k.) 1992 Oxford University Press
Nucleic Acids Research, Vol. 20, No. 17 4669-4670
cDNA cloning of 5' terminal regions P.Towner and W.Gartner1 Department of Biochemistry, University of Bath, Bath A2 7AY, UK and 'Institute for Strahlenchemie, 34-36 Stiftstrasse, MOhiheim-Rhur 4330, Germany Submitted June 26, 1992 Genes encoded by cDNAs are traditionally obtained by screening libraries with an appropriate probe followed by sequencing clones. More recently the method of RACE PCR has been developed to amplify gene segments which can then be cloned or sequenced directly(1, 2, 3). The 5' region of genes encoded by cDNA can be obtained using RACE and relies on terminal deoxynucleotidyl transferase to tag the upstream end of the gene and then to amplify from this site. We have found a more convenient method to achieve this by circularising the cDNA and using it in inverse PCR. The technique is successful because two gene specific primers are used on material which has undergone a single step intramolecular reaction. The technique has been used to amplify two superfamilies of genes from two invertebrate phyla and obtain complete gene sequence from PCR products directly. Typically, eye cup tissue from a range of insects was removed from freshly frozen animals, RNA prepared (4) and mRNA purified using oligo dT dynabeads following the manufacturer's instructions (Dynal, UK). A modified oligonucleotide, 5'GACTACGTTAGCATCTAGAATTCTCGAGT17 was used to prime first strand cDNA synthesis which was used directly in PCR reactions. Reaction conditions for all amplifications was 5 minutes 95°C, 2.5 U Taq Polymerase added (Northumbria Biologicals, UK) and 40 cycles of 95°C 1 minute, 46°C 1 minute, 72°C 2.5 minutes at ramp rate 2 of a Techne PHC-2 thermal cycler. Conventional PCR techniques were used to obtain a middle portion and 3' region of insect opsin genes, these were either cloned, or sequenced directly if one of the primers used in PCR was biotinylated. To obtain the 5' end of the gene the second strand of the cDNA was synthesised, blunt-ended using T4 DNA polymerase and self-ligated in 1 ml for 60 hour at 15°C. The cyclised cDNA was inverse-PCR amplified (5) using a 20-mer matching a sequence upstream of the poly A tract and an antisense 20-mer oligonucleotide to the available 5' region of the gene. This PCR product was not unique because it encompassed the ligation junction, heterogeneity arising due to variation in reverse transcription and activity of T4 polymerase prior to ligation. Consequently, only the antisense primer could be used in direct sequencing to obtain the amino terminus and 5' untranslated sequence. In some instances, heterogeneity of the product limits the amount of useful sequence information obtainable, it then becomes expedient to clone prior to sequencing. The steps involved in performing these techniques are depicted in Figure 1. The method has been used on genes with open reading frames of 1140 bp with 5' and 3' untranslated sequences of approximately 100 and 500 bp, respectively. The technique might be constrained by a requirement to amplify very large PCR products but we have experienced no difficulty in amplifying fragments of up to 1200 bp. Thoughtful choice of primer sites ensures that each
product overlaps its neighbour sufficiently to show exact sequence matches. Interestingly, we have not yet found a sequence anomaly between a cloned product and a directly sequenced product. The whole of the open reading frame of the gene can be amplified using appropriate oligonucleotides and cloned into suitable vectors for expression. An autoradiograph of a direct-sequenced opsin gene is presented in Figure 2.
ACKNOWLEDGEMENTS P.T. thanks the Royal Society for support and David Laughton and Philip Harris for utilising this technique successfully. We are grateful to the British-German Academic Research Collaboration Programme for a Travel Grant.
REFERENCES 1. Frohman,M.A. and Martin,G.R. (1989) Technique 1, 165-170. 2. Hultman,T. et al. (1989) Nucleic Acids Res. 17, 4937-4946. 3. Green,A., Roopra,A. and Vaudin,M. (1990) Nucleic Acids Res. 18, 6163-6164. 4. Chomezynski,P. and Sacchi,N. (1987) Anal. Biochem. 162, 156-159. 5. Innis,M.A. et al. (1990) In: PCR Protocols. Academic Press.
mRNA
5'
First Strand cDNA
A 3'
T17GAG..CAG 5'
Middle Portion Amplification
3' Amplification
Second Strand cDNA
T17GAG..CAG 5'
5' 3'
A17CTC..GTC 3'
T17GAG..CAG 5'
Cyclisation 5' Amplification
Figure 1. Scheme depicting the steps required to amplify the entire gene sequence of cDNAs. Open arrows refer to redundant primers, those used for amplification of opsin were 29-mers of 102 to 106 degeneracy but with unique sequence of three to five bases at their 3' ends. Closed arrows refer to sequence specific primers, open circles suggest the presence of 5' biotin. Primers were prepared using an Applied Biosystems 381A nucleic acid synthesiser with reagents from Severn Biotech, UK.
4670 Nucleic Acids Research, Vol. 20, No. 17
Figure 2. Autoradiograph of a direct-sequenced PCR product encoding 5' region. Lane order is ACGT and codes for amino acid position 60 (closed arrow) to 80 (open arrow) of Sphodromantis spp. opsin.
