Catalytically relevant electrostatic interactions of cytochrome P450c17 (CYP17A1) and cytochrome b5.

Enzymology: Catalytically Relevant Electrostatic Interactions of Cytochrome P450c17 (CYP17A1) and Cytochrome b5 Hwei-Ming Peng, Jiayan Liu, Sarah E. Forsberg, Hong T. Tran, Sean M. Anderson and Richard J. Auchus J. Biol. Chem. published online October 14, 2014

Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts This article cites 0 references, 0 of which can be accessed free at http://www.jbc.org/content/early/2014/10/13/jbc.M114.608919.full.html#ref-list-1

Downloaded from http://www.jbc.org/ by guest on October 20, 2014

Access the most updated version of this article at doi: 10.1074/jbc.M114.608919

JBC Papers in Press. Published on October 14, 2014 as Manuscript M114.608919 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M114.608919 CYP17A1-cytochrome b5 interaction surface

Catalytically Relevant Electrostatic Interactions of Cytochrome P450c17 (CYP17A1) and Cytochrome b5* Hwei-Ming Peng†, Jiayan Liu†, Sarah E. Forsberg†, Hong T. Tran¶, Sean M. Anderson†, and Richard J. Auchus†‡1 From the †Division of Metabolism, Endocrinology, and Diabetes, Department of Internal Medicine, ¶Life Sciences Institute, and the ‡Department of Pharmacology, University of Michigan, Ann Arbor, MI 48109, United States *Running Title: CYP17A1-cytochrome b5 interaction surface 1

To whom correspondence should be addressed: Richard J. Auchus, Division of Metabolism, Endocrinology, and Diabetes, Department of Internal Medicine, University of Michigan, Ann Arbor, MI 48109, Tel: (734)-764-7764. Fax: (734)-936-6684. E-mail: [email protected]

Background: Cytochrome b5 (b5) stimulates the 17,20-lyase activity of cytochrome P450c17 (CYP17A1). Results: A carboxylate group in b5 residues E48/E49 is required for 17,20-lyase activity, and cross-linked peptides Lys88(CYP17A1WT)61 347 Glu (b5) and Lys (CYP17A1R347K)-Glu42(b5) involve adjacent residues. Conclusion: These data afford a molecular model of a CYP17A1-b5 complex. Significance: The CYP17A1-b5 interaction site might be a drug target to inhibit androgen synthesis.

CYP17A1-b5 complexes identified two crossCYP17A1-WT: linked peptide pairs: 84EVLIKK89 – b 5: 53EQAGGDATENFEDVGHSTDAR73 and CYP17A1-R347K: 341TPTISDKNR349 – b5: 40FLEEHPGGEEVLR52. Using these two sites of interaction and E48/E49 in b5 as constraints, protein-docking calculations based on the crystal structures of the two proteins yielded a structural model of the CYP17A1-b5 complex. The appositional surfaces include K88, R347, and R358/R449 of CYP17A1, which interact with E61, E42, and E48/E49 of b5 respectively. Our data reveal the structural basis of the electrostatic interactions between these two proteins, which is critical for 17,20-lyase activity and androgen biosynthesis.

ABSTRACT Two acidic residues, E48 and E49, of cytochrome b5 (b5) are essential for stimulating the 17,20-lyase activity of cytochrome P450c17 (CYP17A1). Substitution of Ala, Gly, Cys, or Gln for these two glutamic acids residues abrogated all capacity to stimulate 17,20-lyase activity. Mutations E49D and E48D/E49D retained 23% and 38% of wild-type activity, respectively. Using the zero-length cross-linker ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), we obtained cross-linked heterodimers of b5 and CYP17A1, wild-type or mutations R347K and R358K. In sharp contrast, the b5 double mutation E48G/E49G did not form cross-linked complexes with wild-type CYP17A1. Mass spectrometric analysis of the

The multifunctional enzyme cytochrome P450c17 (steroid 17-hydroxylase/17,20-lyase, CYP17A12) regulates a key branch point in steroidogenesis. Its 17-hydroxylase activity is critical in cortisol synthesis, whereas its 17,20lyase activity generates sex steroid precursors (1). Abnormal CYP17A1 function has been associated with several diseases, including polycystic ovary syndrome, Cushing’s syndrome, and prostate cancer. Traditionally, disorders of excessive androgen production have been treated with gonadotropin suppression, to prevent testicular testosterone synthesis, or more recently with 1

Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.


