (μ-dish35 mm-low , ibidiVitaris, Baar, Switzerland) precoated with protein A was performed exactly as described before [5]. ICAM-1 was used at 100 nM (high density) or at 40 nM (low density). As a control, DNER-Fc was used at 100 nM.

Permeability assay Permeability of monolayers formed by pMBMECs to 3-kDa dextran coupled to Alexa 680 (LuBioScience, Luzerne, Switzerland) was assessed as described previously [5].

TEER Tightness of monolayers formed by pMBMECs seeded on matrigelcoated filter inserts (0.4 μm pore size, 8.36 mm diameter;  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

In vitro live cell imaging of CD4+ TEM -cell extravasation across pMBMECs cultured on matrigel-coated cell culture surfaces (μ-dish35mm-low , ibidiVitaris) was performed as described before [5, 11]. CD4+ TEM cells were perfused through a custom made flow chamber at 1 × 106 cells/mL for WT pMBMECs or at 2 × 106 cells/mL for ICAM-1null , ICAM-2−/− , or ICAM-1null //ICAM2−/− pMBMECs. Accumulation of CD4+ TEM cells was allowed for 5 min at 0.1 dyn/cm2 , followed by physiological shear at 1.5 dyn/cm2 . Image acquisition was performed at 20× magnification with an inverted microscope (AxioObserver, Zeiss, Feldbach, Switzerland) as described in detail before [11]. Numbers of arrested T cells were counted at 30 s after onset of physiological shear. The behavior of arrested T cells was defined and expressed as fractions of arrested T cells set to 100% as follows: T cells that detached during the observation time (“detachment”), T cells that continuously crawled on the endothelial surface (“crawling”), T cells that remained stationary (“stationary”), T cells that crossed the pMBMECs monolayer with or without prior crawling (“diapedesis”). The event of CD4+ TEM -cell diapedesis across the pMBMECs monolayer became obvious due to the change www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1043–1058

of appearance of the T cells from phase bright (on top of the pMBMECs monolayer) to phase dark (below the pMBMECs monolayer; Supporting Information Video 1). Using the 63× objective (Plan-Neofluar” 63x/1,3) with an FOV of 136 μm × 102 μm and in addition by overlaying the differential interference contrast channel with the GFP fluorescence channel, para- and transcellular diapedesis of T cells across monolayers of VE-CadGFP pMBMECs became visible. Diapedesis with transient loss of the junctional GFP signal was classified as paracellular (Supporting Information Video 3), whereas diapedesis events, which did not affect the junctional VE-CadGFP signal were categorized as transcellular diapedesis (Supporting Information Video 4). Distance and speed of T-cell crawling were evaluated after manual tracking of individual T cells (ImageJ software, National Institute of Health, Bethesda, MD, USA). Each video corresponds to an independent experiment with separate pMBMECs and T cells.

Real-time PCR Total RNA was extracted from nonstimulated or stimulated pMBMECs using High Pure RNA Isolation Kit (ROCHE, Basel, Switzerland). The pMBMECs were left untreated or were stimulated prior to the RNA isolation for 4 h with TNF-α (10 ng/mL) or IL-1β (20 ng/mL, IL-1βhigh ). RNA samples (10 ng) were reverse transcribed into cDNA using random hexamer primers and the Super Script III First Strand cDNA Synthesis kit (InvitrogenTM , Life Technologies). Real-time PCR was performed using MesaGreenqPCR Master Mix Plus for SYBR Assaylow ROX (Eurogentec S.A., Seraing, Belgium) using an Applied BiosystemsViiA 7 machine (Life TechnologiesTM ). Primers (Eurogentec S.A.) were as follows. ICAM-1 (NM 010493): CACGCTACCTCTGCTCCTG (sense) and TCTGGGATGGATGGATACCT (antisense); VCAM-1 (NM 011693): TGGTGAAATGGAATCTGAACC (sense) and CCCAGATGGTGGTTTCCTT (antisense); and ribosomal protein S16 (Rps16) (the endogenous control) (NM 013647): GATATTCGGGTCCGTGTGA (sense) and TTGAGATGGACTGTCGGATG (antisense).

On-Cell Western Quantitative analysis of cell surface protein expression was performed by On-Cell Western analysis as described in [9]. Resting or stimulated pMBMECs grown to confluence in a 384-well clear flat-bottom plate (Greiner Bio-One, Monroe, NC) were incubated with rat anti-mouse monoclonal antibodies reactive with ICAM-1 (25ZC7), ICAM-2 (3C4), VCAM-1 (9DB3), PECAM-1 (Mec13.3), or the isotype control anti-human CD44 (9B5); washed three times with DMEM supplemented with 5% FCS and 25 mMHepes; incubated with the second-stage antibody goat anti-rat-Alexa Fluor 680 for 15 min; washed again; fixed with 1% PFA in PBS; and finally, imaged with the Odyssey Infrared Imaging System (LI-COR Biosciences, Bad Homburg, Germany). Values were normalized to those of the resting condition after subtracting the background value defined as the level of the isotype control antibody staining.  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Cellular immune response

Immunofluorescence staining For immunofluorescence staining, VE-CadGFP pMBMECs were R Chamber SlideTM chamber slides cultured on an 8-well Lab-Tek R , Roskilde, Denimmediately after isolation for 6–8 days (Nunc mark). The staining procedure was as described before [5]. Images were acquired with the AxioObserver.Z1 microscope at 63× magnification (1.40 oil Plan-Apochromat objective, AxioCamMRm camera, Zeiss).

