Neuroscience Letters 567 (2014) 6–10
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Evidence for involvement of the CD40/CD40L system in post-stroke epilepsy Bikui Zhang a , Min Chen a,b , Heng Yang c , Tian Wu a,b , Cuizhu Song a,b , Ren Guo a,∗ a b c
Department of Pharmacy, The Third Xiangya Hospital, Central South University, Changsha, Hunan, China School of Pharmaceutical Sciences, Central South University, Changsha, Hunan, China Department of Neurology, The Third Xiangya Hospital, Central South University, Changsha, Hunan, China
h i g h l i g h t s • • • •
CD40/CD40L system is involved in the process of post-stroke epilepsy. T allele of CD40 −1C/T polymorphism is associated with post-stroke epilepsy. T allele carriers showed increased plasma sCD40L levels. sCD40L levels should be strictly controlled in stroke patients.
a r t i c l e
i n f o
Article history: Received 11 December 2013 Received in revised form 27 January 2014 Accepted 1 March 2014 Keywords: Ischemic stroke (IS) Post-stroke epilepsy (PSE) CD40 CD40L Genetic polymorphism
a b s t r a c t Post-stroke epilepsy (PSE) has a negative effect on stroke prognosis and quality of life. The CD40/CD40L system is reported to be involved in the progression of multiple disease states. We investigated the association between functional polymorphism of CD40 and PSE susceptibility, and we also explored the role of the CD40/CD40L system in PSE. A case-control study was performed in 410 ischemic stroke (IS) patients and in 389 PSE patients. Genotyping was performed by polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). The CD40 mRNA and protein levels were determined by real-time PCR and western blotting, respectively. The plasma sCD40L level was detected using an ELISA kit. The frequency of the T allele in PSE patients was significantly higher than in IS patients (P < 0.05). The plasma sCD40L level was significantly higher in the PSE patients than in the healthy controls and IS patients (P < 0.01, P < 0.05, respectively). The peripheral blood mononuclear cells (PBMCs) from PSE patients showed significantly higher CD40 mRNA and protein expression than the healthy controls and IS patients (P < 0.01, P < 0.05, respectively). In the PSE patients, the T-allele carriers showed increased plasma sCD40L levels and increased CD40 mRNA expression. Our study suggested that the T allele of the CD40 −1C/T polymorphism may be associated with PSE susceptibility. The CD40/CD40L system is involved in the process of PSE. © 2014 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Epilepsy is a common and complex neurological disease caused by multiple factors and is characterized by an excessive discharge of certain neurons in the nervous system. Epilepsy affects approximately 0.5–0.7% of the population worldwide [4]. According to an epidemiological survey, there are approximately 9 million epileptics in China. Ischemic stroke (IS) is one of the most frequent causes
∗ Corresponding author at: Department of Pharmacy, The Third Xiangya Hospital, Central South University, Changsha, Hunan, 410013, China. Tel.: +86 731 88618455; fax: +86 731 88618455. E-mail address: [email protected] (R. Guo). http://dx.doi.org/10.1016/j.neulet.2014.03.003 0304-3940/© 2014 Elsevier Ireland Ltd. All rights reserved.
of acquired epilepsy in the elderly population [13], and 2–14% of elderly patients with stroke will suffer from epilepsy [11]. A Canadian research study suggests that post-stroke epilepsy (PSE) has a negative effect on stoke prognosis and quality of life [5]. To effectively prevent PSE, it is necessary to find some reliable predictors that can be easily detected in patients. It was reported that stroke severity, occurrence of hemorrhagic stroke and cortical lesion size were independent predictors of acute symptomatic seizures [3,9], but these indices lack identified criteria for estimating their relationship with the incidence of PSE. Accumulating evidence indicates that oxidative stress induced by increased reactive oxygen and/or nitrogen species is involved in the pathogenesis and progression of epilepsy, and agents with antioxidant effects have produced neuroprotection against
B. Zhang et al. / Neuroscience Letters 567 (2014) 6–10
oxidative stress-induced dysfunction in neurons [8,23]. The CD40/CD40L system serves as a link between inflammation, immunity, and tumorigenesis [2]. When combined with its ligand CD40L, CD40 is activated and leads to the up-regulation of many proinflammatory and proatherogenic genes through the NF-kappa B pathway. The CD40/CD40L interaction also produces ROS, which deactivate endothelial nitric oxide and increase platelet aggregation, causing endothelial and platelet dysfunction [18]. sCD40L is now considered to be a predictor for the progression and prognosis of patients with cardiovascular diseases [6,7]. However, limited studies have focused on the relationship between PSE and the CD40/CD40L system. In this study, we explored the association between a functional single-nucleotide polymorphism (SNP) in the CD40 Kozak sequence with the susceptibility to PSE; furthermore, we detected the level of the CD40/CD40L system in stroke patients with or without PSE. The aims of this study were to clarify the role of CD40/CD40L system in PSE and to propose a more suitable index for predicting the incidence of PSE.
2. Materials and methods 2.1. Subjects The study cohort consisted of 410 IS patients, 389 PSE patients, and 160 healthy control subjects; all were enrolled at outpatient clinics in The Third Xiangya Hospital in Hunan from September 2010 to April 2013. All patients and controls are Han people and live in Changsha or nearby counties. Furthermore, all subjects experienced no seizures before the stroke event, and all subjects were matched for age and sex. There were no differences in pre-existing medical conditions between the IS and PSE patients. IS was defined by focal neurological signs or symptoms of vascular origin that persisted longer than 24 h and was confirmed by brain CT scan and/or MRI under baseline conditions and brain CT scanning with contrast medium after 48–72 h. PSE patients were defined by clinical symptoms and positive EEG performance. Subjects without family history of IS, epilepsy, coronary artery diseases, autoimmune diseases and systemic inflammatory diseases were recruited as healthy controls. Written informed consent was obtained from all subjects. The study was performed with the approval of the Ethical Committee of the Third Xiangya Hospital of Central South University. 2.2. Genotyping Genomic DNA samples were extracted and purified from the whole blood with the standard phenol/chloroform protocols. All DNA samples were genotyped for the CD40 −1C/T polymorphism using polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). PCR was performed on a personal thermal cycler (Biometra® , Germany). To genotype the CD40 −1C/T polymorphism, a 338 bp fragment was amplified from genomic DNA with the following primers: 5 -ACCATGCCTCCTCCCGTAC-3 (sense); 5 -CCACTCCCAACTCCCGTCT-3 (antisense). A 4 L aliquot of the PCR product was digested with 3U of Nco I endonuclease at 37 ◦ C overnight. The restriction digest products were analyzed using 2.0% agarose gel electrophoresis (Fig. 1). 2.3. Determination of sCD40L concentration in the plasma 5 mL venous blood sample was collected from each subject on day 2 of disease onset for determination of sCD40L level. Plasma levels of sCD40L were measured by an immunoassay
7
Fig. 1. Genotyping for the CD40 −1C/T polymorphism using agarose gel electrophoresis. −1CC homozygotes showed two fragments (245 bp and 93 bp), −1CT heterozygotes showed three fragments (338 bp, 245 bp, and 93 bp), and −1TT homozygotes showed only one fragment (338 bp).