Keywords: Cytochrome P450; allosteric regulation; protein cross-linking; mass spectrometry; androgen; steroidogenesis; cytochrome b5; CYP17A1

CYP17A1-cytochrome b5 interaction surface

abiraterone acetate, a potent CYP17A1 inhibitor (2). Abiraterone treatment, however, has significant potential endocrine side effects and toxicities, including hyperkalemia and hypertension, due to the accumulation of precursor steroids upstream of the 17-hydroxylase reaction (3). Consequently, an unmet clinical need is a selective inhibitor of the 17,20-lyase reaction, which will lower testosterone production without requiring concomitant glucocorticoid therapy or disturbing drug metabolism. Whereas the 17-hydroxylase activity of CYP17A1 is relatively insensitive to physiologic changes or assay conditions, the regulation of 17,20-lyase activity is complex. High abundance of the flavoprotein P450 oxidoreductase (POR), the presence of the 17-kDa heme protein cytochrome b5 (b5), and serine phosphorylation all augment 17,20-lyase activity with little influence on 17-hydroxylase activity (4). In particular, a molar equivalent of b5 increases the rate of the 17,20-lyase reaction 10-fold, via an allosteric mechanism that does not require electron transfer (5). A specific allosteric binding site on b5, which includes the acidic residues E48, E49, and possibly R52, appears to mediate this stimulation of 17,20-lyase activity (6-8). Non-specific interactions of the hydrophobic membranespanning regions of b5 and CYP17A1 are also required to optimize 17,20-lyase activity (9).

EXPERIMENTAL PROCEDURES Materials ̶ PMSF, 5-aminolevulinic acid, Nonidet P-40, DTT, ampicillin, isopropyl-β-Dthiogalactopyranoside (IPTG), 1,2-diacyl-snglycero-3-phosphoethanolamine (PE), 1,2-diacylsn-glycero-3-phospho-L-serine (PS), and His Select resin were obtained from Sigma (St Louis, MO). Ethyl-3-(3dimethylaminopropyl)carbodiimide (EDC) was obtained from Pierce (Rockford, IL), and Sartorius™ Vivapure-S spin columns and plasmid pGro7 were purchased from Thermo Fisher Scientific (Waltham, MA). PVDF membrane was obtained from Millipore (Billerica, MA), Clarity Western ECL reagent was obtained from Bio-Rad (Richmond, CA), and Blue Devil autoradiography film was acquired from Genesee Scientific (San Diego, CA). The mouse anti-His tag antibody was obtained from GenScript (Piscataway, NJ) and used at 1:1500 dilution; secondary antibody goat anti-mouse IgG-HRP conjugate (Thermo Fisher Scientific) was used at 1:8000 dilution. Complete mini-protease inhibitor was obtained from Roche Diagnostics (Indianapolis, IN). Bactotryptone and yeast extract were purchased from Difco (Detroit, MI). Molecular biology reagents, including restriction enzymes and ligases, were obtained from New England BioLabs (Beverly, MA). Platinum Pfx DNA polymerase was obtained from Life Technologies (Grand Island, NY). 17-hydroxypregnenolone was obtained from Steraloids (Pawling, NY), and

On the other hand, the basic residues K88, K89, R347, R358 and R449 of human CYP17A1 are critical for the enzyme's b5dependent acyl-carbon cleavage activities (8,10,11). Studies of CYP17A1 mutations from patients with isolated 17,20-lyase deficiency (10,12) demonstrate that alterations in the interaction of CYP17A1 with its redox-partner proteins POR and b5 form the biochemical basis for this selective enzyme defect. POR mutation G539R also causes a form of isolated 17,20-lyase deficiency (13), as do missense and nonsense mutations in the CYB5A gene encoding b5 (14,15). These observations emphasize that specific interactions of CYP17A1 with POR and b5 are critical for maximal 17,20-lyase activity and thus androgen production. 2


Previous studies have generated a model in which b5 interacts with P450 or P450•POR complexes via at least two surfaces, which incorporate the acidic residues E48-E49 for CYP17A1, and D58-D65 for CYP3A4, CYP2E1 and CYP2C19 (7,16). For multiple conformations of CYP3A4, the contribution of b5 resides E48E49 is minor and varies with phospholipid. Therefore, it might be possible to identify compounds, which block the electrostatic interactions of b5 with CYP17A1 and thus eliminate androgen production without disturbing 17-hydroxylase activity or drug metabolism. Here, we describe the use of site-directed mutagenesis and cross-linking coupled with mass spectrometry to delineate protein-protein interactions of CYP17A1, POR and b5.