Scanning EM For scanning EM, CD4+ TEM cells were allowed to interact with pMBMECs under flow conditions (1.5 dyn/cm2 ) for 10 min. Then, cells were fixed by perfusion of the flow chamber with 2.5% glutaraldehyde and samples were prepared as described elsewhere [47].

EAE Actively induced EAE aEAE was induced in 8- to 12-week-old female C57BL/6J WT and ICAM-1null //ICAM-2−/− C57BL/6J mice exactly as described before [46, 48]. Weights and clinical severity were assessed twice daily and scored as: 0, healthy; 0.5, limb tail; 1, hind leg weakness; 2, hind leg paraplegia; 3, hind leg paraplegia and incontinence.

tEAE tEAE was induced as described before [40]. Eight- 12-week-old C57BL/6J WT and ICAM-1null //ICAM-2−/− C57BL/6J mice were injected i.p. with 3 × 106 MOG-specific CD4+ T-cell blasts. T-cell blasts were obtained by harvesting swollen draining LNs and spleens of C57BL/6J mice 10 days after immunization with MOGaa35–55 /CFA and cultured in the presence of MOGaa35–55 (20 μg/mL), recombinant murine IL-12 (15 ng/mL), IL-23 (5 ng/mL), and anti-IFN-γ mAB clone XMG1.2 (10 μg/mL). After 3 days of culture, T-cell blasts were harvested by Ficoll (SigmaAldrich, St. Louis, USA) gradient centrifugation and encephalitogenic CD4+ T-cell blasts were purified via negative magnetic bead selection (Dynal Invitrogen, Oslo, Norway).

Preparation of the spinal cord window The spinal cord window was carried out exactly as described before [11]. www.eji-journal.eu

1055

1056

Michael Abadier et al.

Intravital video microscopy and image analysis IVM was performed exactly as described [11, 49]. Briefly, 1 × 107 2D2 TCR-MOG CD4+ TEM cells freshly activated in vitro with MOGaa35–55 peptide were loaded with 150 nM calcein and systemically injected via a carotid artery catheter into mice afflicted with EAE (disease scores 0.5–2.0). To count the number of permanently adhering T cells, adjacent FOVs of spinal cord microvessels with a diameter between 20 and 60 μm were recorded at 10, 30, 60, and 120 min postinjection, using a 10× long-distance objective under epifluorescence illumination (Zeiss).

Eur. J. Immunol. 2015. 45: 1043–1058

References 1 Abbott, N. J., Patabendige, A. A., Dolman, D. E., Yusof, S. R. and Begley, D. J., Structure and function of the blood-brain barrier. Neurobiol. Dis. 2010. 37: 13–25. 2 Sallusto, F., Impellizzieri, D., Basso, C., Laroni, A., Uccelli, A., Lanzavecchia, A. and Engelhardt, B., T-cell trafficking in the central nervous system. Immunol. Rev. 2012. 248: 216–227. 3 Engelhardt, B. and Ransohoff, R. M., The ins and outs of T-lymphocyte trafficking to the CNS: anatomical sites and molecular mechanisms. Trends Immunol. 2005. 26: 485–495. 4 Greenwood, J., Heasman, S. J., Alvarez, J. I., Prat, A., Lyck, R. and Engelhardt, B., Review: leucocyte-endothelial cell crosstalk at the blood-brain barrier—a prerequisite for successful immune cell entry to the brain.

Immunohistology

Neuropathol. Appl. Neurobiol. 2011. 37: 24–39. 5 Steiner, O., Coisne, C., Cecchelli, R., Boscacci, R., Deutsch, U., Engelhardt,

Mice were anesthetized with isoflurane (Baxter; Arovet) and perfused with 1% formaldehyde (Grogg Chemie) in PBS through the left ventricle of the heart. Brains and spinal cords were removed, embedded in Tissue-Tek (OCT compound; Haslab), and snapfrozen in a dry ice/isopentane bath (Grogg Chemie). Cryostat sections (6 μm) were air-dried overnight, acetone-fixed, and stained for immunohistology using a three-step immunoperoxidase staining kit (Vectastain; Reactolab) exactly as described by us before [50].

B. and Lyck, R., Differential roles for endothelial ICAM-1, ICAM-2, and VCAM-1 in shear-resistant T cell arrest, polarization, and directed crawling on blood-brain barrier endothelium. J. Immunol. 2010. 185: 4846–4855. 6 Bartholomaus, I., Kawakami, N., Odoardi, F., Schlager, C., Miljkovic, D., Ellwart, J. W., Klinkert, W. E. et al., Effector T cell interactions with meningeal vascular structures in nascent autoimmune CNS lesions. Nature 2009. 462: 94–98. 7 Lyck, R. and Engelhardt, B., Going against the tide—how encephalitogenic T cells breach the blood-brain barrier. J. Vasc. Res. 2012. 49: 497–509. 8 Engelhardt, B. and Wolburg, H., Mini-review: transendothelial migration of leukocytes—through the front door or around the side of the house? Eur. J. Immunol. 2004. 34: 2955–2963.

Statistics

9 Gorina, R., Lyck, R., Vestweber, D. and Engelhardt, B., Beta2 integrinmediated crawling on endothelial ICAM-1 and ICAM-2 is a prerequisite

Statistical analysis was performed using GraphPad Prism 6.0 software (Graphpad software, La Jolla, CA, USA). For the proportion test, absolute numbers of events were compared (R software, www.r-project.org). Asterisks indicate significant differences (*p