(Quantikine CD40 ligand, R&D Systems). The intra-assay and interassay coefficients of variation were 3% and 5%, respectively. 2.4. Isolation of human peripheral blood mononuclear cells Peripheral blood mononuclear cells (PBMCs) were collected from buffy coats, after centrifugation at 2000 × g for 30 min over 5 mL Ficoll–Hypaque gradients (Sigma, USA), washed twice with ice cold PBS, and then total RNA from the PBMCs was extracted for the subsequent experiment. The PBMCs were collected at the same time after the stroke event in each subject. 2.5. Real-time PCR analysis To validate differentially expressed CD40 mRNA in isolated PBMCs from subjects, real-time PCR was performed according to the manufacturer’s instructions using an ABI 7300 real-time PCR system with the SYBR Green method. The sequences of primers were as follows: CD40: 5 -GCAGGCACAAACAAGACTGA-3 (sense) and 5 -TCGTCGG GAAATTGATCTC-3 (antisense); GAPDH (endogenous control): 5 -CTGCACCACCAACTGCTTAG-3 (sense); 5 AGGTCCACCACTGACACGTT -3 (antisense). The relative abundance of the CD40 mRNA from the PBMCs was normalized to the expression level of GAPDH. All amplification reactions were performed in triplicate. 2.6. Western blotting Protein was extracted from cultured PBMCs with RIPA lysis buffer (containing 0.1% PMSF) (Beyotime Biotech, China) following the manufacturer’s instructions. An equal amount (100 g) of the total protein was separated using SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (Beyotime Biotech, China) and then transferred onto a polyvinylidene difluoride (PVDF) (Pell, USA) membrane. The membranes were immunoblotted with antibodies against CD40 (human monoclonal antibody, Abcam, UK) or GAPDH (Abcam, UK) followed by a horseradish peroxidase-conjugated secondary antibody. The immunoblots were visualized using a Bio-Rad Calibrated Densitometer. 2.7. Statistical analysis The descriptive results of continuous variables are expressed as the mean ± SE. Statistical analysis of the data was carried out using the SSPS 11.5 software. Differences in the genotype and allele frequencies between groups were compared using the 2 test. Differences among groups were analyzed using one-way ANOVA followed by the Student–Newman–Keuls test. The statistical power of our study was assessed as described previously [12]. The significance level was chosen as P < 0.05.
8
B. Zhang et al. / Neuroscience Letters 567 (2014) 6–10
Table 1 General characteristics of the IS patients and PSE patients. Parameter
IS (n = 410)
PSE (n = 389)
P
Gender (male/female) Age (year) BMI (kg/m2 ) SBP (mmHg) DBP (mmHg) Creatinine (Cr) (mol/L) HDL-C (mmol/L) LDL-C (mmol/L) Triglyceride (TG) (mmol/L) Total cholesterol (TC) (mmol/L)
241/169 62.32 ± 8.06 22.34 ± 2.48 140 ± 12 82 ± 8 84.42 ± 13.22 1.28 ± 0.49 2.84 ± 0.52 1.92 ± 0.68 4.66 ± 0.81
219/170 64.46 ± 9.87 23.15 ± 1.77 147 ± 14 86 ± 10 85.69 ± 16.47 1.32 ± 0.66 2.79 ± 0.82 1.88 ± 1.02 4.71 ± 0.95
NS NS NS NS NS NS NS NS NS NS
3. Results 3.1. Clinical and laboratory characteristics in the IS patients and PSE patients The demographic characteristics and distribution of risk factors in both the IS patients and PSE patients are shown in Table 1. The clinical and laboratory characteristics were not significantly different between the IS patients and PSE patients. 3.2. Distribution of allele and genotype frequencies of CD40 −1C/T genotype The distribution and allele frequencies of the CD40 −1C/T variant in IS patients and PSE patients are presented in Table 2. The distribution of genotypes in both study groups complied with the Hardy–Weinberg equilibrium (P > 0.05). The results obtained from our study demonstrated that the frequency of the T allele was significantly higher in the PSE group than in the IS group (50.5% vs. 38.5%, 2 = 23.204, P = 0.0000017, OR = 1.628, 95% CI: 1.335–1.986, Table 2), and the carriers of this allele were overrepresented in the PSE group than in the IS group (70.4% vs. 58.8%, 2 = 11.838, P = 0.00058, OR = 1.671, 95% CI: 1.246–2.241, Table 2). The statistical power of the present study was 96.2%. 3.3. The association of the plasma sCD40L concentration with different groups To evaluate the effect of the CD40/CD40L system on the process of IS and PSE, 480 blood samples from IS patients, PSE patients and healthy controls were collected, and the plasma sCD40L concentration was examined by ELISA. Our data revealed that the plasma sCD40L concentration was significantly higher in the PSE group than in the other groups (Fig. 2A). When we divided the PSE patients into three subgroups according to the CD40 −1C/T polymorphism, we found that individuals carrying the TT genotype showed significantly higher sCD40L levels (Fig. 2B). No differences in the plasma sCD40L concentrations were observed between the genotypes in the IS patients and healthy controls (data not shown). 3.4. Differences in PBMCs CD40 mRNA expression between different groups To test the possibility that CD40 mRNA expression is associated with the different disease states, total RNA was extracted from the PBMCs in IS patients, PSE patients and healthy controls, and real-time PCR was performed. Our data demonstrated that CD40 mRNA expression was significantly elevated in the IS patients and PSE patients, and the PSE groups showed the highest level of CD40 mRNA expression (Fig. 3A). We also explored the association between CD40 mRNA and the CD40 −1C/T polymorphism. As shown in Fig. 3B, in PSE patients, carriers with the T allele showed
Fig. 2. The plasma sCD40L level in each group during the disease process. The plasma sCD40L concentration was detected using ELISA in each group. (A) The differences in plasma sCD40L levels in healthy controls (n = 160), IS patients (n = 160) and PSE patients (n = 160). The descriptive results are expressed as the mean ± SEM. ** P < 0.01 compared with healthy controls, and # P < 0.05 compared with IS patients. (B) The association between the sCD40L level and CD40 −1C/T genotype in PSE patients. The descriptive results are expressed as the mean ± SEM, n = 50 in each group. * P < 0.05, ** P < 0.01 compared with the CC genotype, and # P < 0.05 compared with the CT genotype.