[7-3H]-pregnenolone was obtained from PerkinElmer NEN (Waltham, MA). The [7-3H]17-hydroxypregnenolone was prepared by enzymatic conversion from [7-3H]-pregnenolone using recombinant CYP17A1 and POR and purified as described (7). Plasmids ̶ The expression plasmids were generous gifts obtained from the following investigators: modified human CYP17A1-G3H6 in pCW and N-27-human POR-G3H6 in pET22 from Professor Walter L. Miller (University of California, San Francisco, CA); human b5 in pLW01-b5H4 from Professor Lucy Waskell (University of Michigan). Site-directed mutagenesis ̶ Human b5 mutations were generated following site-directed mutagenesis methods described previously (6). Briefly, plasmid DNA encoding the wild-type b5 cDNA was amplified by using 0.25 U Pfx and 0.5 U Taq DNA polymerases and a set of primers containing the appropriate base substitution as listed in Table 1. Reactions conditions were: denaturing at 95 °C for 15 sec, annealing at 62.5 °C for 20 sec, and extension at 68 °C for 3 min 30 sec. After 30 cycles of amplification, the resulting mutated plasmids were selected by digestion with Dpn I, and 5 µl PCR products were transformed in DH5α competent cells. The CYP17A1-R347K plasmid was created in the same manner as the b5 mutations, and the CYP17A1-R358K plasmid was prepared by overlap extension PCR, using the primers listed in Table 1. Constructs were sequenced to assure accurate mutagenesis.

Reconstituted enzyme assays ̶ In a 2 ml polypropylene tube, purified human CYP17A1 was mixed with 4-fold molar excess of POR, various amounts of b5, and 20 µg control yeast microsomes (CYMS) as phospholipid source in less than 10 µl volume and incubated for 5 min. The reaction mixture was then diluted to 0.2 ml with 50 mM potassium phosphate buffer (pH = 7.4), and substrates progesterone (10 µM, for 17hydroxylase activity) or 17-hydroxypregnelonone (5 µM, for 17,20-lyase activity) with 80,000 CPM tracer steroid in methanol (2% of incubation volume) were added. Experiments with microsomes containing native CYP17A1 (5 pmol) and POR from transformed yeast were preincubated with b5 variants (10 pmol) at room temperature for 5 min before adding substrate. The resulting mixture was pre-incubated at 37 °C for 3 min before adding NADPH (1 mM) and incubating at 37 °C for another 20 min. The reaction mixture was extracted with 1 ml

Expression and purification of recombinant proteins in E. coli ̶ Modified human CYP17A1 was expressed with GroEL/ES chaperones (pGro7 plasmid) in E. coli JM109 cells as described (17). Modified human POR was expressed in E. coli C41(DE3) cells (OverExpress, Lucigen, Middleton, WI) and purified according to the previously published procedure (18). For both cases, 1 liter of Terrific Broth (supplemented with 0.5 mM 5aminolevulinic acid for CYP17A1) and appropriate antibiotics were inoculated with 20 mL of an overnight pre-culture. The cells were grown at 37 °C with shaking at 250 rpm until the 3


A600 reached 0.8-1.2 AU, at which time the culture was induced with 0.4 mM IPTG and grown for 48 h at 25-27°C. After cell lysis with a French press, the recombinant proteins were solubilized using mild non-denaturing detergents: 0.5% Nonidet P40 for CYP17A1 and 0.2% cholate/0.2% Triton X-100 for POR (18). After centrifugation at 100,000 x g for 45 min, the supernatant was mixed with Ni-NTA affinity resin and purified in a single step upon elution with 300 mM imidazole, followed by buffer exchange using PD-10 columns. For cross-linking experiments, higher purity of CYP17A1 protein preparations were obtained by further affinity purified with His Select resin (0.5 ml) and Sartorius™ Vivapure-S spin columns (Mini H) according to manufacturer’s operation instructions. Purified CYP17A1 preparations showed a specific content of 8–12 nmol P450/mg protein with 3-10% P420. The protocol for expression and reconstitution of recombinant human b5 was based on the procedure of Mulrooney and Waskell (19). Yeast microsomes containing native human CYP17A1 and POR and control microsomes without human P450 enzymes were prepared from strain YiV(B) transformed with V60-c17 or native V60 plasmids, respectively, as described (20).