Nucleic Acids Research, Vol. 20, No. 17 4669-4670
cDNA cloning of 5' terminal regions P.Towner and W.Gartner1 Department of Biochemistry, University of Bath, Bath A2 7AY, UK and 'Institute for Strahlenchemie, 34-36 Stiftstrasse, MOhiheim-Rhur 4330, Germany Submitted June 26, 1992 Genes encoded by cDNAs are traditionally obtained by screening libraries with an appropriate probe followed by sequencing clones. More recently the method of RACE PCR has been developed to amplify gene segments which can then be cloned or sequenced directly(1, 2, 3). The 5' region of genes encoded by cDNA can be obtained using RACE and relies on terminal deoxynucleotidyl transferase to tag the upstream end of the gene and then to amplify from this site. We have found a more convenient method to achieve this by circularising the cDNA and using it in inverse PCR. The technique is successful because two gene specific primers are used on material which has undergone a single step intramolecular reaction. The technique has been used to amplify two superfamilies of genes from two invertebrate phyla and obtain complete gene sequence from PCR products directly. Typically, eye cup tissue from a range of insects was removed from freshly frozen animals, RNA prepared (4) and mRNA purified using oligo dT dynabeads following the manufacturer's instructions (Dynal, UK). A modified oligonucleotide, 5'GACTACGTTAGCATCTAGAATTCTCGAGT17 was used to prime first strand cDNA synthesis which was used directly in PCR reactions. Reaction conditions for all amplifications was 5 minutes 95°C, 2.5 U Taq Polymerase added (Northumbria Biologicals, UK) and 40 cycles of 95°C 1 minute, 46°C 1 minute, 72°C 2.5 minutes at ramp rate 2 of a Techne PHC-2 thermal cycler. Conventional PCR techniques were used to obtain a middle portion and 3' region of insect opsin genes, these were either cloned, or sequenced directly if one of the primers used in PCR was biotinylated. To obtain the 5' end of the gene the second strand of the cDNA was synthesised, blunt-ended using T4 DNA polymerase and self-ligated in 1 ml for 60 hour at 15°C. The cyclised cDNA was inverse-PCR amplified (5) using a 20-mer matching a sequence upstream of the poly A tract and an antisense 20-mer oligonucleotide to the available 5' region of the gene. This PCR product was not unique because it encompassed the ligation junction, heterogeneity arising due to variation in reverse transcription and activity of T4 polymerase prior to ligation. Consequently, only the antisense primer could be used in direct sequencing to obtain the amino terminus and 5' untranslated sequence. In some instances, heterogeneity of the product limits the amount of useful sequence information obtainable, it then becomes expedient to clone prior to sequencing. The steps involved in performing these techniques are depicted in Figure 1. The method has been used on genes with open reading frames of 1140 bp with 5' and 3' untranslated sequences of approximately 100 and 500 bp, respectively. The technique might be constrained by a requirement to amplify very large PCR products but we have experienced no difficulty in amplifying fragments of up to 1200 bp. Thoughtful choice of primer sites ensures that each
product overlaps its neighbour sufficiently to show exact sequence matches. Interestingly, we have not yet found a sequence anomaly between a cloned product and a directly sequenced product. The whole of the open reading frame of the gene can be amplified using appropriate oligonucleotides and cloned into suitable vectors for expression. An autoradiograph of a direct-sequenced opsin gene is presented in Figure 2.
ACKNOWLEDGEMENTS P.T. thanks the Royal Society for support and David Laughton and Philip Harris for utilising this technique successfully. We are grateful to the British-German Academic Research Collaboration Programme for a Travel Grant.
REFERENCES 1. Frohman,M.A. and Martin,G.R. (1989) Technique 1, 165-170. 2. Hultman,T. et al. (1989) Nucleic Acids Res. 17, 4937-4946. 3. Green,A., Roopra,A. and Vaudin,M. (1990) Nucleic Acids Res. 18, 6163-6164. 4. Chomezynski,P. and Sacchi,N. (1987) Anal. Biochem. 162, 156-159. 5. Innis,M.A. et al. (1990) In: PCR Protocols. Academic Press.
mRNA
5'
First Strand cDNA
A 3'
T17GAG..CAG 5'
Middle Portion Amplification
3' Amplification
Second Strand cDNA
T17GAG..CAG 5'
5' 3'
A17CTC..GTC 3'
T17GAG..CAG 5'
Cyclisation 5' Amplification
Figure 1. Scheme depicting the steps required to amplify the entire gene sequence of cDNAs. Open arrows refer to redundant primers, those used for amplification of opsin were 29-mers of 102 to 106 degeneracy but with unique sequence of three to five bases at their 3' ends. Closed arrows refer to sequence specific primers, open circles suggest the presence of 5' biotin. Primers were prepared using an Applied Biosystems 381A nucleic acid synthesiser with reagents from Severn Biotech, UK.
4670 Nucleic Acids Research, Vol. 20, No. 17
Figure 2. Autoradiograph of a direct-sequenced PCR product encoding 5' region. Lane order is ACGT and codes for amino acid position 60 (closed arrow) to 80 (open arrow) of Sphodromantis spp. opsin.