an increased CD40 mRNA expression, and individuals with the TT genotype showed the highest expression of CD40 mRNA (Fig. 3B). 3.5. Difference in CD40 protein level among different groups Considering that the CD40 protein level also reflects the activity of the CD40/CD40L system, we examined CD40 protein expression in the PBMCs from IS patients, PSE patients and healthy controls. We found that CD40 protein levels were significantly increased in IS patients and PSE patients relative to the controls. When compared with the IS group, the PSE group showed a higher CD40 protein level (Fig. 4). 4. Discussion CD40 and CD40L belong to the tumor necrosis factor superfamily and the tumor necrosis factor family, respectively [1,17]. After stimulation with a wide range of platelet activators and cytokines, the CD40/CD40L system is activated and then induces the upregulation of many pro-inflammatory genes and pro-coagulant genes [2]. In the past several years, there have been numerous studies focusing on the involvement of CD40 in cardiovascular disease [19,20]. Many studies have also been conducted to explore the relationship between the genetic polymorphism of the CD40/CD40L system and cardiovascular diseases [15,16,22]. Nonetheless, little information is available regarding the effect of CD40 gene polymorphisms on PSE susceptibility. The data from our study have provided compelling evidence that the CD40 −1C/T polymorphism is associated with PSE susceptibility, and individuals with a T allele have shown significantly higher incidence of epilepsy after stroke.
B. Zhang et al. / Neuroscience Letters 567 (2014) 6–10
9
Table 2 Genotype distribution and allele frequency of the CD40 −1C/T polymorphism in IS and PSE patients. n IS patients PSE patients 2 P-value OR (95% CI)
410 389
Genotype (%) CC 169 (41.2) 115 (29.6)
CT
TT
166 (40.5) 155 (39.8) 15.396 0.00045
75 (18.3) 119 (30.6)
Furthermore, in our study, we observed an increased level of plasma sCD40L and increased CD40 expression in PSE patients. Increased sCD40L and CD40 levels reflect a pro-thrombotic state and an oxidative stress state; individuals with different sCD40L levels showed different therapeutic effects and prognoses [15]. Along the same line, the up-regulation of CD40 and sCD40L appears to be responsible for the increased incidence of epilepsy in stroke patients. Monitoring the plasma sCD40L concentration in stroke patients may be a reliable method for forecasting stoke prognoses and drug therapeutic effects. All patients in our study will receive a long period of follow-up. In this period, we will record the data about the frequency and severity of epilepsy in these patients and sample a small amount of blood to measure the sCD40L levels. At the end of the follow-up, these data will help us to assess the relationship between the sCD40L levels and the epileptic recurrence rate. Given that CD40 and CD40L may influence each other in the process of diseases [24], we also explored the association between CD40 and CD40L. Our results revealed that the CD40 −1C/T polymorphism influences the plasma sCD40L level in PSE patients.
Fig. 3. CD40 mRNA expression in each group and its association with the CD40 −1C/T genotype. CD40 mRNA expression in PBMCs was analyzed by real-time PCR and expressed as a ratio to the control gene. (A) CD40 mRNA expression in healthy controls (n = 75), IS patients (n = 75) and PSE patients (n = 75). The descriptive results are expressed as the mean ± SEM. ** P < 0.01 compared with healthy controls, and # P < 0.05 compared with IS patients. (B) The association between CD40 mRNA expression and CD40 −1C/T genotype in PSE patients. The descriptive results are expressed as the mean ± SEM, n = 50 in each group. ** P < 0.01 compared with the CC genotype, and # P < 0.05 compared with the CT genotype.
Allele (%) C
T
504 (61.5) 385 (49.5) 23.204 0.0000017 1.628 (1.335–1.986)
316 (38.5) 393 (50.5) 11.838 0.00058 1.671 (1.246–2.241)
Carriage T 241 (58.8) 274 (70.4)
Because this polymorphism exists in the Kozak sequence, which can influence the initiation of CD40 transcription [10], it may affect the sCD40L level through feedback regulation during the stroke and induce epilepsy. Based on these results, we can attain some enlightenment for clinical treatment. Stroke patients with the T allele may face a higher epilepsy risk, which would lead to a negative effect on the prognosis of stroke. Therefore, in stroke patients with the T allele, it is crucial to control the plasma sCD40L and CD40 at a low level. In summary, all of these data convincingly support the hypothesis that an activated CD40/CD40L system may serve as a crucial pathogenic factor in the development of PSE. Our evidence suggests an important therapeutic potential for controlling the CD40/CD40L system in stroke patients. It should be noted that there are some limitations to our study. For example, our sample size is relatively small, so more large-scale studies are needed to fully unveil the role of the CD40/CD40L system in PSE. Some other gene polymorphisms associated with atherosclerosis and epilepsy, such as ADAM 10 [14] and netrin G1 [21], may also have an effect on PSE. Further cell experiments should also be conducted to explore the underlying pathogenic mechanism of the CD40/CD40L system in PSE.
Fig. 4. The protein expression of CD40 in each group. PBMCs were harvested from subjects in healthy controls (n = 30), IS patients (n = 30) and PSE patients (n = 30). CD40 protein expression levels were assessed by western blotting. Data are presented as the mean ± SEM. ** P < 0.01 compared with healthy controls, and # P < 0.05 compared with IS patients.