dichloromethane, and the organic phase was dried under nitrogen flow.

analyses, the SDS-PAGE gels were electroblotted onto PVDF membrane. The membranes were blocked for 1 h at room temperature in PBS containing 5% skim milk plus 0.1% Tween-20 and were incubated overnight at 4°C with mouse anti-His tag antibody, followed by incubation with secondary antibody for 1 h at room temperature. The blots were incubated for 1 min with ECL reagent and exposed to photographic film. LC/MS analysis ̶ The excised gels containing cross-linked proteins were processed by in-gel digestion using a robot (ProGest, DigiLab) and Promega sequencing-grade trypsin. The digested sample was analyzed by nano LC/MS with a Waters NanoAcquity HPLC system interfaced to a ThermoFisher Q Exactive tandem mass spectrometer. Peptides were loaded on a trapping column and resolved on a 75 µm analytical column at 350 nl/min; both columns were packed with Jupiter Proteo resin (Phenomenex). The mass spectrometer was operated in data-dependent mode, with MS and tandem MS performed in the Orbitrap at 70,000 FWHM and 17,500 FWHM resolutions, respectively. The fifteen most abundant ions were selected for tandem MS.

Spectroscopic methods ̶ UV/visible spectra were recorded on a Shimadzu UV-2600 spectrophotometer with UV-Probe software using a quartz cuvette with a path length of 10 mm.

Data processing ̶ Data were searched using a local copy of Mascot, and the DAT files were parsed into scaffold software for validation, filtering, and creating a non-redundant list for each sample. Cross-linked products were identified by analyzing MS data with the software StavroX 3.2.10. (21) , and Sqid-Xlink 1.0 (22). MS data containing all tandem MS data for each precursor ion are loaded as standard Mascot generic file (mgf) for StavroX or as dta files for Sqid-Xlink. The parameters are: K miscleavage = 3; R miscleavage = 1; fixed modification = carbamidomethyl (C); variable modification = oxidation (M), acetyl (protein N-term), pyro-glu (N-term Q), deamidation (NQ). CrossLinker parameters are: EDC mass = −18.01; composition = −H2O; precursor mass deviation = 50.0 ppm; fragment mass deviation = 20.0 ppm; lower mass limit = 200.0 Da; upper mass limit = 5000.0 Da; and S/N ratio = 2.0.

Cross-linking and immunoblot experiments ̶ Purified human CYP17A1 (50 pmol), b5 (WT or mutations) and phospholipids (PE:PS = 1:1) were reconstituted at a molar ratio of 1:15:100. After incubation for 20 min at 25°C, freshly prepared EDC was added to a final concentration of 2 mM in a total volume of 20 µl containing 50 mM potassium phosphate (pH 7.0). The mixture was shaken gently at room temperature for 2 h, followed by adding an equal volume of Laemmli sample buffer and boiling for 5 min. Control incubations without EDC were conducted in parallel. The cross-linked proteins were resolved with SDS-PAGE on 7.5% gels, and the bands corresponding to the heterodimeric complex of CYP17A1 and b5 were excised and submitted to LC/MS analysis at MSBioworks (Ann Arbor, Michigan). For immunoblot 4


Chromatography, data acquisition, and determination of kinetic constants ̶ Reaction products were analyzed using an Agilent 1260 Infinity HPLC system with UV detector and βRAM4 in-line scintillation counter (LabLogic, Brandon, FL). Extracted steroid products were dissolved in 20 µl of methanol, and 5 µl injections were resolved with a 50 × 2.1 mm, 2.6 µm, C8 Kinetex column (Phenomenex, Torrance, CA), equipped with a guard column at a flow rate of 0.4 mL/min. A methanol/water linear gradient was used: 27% methanol from 0 to 0.5 min, 39% to 16 min, 44% to 20 min, 60% to 22 min, 71% to 30 min, 75% to 30.5 min, 27% to 33 min. Products were identified by retention times of external standards chromatographed at the beginning and ends of the experiments. The flow rate of the scintillation cocktail (Bio-SafeII, Research Products International, Mount Prospect, IL) was 1.2 mL/min, and the data were processed with Laura4 software (LabLogic) and graphed with GraphPad Prism 6 (GraphPad Software, San Diego, CA).


donors. All mutations displayed absorption spectra comparable to that of the wild-type b5 in the reduced and oxidized state (Fig. 1), indicating structural and electronic integrity. Each b5 mutation was tested for its capacity to stimulate the 17,20-lyase activity of CYP17A1 (Fig. 2A). When yeast microsomes containing CYP17A1 and POR are incubated with b5 and 17-hydroxypregnenolone, the presence of wild-type b5 increased the rate of product formation 11-fold. The activities of b5 mutations GG, GA, AG, GC, CG, DG, GQ, and QG were totally abolished, and product formation was reduced to that observed without b5 added. The GD and DD mutations partially restored the capacity to stimulate 17,20-lyase activity at 23% and 38% that of wild-type b5, respectively. These results were replicated in a reconstituted system containing purified CYP17A1, POR, b5 and CYMS as lipid source (Fig. 2B). These data indicate that at least one carboxylate group is an essential feature of this interaction site and that even conservative aspartate substitutions are poorly tolerated at b5 residues E48 and E49. R-to-K mutations of key CYP17A1 residues ̶ CYP17A1 mutations that remove the full positive charge at arginine 347 or 358 selectively disrupt 17,20-lyase activity yet preserve 17-hydroxylase activity (11). We reasoned that mutation of these arginines to the basic residue lysine might preserve interactions with POR and b5, particularly the carboxylatemediated interaction with b5. CYP17A1 mutations R347K and R358K were strategically constructed in an effort to maintain 17,20-lyase activity, yet render residues 347 and 358 vulnerable to chemical reaction with carbodiimide cross-linking agents. The resulting R347K and R358K mutations exhibited similar 17-hydroxylase (Fig. 2C) and b5-stimulated 17,20-lyase activity as wild-type CYP17A1 (Fig. 2D). These mutations were then employed with wild-type CYP17A1 in cross-linking experiments with b5.

RESULTS Site-directed mutagenesis of b5 residues E48 and E49 ̶ Previous work has identified the acidic residues E48 and E49 as critical b5 residues for stimulation of 17,20-lyase activity (6,7). To determine the steric and electrostatic requirements of these key residues, a series of b5 mutations at position 48 and 49 (GG, GA, AG, GC, CG, GD, DG, GQ, QG, and DD) were generated, expressed, and purified as previously (7). The side-chain groups of these mutations vary in size, shape, charge, hydrophobicity, chemistry, and capacity to serve as salt bridges or hydrogen bond

Cross-linking CYP17A1 with b5 ̶ To identify CYP17A1 residues in close proximity to carboxylate groups of b5 during complex 5


Three-dimensional model analysis ̶ A three-dimensional model of CYP17A1-b5 heterodimer was predicted using the GRAMM-X (23) and HADDOCK (24-26) software tools, which are rigid-body protein-protein docking programs, to present the molecular interactions between CYP17A1 and b5. Each of the programs returned the 10 most probable models (clusters) out of thousands of candidates based on their geometry, hydrophobicity, and electrostatic complementarity. The first-ranked model in cluster 1 of HADDOCK and the top model in GRAMM-X exhibited highly similar interacting modes; therefore, the structure from HADDOCK was selected as the final model for further analysis. Chain A of human b5 molecule (PDB ID: 2I96, no accompanying journal publication as of August 2014) was set as ligand molecule and chain A of human CYP17A1 (PDB ID: 3RUK published by DeVore and Scott (27) as receptor molecule. As constraints, the 2 intermolecular cross-links identified below as well as amino acids identified from mutagenesis studies—K88, R347, R358 of CYP17A1 and E42, E48, E49, and E61 of b5—were used during all calculations to predict the interaction of these two target proteins. Molecular graphic figures were generated using PyMOL (http://www.pymol.org/). Predictions of binding affinity changes upon mutation were calculated by BeAtMuSiC v1.0 (28) available as a server at: http://babylone.ulb.ac.be/Beatmusic/, and molecular interface analysis was performed using PDBePISA (http://www.ebi.ac.uk/pdbe/prot_int/pistart.html).