10
B. Zhang et al. / Neuroscience Letters 567 (2014) 6–10
Sources of funding This project was supported by Chinese National Science Foundation (No. 81000120). Conflicts of interest statement There are no conflicts of interest. Acknowledgments This project was supported by the Chinese National Science Foundation (No. 81000120) to Ren Guo and Hunan Science foundation (No. 09JJ0651). References [1] S.X. Anand, J.F. Viles-Gonzalez, J.J. Badimon, E. Cavusoglu, J.D. Marmur, Membrane-associated CD40L and sCD40L in atherothrombotic disease, Thromb. Haemostasis 90 (2003) 377–384. [2] C. Antoniades, C. Bakogiannis, D. Tousoulis, A.S. Antonopoulos, C. Stefanadis, The CD40/CD40 ligand system: linking inflammation with atherothrombosis, J. Am. Coll. Cardiol. 54 (2009) 669–677. [3] E. Beghi, R. D’Alessandro, S. Beretta, D. Consoli, V. Crespi, L. Delaj, C. Gandolfo, G. Greco, A. La Neve, M. Manfredi, F. Mattana, R. Musolino, L. Provinciali, M. Santangelo, L.M. Specchio, G. Zaccara, Incidence and predictors of acute symptomatic seizures after stroke, Neurology 77 (2011) 1785–1793. [4] G. Birbeck, E. Chomba, M. Atadzhanov, E. Mbewe, A. Haworth, The social and economic impact of epilepsy in Zambia: a cross-sectional study, Lancet Neurol. 6 (2007) 39–44. [5] J.G. Burneo, J. Fang, G. Saposnik, Impact of seizures on morbidity and mortality after stroke: a Canadian multi-centre cohort study, Eur. J. Neurol. 17 (2010) 52–58. [6] G. Davi, A. Tuttolomondo, F. Santilli, S. Basili, E. Ferrante, R.D. Di, A. Pinto, G. Licata, CD40 ligand and MCP-1 as predictors of cardiovascular events in diabetic patients with stroke, J. Atheroscler. Thromb. 16 (2009) 707–713. [7] D. Ferro, L. Loffredo, L. Polimeni, F. Fimognari, P. Villari, P. Pignatelli, V. Fuster, F. Violi, Soluble CD40 ligand predicts ischemic stroke and myocardial infarction in patients with nonvalvular atrial fibrillation, Arterioscler., Thromb., Vasc. Biol. 27 (2007) 2763–2768. [8] J. Folbergrova, J. Otahal, R. Druga, Brain superoxide anion formation in immature rats during seizures: protection by selected compounds, Exp. Neurol. 233 (2012) 421–429. [9] G.J. Jungehulsing, P.U. Heuschmann, M. Holtkamp, S. Schwab, P.L. KolominskyRabas, Incidence and predictors of post-stroke epilepsy, Acta Neurol. Scand. (2013), http://dx.doi.org/10.1111/ane.12070.
[10] M. Kozak, Initiation of translation in prokaryotes and eukaryotes, Gene 234 (1999) 187–208. [11] D.L. Labovitz, W.A. Hauser, R.L. Sacco, Prevalence and predictors of early seizure and status epilepticus after first stroke, Neurology 57 (2001) 200–206. [12] J.M. Lalouel, A. Rohrwasser, Power and replication in case-control studies, Am. J. Hypertens. 15 (2002) 201–205. [13] X. Li, M.M. Breteler, M.C. de Bruyne, H. Meinardi, W.A. Hauser, A. Hofman, Vascular determinants of epilepsy: the Rotterdam Study, Epilepsia 38 (1997) 1216–1220. [14] Y. Li, F. Liao, X.J. Yin, L.L. Cui, G.D. Ma, X.X. Nong, H.H. Zhou, Y.F. Chen, B. Zhao, K.S. Li, An association study on ADAM10 promoter polymorphisms and atherosclerotic cerebral infarction in a Chinese population, CNS Neurosci. Ther. 19 (2013) 785–794. [15] A. Malarstig, B. Lindahl, L. Wallentin, A. Siegbahn, Soluble CD40L levels are regulated by the −3459 A > G polymorphism and predict myocardial infarction and the efficacy of antithrombotic treatment in non-ST elevation acute coronary syndrome, Arterioscler., Thromb., Vasc. Biol. 26 (2006) 1667–1673. [16] Y. Onouchi, S. Onoue, M. Tamari, K. Wakui, Y. Fukushima, M. Yashiro, Y. Nakamura, H. Yanagawa, F. Kishi, K. Ouchi, M. Terai, K. Hamamoto, F. Kudo, H. Aotsuka, Y. Sato, A. Nariai, Y. Kaburagi, M. Miura, T. Saji, T. Kawasaki, Y. Nakamura, A. Hata, CD40 ligand gene and Kawasaki disease, Eur. J. Hum. Genet. 12 (2004) 1062–1068. [17] M.L. Prasad, M. Velickovic, S.A. Weston, E.M. Benson, Mutational screening of the CD40 ligand (CD40L) gene in patients with X linked hyper-IgM syndrome (XHIM) and determination of carrier status in female relatives, J. Clin. Pathol. 58 (2005) 90–92. [18] M. Rizvi, D. Pathak, J.E. Freedman, S. Chakrabarti, CD40–CD40 ligand interactions in oxidative stress, inflammation and vascular disease, Trends Mol. Med. 14 (2008) 530–538. [19] U. Schonbeck, N. Gerdes, N. Varo, R.S. Reynolds, D.B. Horton, U. Bavendiek, L. Robbie, P. Ganz, S. Kinlay, P. Libby, Oxidized low-density lipoprotein augments and 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors limit CD40 and CD40L expression in human vascular cells, Circulation 106 (2002) 2888–2893. [20] U. Schonbeck, P. Libby, CD40 signaling and plaque instability, Circ. Res. 89 (2001) 1092–1103. [21] A. Stepanyan, R. Zakharyan, A. Boyajyan, The netrin G1 gene rs628117 polymorphism is associated with ischemic stroke, Neurosci. Lett. 549 (2013) 74–77. [22] C. Tian, W. Qin, L. Li, W. Zheng, F. Qiu, A common polymorphism in CD40 Kozak sequence (−1C/T) is associated with acute coronary syndrome, Biomed. Pharmacother. 64 (2010) 191–194. [23] C.Y. Tsai, J.Y. Chan, K.S. Hsu, A.Y. Chang, S.H. Chan, Brain-derived neurotrophic factor ameliorates brain stem cardiovascular dysregulation during experimental temporal lobe status epilepticus, PLoS One 7 (2012) e33527. [24] B. Zhang, T. Wu, C. Song, M. Chen, H. Li, R. Guo, Association of CD40 −1C/T polymorphism with cerebral infarction susceptibility and its effect on sCD40L in Chinese population, Int. Immunopharmacol. 16 (2013) 461–465.