type CYP17A1 and b5: CYP17A1-WT (84EVLIKK89)-b5 (53EQAGGDATENFEDVGHSTDAR73). The underlined residues, K88 of CYP17A1 and E61 of b5, have formed an interprotein amide bond via the action of EDC. Crosslinking of CYP17A1 mutation R358K and b5 with EDC afforded the same Lys88(CYP17A1)Glu61(b5) peptide (Fig. 4C, 4D), and no additional cross-linked species were identified. When CYP17A1 mutation R347K was incubated with b5 and EDC (Fig. 5A), a second cross-linked peptide was identified in addition to the K88(CYP17A1)-E61(b5) product. The fragmentation spectrum shown in Fig. 5B identified this new cross-linked peptide as: CYP17A1-R347K (341TPTISDKNR349) − b5 (40FLEEHPGGEEVLR52). Experiments were also performed, in which CYP17A1, POR, and b5 were treated with EDC, and one band corresponding to the ternary complex was detected by Coomassie blue staining (data not shown). LC/MS revealed peptides derived from CYP17A1, POR, and b5 in the complex with 5160% sequence coverage, including the crosslinked peptide K88(CYP17A1)-E61(b5). Due to lower mass accuracy of the data, however, other candidate cross-linked peptides could not be characterized with confidence. Table 2 summarizes the 2 intermolecular cross-link locations identified with StavroX and SquidXlink analyses.

Mass-spectrometry analysis of protein cross-links ̶ Following SDS-PAGE and Denville blue staining of the cross-linked species (Fig. 4A), peptide mixtures generated from in-gel trypsin digestions were separated by nano-HPLC and analyzed by mass spectrometry. These digests contained peptides from both CYP17A1 and b5, as well as inter- and intramolecular cross-linked products. To identify cross-linked peptides involving the 2 proteins from this intricate mixture, the experimentally obtained monoisotopic masses were compared with calculated masses of peptides and cross-linked products derived from the StavroX (21) and squid-Xlink (22) software packages as described in the Experimental Procedures. Fig. 4B shows a representative, high-resolution fragmentation spectrum of cross-linked peptides between wild-

Model of b5 interaction with CYP17A1 ̶ Using distance constraints derived from the crosslinking data and b5 residues E48 and E49 as essential components, low-resolution structural models were calculated using HADDOCK (2426) rigid body energy minimization and semiflexible and water refinement (Fig. 6A). The xray crystal structure of human CYP17A1 with bound abiraterone (PDB ID: 3RUK) reported by DeVore and Scott (27) was used as the receptor molecule. Like other P450s, the core of CYP17A1 contains helices D, E, I, and L, which compose a four-helix bundle that carries the triangular prism-shaped structure of the protein molecule. The long I-helix (purple in Fig. 6B, C) runs over the distal surface of the heme. The 6


formation, mixtures of CYP17A1 and b5 were incubated with the water-soluble zero-length cross-linker EDC, which covalently links lysine amino groups to the carboxylate groups of aspartic or glutamic acid. CYP17A1 mutations R347K and R358K were employed to specifically target these key residues, and b5 mutation E48G/E49G was used as a negative control. When incubations of b5 and CYP17A1 were treated with EDC, an approximately 70 kDa species was formed, consistent with a CYP17A1b5 heterodimer (“complex,” Fig. 3A). A 70 kDa species also appeared in incubations containing the CYP17A1 mutations R347K and R358K (Fig. 3A); however, complex formation was abolished or markedly reduced for incubations containing b5 mutation E48G/E49G (Fig. 3B). These results suggest that poor complex formation is the primary reason why b5 mutation E48G/E49G fails to stimulate 17,20-lyase activity. A small amount of complex formation between CYP17A1 mutation R358K and b5 mutation E48G/E49G (Fig. 3B) appears to be a nonspecific cross-linked product, since this b5 mutation does not stimulate the 17,20-lyase activity of CYP17A1 mutation R358K (data not shown). Addition of substrate to these experiments enhanced formation of the putative CYP17A1-b5 complex in the order 17hydroxypregnenolone = pregnenolone > progesterone > no substrate (Fig. 3C).