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Evidence for involvement of the CD40/CD40L system in post-stroke epilepsy Bikui Zhang a , Min Chen a,b , Heng Yang c , Tian Wu a,b , Cuizhu Song a,b , Ren Guo a,∗ a b c
Department of Pharmacy, The Third Xiangya Hospital, Central South University, Changsha, Hunan, China School of Pharmaceutical Sciences, Central South University, Changsha, Hunan, China Department of Neurology, The Third Xiangya Hospital, Central South University, Changsha, Hunan, China
h i g h l i g h t s • • • •
CD40/CD40L system is involved in the process of post-stroke epilepsy. T allele of CD40 −1C/T polymorphism is associated with post-stroke epilepsy. T allele carriers showed increased plasma sCD40L levels. sCD40L levels should be strictly controlled in stroke patients.
a r t i c l e
i n f o
Article history: Received 11 December 2013 Received in revised form 27 January 2014 Accepted 1 March 2014 Keywords: Ischemic stroke (IS) Post-stroke epilepsy (PSE) CD40 CD40L Genetic polymorphism
a b s t r a c t Post-stroke epilepsy (PSE) has a negative effect on stroke prognosis and quality of life. The CD40/CD40L system is reported to be involved in the progression of multiple disease states. We investigated the association between functional polymorphism of CD40 and PSE susceptibility, and we also explored the role of the CD40/CD40L system in PSE. A case-control study was performed in 410 ischemic stroke (IS) patients and in 389 PSE patients. Genotyping was performed by polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). The CD40 mRNA and protein levels were determined by real-time PCR and western blotting, respectively. The plasma sCD40L level was detected using an ELISA kit. The frequency of the T allele in PSE patients was significantly higher than in IS patients (P < 0.05). The plasma sCD40L level was significantly higher in the PSE patients than in the healthy controls and IS patients (P < 0.01, P < 0.05, respectively). The peripheral blood mononuclear cells (PBMCs) from PSE patients showed significantly higher CD40 mRNA and protein expression than the healthy controls and IS patients (P < 0.01, P < 0.05, respectively). In the PSE patients, the T-allele carriers showed increased plasma sCD40L levels and increased CD40 mRNA expression. Our study suggested that the T allele of the CD40 −1C/T polymorphism may be associated with PSE susceptibility. The CD40/CD40L system is involved in the process of PSE. © 2014 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Epilepsy is a common and complex neurological disease caused by multiple factors and is characterized by an excessive discharge of certain neurons in the nervous system. Epilepsy affects approximately 0.5–0.7% of the population worldwide [4]. According to an epidemiological survey, there are approximately 9 million epileptics in China. Ischemic stroke (IS) is one of the most frequent causes
∗ Corresponding author at: Department of Pharmacy, The Third Xiangya Hospital, Central South University, Changsha, Hunan, 410013, China. Tel.: +86 731 88618455; fax: +86 731 88618455. E-mail address: [email protected] (R. Guo). http://dx.doi.org/10.1016/j.neulet.2014.03.003 0304-3940/© 2014 Elsevier Ireland Ltd. All rights reserved.
of acquired epilepsy in the elderly population [13], and 2–14% of elderly patients with stroke will suffer from epilepsy [11]. A Canadian research study suggests that post-stroke epilepsy (PSE) has a negative effect on stoke prognosis and quality of life [5]. To effectively prevent PSE, it is necessary to find some reliable predictors that can be easily detected in patients. It was reported that stroke severity, occurrence of hemorrhagic stroke and cortical lesion size were independent predictors of acute symptomatic seizures [3,9], but these indices lack identified criteria for estimating their relationship with the incidence of PSE. Accumulating evidence indicates that oxidative stress induced by increased reactive oxygen and/or nitrogen species is involved in the pathogenesis and progression of epilepsy, and agents with antioxidant effects have produced neuroprotection against
B. Zhang et al. / Neuroscience Letters 567 (2014) 6–10
oxidative stress-induced dysfunction in neurons [8,23]. The CD40/CD40L system serves as a link between inflammation, immunity, and tumorigenesis [2]. When combined with its ligand CD40L, CD40 is activated and leads to the up-regulation of many proinflammatory and proatherogenic genes through the NF-kappa B pathway. The CD40/CD40L interaction also produces ROS, which deactivate endothelial nitric oxide and increase platelet aggregation, causing endothelial and platelet dysfunction [18]. sCD40L is now considered to be a predictor for the progression and prognosis of patients with cardiovascular diseases [6,7]. However, limited studies have focused on the relationship between PSE and the CD40/CD40L system. In this study, we explored the association between a functional single-nucleotide polymorphism (SNP) in the CD40 Kozak sequence with the susceptibility to PSE; furthermore, we detected the level of the CD40/CD40L system in stroke patients with or without PSE. The aims of this study were to clarify the role of CD40/CD40L system in PSE and to propose a more suitable index for predicting the incidence of PSE.
2. Materials and methods 2.1. Subjects The study cohort consisted of 410 IS patients, 389 PSE patients, and 160 healthy control subjects; all were enrolled at outpatient clinics in The Third Xiangya Hospital in Hunan from September 2010 to April 2013. All patients and controls are Han people and live in Changsha or nearby counties. Furthermore, all subjects experienced no seizures before the stroke event, and all subjects were matched for age and sex. There were no differences in pre-existing medical conditions between the IS and PSE patients. IS was defined by focal neurological signs or symptoms of vascular origin that persisted longer than 24 h and was confirmed by brain CT scan and/or MRI under baseline conditions and brain CT scanning with contrast medium after 48–72 h. PSE patients were defined by clinical symptoms and positive EEG performance. Subjects without family history of IS, epilepsy, coronary artery diseases, autoimmune diseases and systemic inflammatory diseases were recruited as healthy controls. Written informed consent was obtained from all subjects. The study was performed with the approval of the Ethical Committee of the Third Xiangya Hospital of Central South University. 2.2. Genotyping Genomic DNA samples were extracted and purified from the whole blood with the standard phenol/chloroform protocols. All DNA samples were genotyped for the CD40 −1C/T polymorphism using polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). PCR was performed on a personal thermal cycler (Biometra® , Germany). To genotype the CD40 −1C/T polymorphism, a 338 bp fragment was amplified from genomic DNA with the following primers: 5 -ACCATGCCTCCTCCCGTAC-3 (sense); 5 -CCACTCCCAACTCCCGTCT-3 (antisense). A 4 L aliquot of the PCR product was digested with 3U of Nco I endonuclease at 37 ◦ C overnight. The restriction digest products were analyzed using 2.0% agarose gel electrophoresis (Fig. 1). 2.3. Determination of sCD40L concentration in the plasma 5 mL venous blood sample was collected from each subject on day 2 of disease onset for determination of sCD40L level. Plasma levels of sCD40L were measured by an immunoassay
7
Fig. 1. Genotyping for the CD40 −1C/T polymorphism using agarose gel electrophoresis. −1CC homozygotes showed two fragments (245 bp and 93 bp), −1CT heterozygotes showed three fragments (338 bp, 245 bp, and 93 bp), and −1TT homozygotes showed only one fragment (338 bp).