with R347, R358, and R449 of CYP17A1 or E49, which interacts with R358 and R449 of CYP17A1, with smaller or neutral amino acids resulted in a marked loss of catalytic activity. Prediction of changes in protein-protein binding affinity from these b5 mutations was analyzed by BeAtMuSiC v1.0. The difference in binding energies (ΔGbind) calculated for wild-type b5 and these mutations affords the change in binding energy (ΔΔGbind), which provides an estimate of the relative binding affinities. A substantial decrease in the binding affinity (ΔΔGbind = 3.5 Kcal/mol) was observed with the inactive CYP17A1-b5 mutation E48G/E49G complex. Smaller yet significant decreases in binding energy were calculated for the partially active CYP17A1-b5 mutation E48G/E49D (3.0 mutation Kcal/mol) and CYP17A1-b5 E48D/E49D (2.8 Kcal/mol) complexes. Thus, the stimulation of 17,20-lyase activity correlates well with the binding affinity between CYP17A1 and these b5 species. DISCUSSION The 17,20-lyase activity of CYP17A1 is strongly regulated via interactions with the redox partners POR and b5. Given the difficulties encountered when using traditional structural biology methods to study such multi-protein complexes, elucidating the architecture of these assemblies and their multiple interactions remains a challenging task. To overcome these difficulties, our study combined data from mutagenesis, chemical cross-linking, mass spectrometry, and computational modeling to provide an internally consistent description of CYP17A1 interactions with its allosteric modulator b5. First, we found that only some b5 mutations containing at least one acidic residue at positions 48 and 49 stimulate 17,20-lyase activity, affirming the stringent requirement for a carboxylate group in the α3 helix of b5 for this function. Second, we showed that b5 forms specific cross-links with CYP17A1, including mutations R347K and R358K, and that b5 mutation E48G/E49G disrupts this crosslinking. EDC, a zero-length cross-linking reagent, only reacts with amino and carboxylate groups in close proximity, which allows a very precise

Surface contacts analysis by PISA ̶ To analyze the surface contacts of the CYP17A1-b5 complex, we used the protein interfaces, surfaces and assemblies service PDBePISA at the European Bioinformatics Institute (http://www.ebi.ac.uk/pdbe/prot_int/pistart.html/). PISA yielded the interface area of 1126.0 Å2 for the interface between CYP17A1 and b5 in the complex. The interaction surface shows good shape complementarity with numerous electrostatic interactions, including 20 potential hydrogen bonds and 23 potential salt bridges (Table 3, Fig. 6D), plus hydrophobic interactions. Interfacing residues identified within the CYP17A1-b5 complex including K83/K88/K91 (B helix), K136 (C helix), R347 (J’ helix), R358 (K helix), and R449 (L helix) in CYP17A1 and E42/E43 (turn 2), E48/E49 (α3 helix), and E61/D65 (α4 helix) in b5 were all consistent with the results from cross-linking and mutagenesis experiments. As evidenced in Fig. 2A and B, replacement of b5 residues E48, which interacts 7


proximal side, where the heme iron is ligated to the thiolate of a conserved cysteine, is a highly conserved region where interactions with redoxpartner proteins occur. In the human b5 molecule (PDB ID: 2I96), the prosthetic heme group is sandwiched in a cleft between two helix–loop– helix motifs (Fig 6B), and a three-stranded βsheet ties together these helices. The structure of the CYP17A1-b5 complex generated from HADDOCK shows that seven key amino acids including K88, R347, and R358 in CYP17A1, and E42, E48, E49, and E61 in b5 are all located at the interface of the complex. This model incorporates the available evidence and features direct electrostatic and functional interactions between these charges residues. In addition to the two cross-links identified, the major contribution to the interaction enthalpy between CYP17A1 and b5 arises from the two electrostatic interactions between positively charged R347 (J’ helix) and R358 (K helix) side chains of CYP17A1 and negatively charged E48 and E49 (α3 helix) Cationic R358 on carboxyl groups of b5. CYP17A1 interacts with both E48 and E49 of b5, while anionic E48 on b5 interacts with both R347 and R358 of CYP17A1.