(Quantikine CD40 ligand, R&D Systems). The intra-assay and interassay coefficients of variation were 3% and 5%, respectively. 2.4. Isolation of human peripheral blood mononuclear cells Peripheral blood mononuclear cells (PBMCs) were collected from buffy coats, after centrifugation at 2000 × g for 30 min over 5 mL Ficoll–Hypaque gradients (Sigma, USA), washed twice with ice cold PBS, and then total RNA from the PBMCs was extracted for the subsequent experiment. The PBMCs were collected at the same time after the stroke event in each subject. 2.5. Real-time PCR analysis To validate differentially expressed CD40 mRNA in isolated PBMCs from subjects, real-time PCR was performed according to the manufacturer’s instructions using an ABI 7300 real-time PCR system with the SYBR Green method. The sequences of primers were as follows: CD40: 5 -GCAGGCACAAACAAGACTGA-3 (sense) and 5 -TCGTCGG GAAATTGATCTC-3 (antisense); GAPDH (endogenous control): 5 -CTGCACCACCAACTGCTTAG-3 (sense); 5 AGGTCCACCACTGACACGTT -3 (antisense). The relative abundance of the CD40 mRNA from the PBMCs was normalized to the expression level of GAPDH. All amplification reactions were performed in triplicate. 2.6. Western blotting Protein was extracted from cultured PBMCs with RIPA lysis buffer (containing 0.1% PMSF) (Beyotime Biotech, China) following the manufacturer’s instructions. An equal amount (100 g) of the total protein was separated using SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (Beyotime Biotech, China) and then transferred onto a polyvinylidene difluoride (PVDF) (Pell, USA) membrane. The membranes were immunoblotted with antibodies against CD40 (human monoclonal antibody, Abcam, UK) or GAPDH (Abcam, UK) followed by a horseradish peroxidase-conjugated secondary antibody. The immunoblots were visualized using a Bio-Rad Calibrated Densitometer. 2.7. Statistical analysis The descriptive results of continuous variables are expressed as the mean ± SE. Statistical analysis of the data was carried out using the SSPS 11.5 software. Differences in the genotype and allele frequencies between groups were compared using the 2 test. Differences among groups were analyzed using one-way ANOVA followed by the Student–Newman–Keuls test. The statistical power of our study was assessed as described previously [12]. The significance level was chosen as P < 0.05.
8
B. Zhang et al. / Neuroscience Letters 567 (2014) 6–10
Table 1 General characteristics of the IS patients and PSE patients. Parameter
IS (n = 410)
PSE (n = 389)
P
Gender (male/female) Age (year) BMI (kg/m2 ) SBP (mmHg) DBP (mmHg) Creatinine (Cr) (mol/L) HDL-C (mmol/L) LDL-C (mmol/L) Triglyceride (TG) (mmol/L) Total cholesterol (TC) (mmol/L)
241/169 62.32 ± 8.06 22.34 ± 2.48 140 ± 12 82 ± 8 84.42 ± 13.22 1.28 ± 0.49 2.84 ± 0.52 1.92 ± 0.68 4.66 ± 0.81
219/170 64.46 ± 9.87 23.15 ± 1.77 147 ± 14 86 ± 10 85.69 ± 16.47 1.32 ± 0.66 2.79 ± 0.82 1.88 ± 1.02 4.71 ± 0.95
NS NS NS NS NS NS NS NS NS NS
3. Results 3.1. Clinical and laboratory characteristics in the IS patients and PSE patients The demographic characteristics and distribution of risk factors in both the IS patients and PSE patients are shown in Table 1. The clinical and laboratory characteristics were not significantly different between the IS patients and PSE patients. 3.2. Distribution of allele and genotype frequencies of CD40 −1C/T genotype The distribution and allele frequencies of the CD40 −1C/T variant in IS patients and PSE patients are presented in Table 2. The distribution of genotypes in both study groups complied with the Hardy–Weinberg equilibrium (P > 0.05). The results obtained from our study demonstrated that the frequency of the T allele was significantly higher in the PSE group than in the IS group (50.5% vs. 38.5%, 2 = 23.204, P = 0.0000017, OR = 1.628, 95% CI: 1.335–1.986, Table 2), and the carriers of this allele were overrepresented in the PSE group than in the IS group (70.4% vs. 58.8%, 2 = 11.838, P = 0.00058, OR = 1.671, 95% CI: 1.246–2.241, Table 2). The statistical power of the present study was 96.2%. 3.3. The association of the plasma sCD40L concentration with different groups To evaluate the effect of the CD40/CD40L system on the process of IS and PSE, 480 blood samples from IS patients, PSE patients and healthy controls were collected, and the plasma sCD40L concentration was examined by ELISA. Our data revealed that the plasma sCD40L concentration was significantly higher in the PSE group than in the other groups (Fig. 2A). When we divided the PSE patients into three subgroups according to the CD40 −1C/T polymorphism, we found that individuals carrying the TT genotype showed significantly higher sCD40L levels (Fig. 2B). No differences in the plasma sCD40L concentrations were observed between the genotypes in the IS patients and healthy controls (data not shown). 3.4. Differences in PBMCs CD40 mRNA expression between different groups To test the possibility that CD40 mRNA expression is associated with the different disease states, total RNA was extracted from the PBMCs in IS patients, PSE patients and healthy controls, and real-time PCR was performed. Our data demonstrated that CD40 mRNA expression was significantly elevated in the IS patients and PSE patients, and the PSE groups showed the highest level of CD40 mRNA expression (Fig. 3A). We also explored the association between CD40 mRNA and the CD40 −1C/T polymorphism. As shown in Fig. 3B, in PSE patients, carriers with the T allele showed
Fig. 2. The plasma sCD40L level in each group during the disease process. The plasma sCD40L concentration was detected using ELISA in each group. (A) The differences in plasma sCD40L levels in healthy controls (n = 160), IS patients (n = 160) and PSE patients (n = 160). The descriptive results are expressed as the mean ± SEM. ** P < 0.01 compared with healthy controls, and # P < 0.05 compared with IS patients. (B) The association between the sCD40L level and CD40 −1C/T genotype in PSE patients. The descriptive results are expressed as the mean ± SEM, n = 50 in each group. * P < 0.05, ** P < 0.01 compared with the CC genotype, and # P < 0.05 compared with the CT genotype.
an increased CD40 mRNA expression, and individuals with the TT genotype showed the highest expression of CD40 mRNA (Fig. 3B). 3.5. Difference in CD40 protein level among different groups Considering that the CD40 protein level also reflects the activity of the CD40/CD40L system, we examined CD40 protein expression in the PBMCs from IS patients, PSE patients and healthy controls. We found that CD40 protein levels were significantly increased in IS patients and PSE patients relative to the controls. When compared with the IS group, the PSE group showed a higher CD40 protein level (Fig. 4). 4. Discussion CD40 and CD40L belong to the tumor necrosis factor superfamily and the tumor necrosis factor family, respectively [1,17]. After stimulation with a wide range of platelet activators and cytokines, the CD40/CD40L system is activated and then induces the upregulation of many pro-inflammatory genes and pro-coagulant genes [2]. In the past several years, there have been numerous studies focusing on the involvement of CD40 in cardiovascular disease [19,20]. Many studies have also been conducted to explore the relationship between the genetic polymorphism of the CD40/CD40L system and cardiovascular diseases [15,16,22]. Nonetheless, little information is available regarding the effect of CD40 gene polymorphisms on PSE susceptibility. The data from our study have provided compelling evidence that the CD40 −1C/T polymorphism is associated with PSE susceptibility, and individuals with a T allele have shown significantly higher incidence of epilepsy after stroke.
B. Zhang et al. / Neuroscience Letters 567 (2014) 6–10
9
Table 2 Genotype distribution and allele frequency of the CD40 −1C/T polymorphism in IS and PSE patients. n IS patients PSE patients 2 P-value OR (95% CI)
410 389
Genotype (%) CC 169 (41.2) 115 (29.6)
CT
TT
166 (40.5) 155 (39.8) 15.396 0.00045
75 (18.3) 119 (30.6)
Furthermore, in our study, we observed an increased level of plasma sCD40L and increased CD40 expression in PSE patients. Increased sCD40L and CD40 levels reflect a pro-thrombotic state and an oxidative stress state; individuals with different sCD40L levels showed different therapeutic effects and prognoses [15]. Along the same line, the up-regulation of CD40 and sCD40L appears to be responsible for the increased incidence of epilepsy in stroke patients. Monitoring the plasma sCD40L concentration in stroke patients may be a reliable method for forecasting stoke prognoses and drug therapeutic effects. All patients in our study will receive a long period of follow-up. In this period, we will record the data about the frequency and severity of epilepsy in these patients and sample a small amount of blood to measure the sCD40L levels. At the end of the follow-up, these data will help us to assess the relationship between the sCD40L levels and the epileptic recurrence rate. Given that CD40 and CD40L may influence each other in the process of diseases [24], we also explored the association between CD40 and CD40L. Our results revealed that the CD40 −1C/T polymorphism influences the plasma sCD40L level in PSE patients.
Fig. 3. CD40 mRNA expression in each group and its association with the CD40 −1C/T genotype. CD40 mRNA expression in PBMCs was analyzed by real-time PCR and expressed as a ratio to the control gene. (A) CD40 mRNA expression in healthy controls (n = 75), IS patients (n = 75) and PSE patients (n = 75). The descriptive results are expressed as the mean ± SEM. ** P < 0.01 compared with healthy controls, and # P < 0.05 compared with IS patients. (B) The association between CD40 mRNA expression and CD40 −1C/T genotype in PSE patients. The descriptive results are expressed as the mean ± SEM, n = 50 in each group. ** P < 0.01 compared with the CC genotype, and # P < 0.05 compared with the CT genotype.
Allele (%) C
T
504 (61.5) 385 (49.5) 23.204 0.0000017 1.628 (1.335–1.986)
316 (38.5) 393 (50.5) 11.838 0.00058 1.671 (1.246–2.241)
Carriage T 241 (58.8) 274 (70.4)
Because this polymorphism exists in the Kozak sequence, which can influence the initiation of CD40 transcription [10], it may affect the sCD40L level through feedback regulation during the stroke and induce epilepsy. Based on these results, we can attain some enlightenment for clinical treatment. Stroke patients with the T allele may face a higher epilepsy risk, which would lead to a negative effect on the prognosis of stroke. Therefore, in stroke patients with the T allele, it is crucial to control the plasma sCD40L and CD40 at a low level. In summary, all of these data convincingly support the hypothesis that an activated CD40/CD40L system may serve as a crucial pathogenic factor in the development of PSE. Our evidence suggests an important therapeutic potential for controlling the CD40/CD40L system in stroke patients. It should be noted that there are some limitations to our study. For example, our sample size is relatively small, so more large-scale studies are needed to fully unveil the role of the CD40/CD40L system in PSE. Some other gene polymorphisms associated with atherosclerosis and epilepsy, such as ADAM 10 [14] and netrin G1 [21], may also have an effect on PSE. Further cell experiments should also be conducted to explore the underlying pathogenic mechanism of the CD40/CD40L system in PSE.
Fig. 4. The protein expression of CD40 in each group. PBMCs were harvested from subjects in healthy controls (n = 30), IS patients (n = 30) and PSE patients (n = 30). CD40 protein expression levels were assessed by western blotting. Data are presented as the mean ± SEM. ** P < 0.01 compared with healthy controls, and # P < 0.05 compared with IS patients.
10
B. Zhang et al. / Neuroscience Letters 567 (2014) 6–10
Sources of funding This project was supported by Chinese National Science Foundation (No. 81000120). Conflicts of interest statement There are no conflicts of interest. Acknowledgments This project was supported by the Chinese National Science Foundation (No. 81000120) to Ren Guo and Hunan Science foundation (No. 09JJ0651). References [1] S.X. Anand, J.F. Viles-Gonzalez, J.J. Badimon, E. Cavusoglu, J.D. Marmur, Membrane-associated CD40L and sCD40L in atherothrombotic disease, Thromb. Haemostasis 90 (2003) 377–384. [2] C. Antoniades, C. Bakogiannis, D. Tousoulis, A.S. Antonopoulos, C. Stefanadis, The CD40/CD40 ligand system: linking inflammation with atherothrombosis, J. Am. Coll. Cardiol. 54 (2009) 669–677. [3] E. Beghi, R. D’Alessandro, S. Beretta, D. Consoli, V. Crespi, L. Delaj, C. Gandolfo, G. Greco, A. La Neve, M. Manfredi, F. Mattana, R. Musolino, L. Provinciali, M. Santangelo, L.M. Specchio, G. Zaccara, Incidence and predictors of acute symptomatic seizures after stroke, Neurology 77 (2011) 1785–1793. [4] G. Birbeck, E. Chomba, M. Atadzhanov, E. Mbewe, A. Haworth, The social and economic impact of epilepsy in Zambia: a cross-sectional study, Lancet Neurol. 6 (2007) 39–44. [5] J.G. Burneo, J. Fang, G. Saposnik, Impact of seizures on morbidity and mortality after stroke: a Canadian multi-centre cohort study, Eur. J. Neurol. 17 (2010) 52–58. [6] G. Davi, A. Tuttolomondo, F. Santilli, S. Basili, E. Ferrante, R.D. Di, A. Pinto, G. Licata, CD40 ligand and MCP-1 as predictors of cardiovascular events in diabetic patients with stroke, J. Atheroscler. Thromb. 16 (2009) 707–713. [7] D. Ferro, L. Loffredo, L. Polimeni, F. Fimognari, P. Villari, P. Pignatelli, V. Fuster, F. Violi, Soluble CD40 ligand predicts ischemic stroke and myocardial infarction in patients with nonvalvular atrial fibrillation, Arterioscler., Thromb., Vasc. Biol. 27 (2007) 2763–2768. [8] J. Folbergrova, J. Otahal, R. Druga, Brain superoxide anion formation in immature rats during seizures: protection by selected compounds, Exp. Neurol. 233 (2012) 421–429. [9] G.J. Jungehulsing, P.U. Heuschmann, M. Holtkamp, S. Schwab, P.L. KolominskyRabas, Incidence and predictors of post-stroke epilepsy, Acta Neurol. Scand. (2013), http://dx.doi.org/10.1111/ane.12070.
[10] M. Kozak, Initiation of translation in prokaryotes and eukaryotes, Gene 234 (1999) 187–208. [11] D.L. Labovitz, W.A. Hauser, R.L. Sacco, Prevalence and predictors of early seizure and status epilepticus after first stroke, Neurology 57 (2001) 200–206. [12] J.M. Lalouel, A. Rohrwasser, Power and replication in case-control studies, Am. J. Hypertens. 15 (2002) 201–205. [13] X. Li, M.M. Breteler, M.C. de Bruyne, H. Meinardi, W.A. Hauser, A. Hofman, Vascular determinants of epilepsy: the Rotterdam Study, Epilepsia 38 (1997) 1216–1220. [14] Y. Li, F. Liao, X.J. Yin, L.L. Cui, G.D. Ma, X.X. Nong, H.H. Zhou, Y.F. Chen, B. Zhao, K.S. Li, An association study on ADAM10 promoter polymorphisms and atherosclerotic cerebral infarction in a Chinese population, CNS Neurosci. Ther. 19 (2013) 785–794. [15] A. Malarstig, B. Lindahl, L. Wallentin, A. Siegbahn, Soluble CD40L levels are regulated by the −3459 A > G polymorphism and predict myocardial infarction and the efficacy of antithrombotic treatment in non-ST elevation acute coronary syndrome, Arterioscler., Thromb., Vasc. Biol. 26 (2006) 1667–1673. [16] Y. Onouchi, S. Onoue, M. Tamari, K. Wakui, Y. Fukushima, M. Yashiro, Y. Nakamura, H. Yanagawa, F. Kishi, K. Ouchi, M. Terai, K. Hamamoto, F. Kudo, H. Aotsuka, Y. Sato, A. Nariai, Y. Kaburagi, M. Miura, T. Saji, T. Kawasaki, Y. Nakamura, A. Hata, CD40 ligand gene and Kawasaki disease, Eur. J. Hum. Genet. 12 (2004) 1062–1068. [17] M.L. Prasad, M. Velickovic, S.A. Weston, E.M. Benson, Mutational screening of the CD40 ligand (CD40L) gene in patients with X linked hyper-IgM syndrome (XHIM) and determination of carrier status in female relatives, J. Clin. Pathol. 58 (2005) 90–92. [18] M. Rizvi, D. Pathak, J.E. Freedman, S. Chakrabarti, CD40–CD40 ligand interactions in oxidative stress, inflammation and vascular disease, Trends Mol. Med. 14 (2008) 530–538. [19] U. Schonbeck, N. Gerdes, N. Varo, R.S. Reynolds, D.B. Horton, U. Bavendiek, L. Robbie, P. Ganz, S. Kinlay, P. Libby, Oxidized low-density lipoprotein augments and 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors limit CD40 and CD40L expression in human vascular cells, Circulation 106 (2002) 2888–2893. [20] U. Schonbeck, P. Libby, CD40 signaling and plaque instability, Circ. Res. 89 (2001) 1092–1103. [21] A. Stepanyan, R. Zakharyan, A. Boyajyan, The netrin G1 gene rs628117 polymorphism is associated with ischemic stroke, Neurosci. Lett. 549 (2013) 74–77. [22] C. Tian, W. Qin, L. Li, W. Zheng, F. Qiu, A common polymorphism in CD40 Kozak sequence (−1C/T) is associated with acute coronary syndrome, Biomed. Pharmacother. 64 (2010) 191–194. [23] C.Y. Tsai, J.Y. Chan, K.S. Hsu, A.Y. Chang, S.H. Chan, Brain-derived neurotrophic factor ameliorates brain stem cardiovascular dysregulation during experimental temporal lobe status epilepticus, PLoS One 7 (2012) e33527. [24] B. Zhang, T. Wu, C. Song, M. Chen, H. Li, R. Guo, Association of CD40 −1C/T polymorphism with cerebral infarction susceptibility and its effect on sCD40L in Chinese population, Int. Immunopharmacol. 16 (2013) 461–465.