localization of protein interaction sites. Third, we identified 2 cross-linked peptides, which clustered in two adjacent regions for each protein. Finally, from the distance constraints imposed by the cross-linking and mutagenesis data, we used computational methods and existing x-ray crystal structures to generate a low-resolution model of the protein complex. These results represent the first observation of CYP17A1 and b5 cross-links and reveal the closest contacts between CYP17A1 and b5, which involve R347 and R358 of CYP17A1 with E48 and E49 of b5 at distances of 1.7-3.9 Å. All 4 CYP17A1 residues (K88, R347, R358, and R449) and three b5 residues (E48, E49, and R52) predicted by mutagenesis studies to be interacting with each other are on the interface of our model (Fig. 6D, Table 3).

solvent or might rapidly form an intramolecular cross-link. A zero-length cross-linking agent such as EDC identifies only a very limited number of interacting residues due to strict steric and chemical requirements. This analysis underscores the limitations of cross-linking experiments alone and emphasizes the need to combine these results with mutagenesis, modeling, and other structural studies. Nevertheless, these experiments yielded sufficient results to construct a structural model, which explains the available biochemical data.

Surprisingly, even though mutagenesis and NMR studies strongly implicate b5 residues E48 and E49 as critical for stimulating 17,20lyase activity, we did not identify these residues engaged in cross-linked amide bonds from with CYP17A1. Instead, acidic residues adjacent to the b5 α3 helix containing E48 and E49 formed crosslinks with CYP17A1 residues. Similarly, genetic and biochemical evidence confirm the importance of CYP17A1 residues R347 and R358 for 17,20lyase activity and interactions with POR and b5; however, EDC does not react with the guanidinium group of arginine and thus cannot be used to identify interacting residues on b5. We therefore employed CYP17A1 mutation R347K to trap residue 347 in a cross-link with E42 of b5. In contrast, mutant CYP17A1 residue K358 was not found in cross-linked peptides with b5 in our experiments. It is possible that other cross-linked peptides containing mutant CYP17A1 residues K347 or K358 and/or b5 residues E48 or E49 were present in our experiments but not identified for several possible reasons. The most likely reason is that cross-linked products involving K358 are not amenable to detection under the mass spectrometric conditions and computational methods employed, due to either insolubility, resistance to trypsin digestion, poor ionization, or subsequent further chemical modification. In addition, the side chain of K358 appears to be buried deep in the interaction surface and might not be accessible to the EDC reagent in the

The interaction sites of b5 with CYP2B4 (33,34), CYP2E1 (35), CYP3A4 (32), and CYP17A1 (6,7,this study) identified by crosslinking, NMR mapping and site-directed mutagenesis, are summarized in Table 4. Electrostatic attractions appear to dominate the orientation between each P450 and b5 to generate pre-collisional encounter complexes. Multiple sequences alignment among these P450s has shown that there are a significant number of 8


The sites of cross-linking identified in this study are all located on the proximal surface of CYP17A1 near the heme, in the conserved redox partner-binding site. K88 of CYP17A1, which cross-links to E61 of b5, is located at the end of helix B. The CYP17A1 mutation K88A shows a 30–40% diminished affinity for b5 (29,30), and CYP17A1 mutation K89N exhibits a selective 3-fold reduction in 17,20-lyase activity (31). In fact, K88 of CYP17A1 corresponds to K96 of CYP3A4, and the latter has been shown to interact with the same residue on helix 4 of b5 (E61, human b5 numbering) (32). When R347 of CYP17A1 located on helix J’ was mutated to lysine, a cross-link was readily formed with E42 of the b5 molecule (Fig. 5A). This cross-link specifies the orientation of the α2−loop−α3 segment of b5—including key residues E42, E48, and E49—to align with the proximal concave surface of CYP17A1 and is critical for determining the topological features of CYP17A1-b5 complex. Further support for this model derives from site-directed mutagenesis studies, where substitution of either R347, R358 or R449 to alanine in human CYP17A1 prevented binding of b5 and eliminates 17,20-lyase activity without impairing 17-hydroxylase activity (11).


favorable contacts between amino acid residues at different regions of the structure. For CYP2B4, total of 7 side chains participate in b5 interactions, and these residues are all located in the C-helix on the proximal surface of the protein, except for K433, which is located in the β-bulge (33). All of the 5 residues of b5 that interact with CYP2B4 are located on the α4−loop−α5 segment, which are distinct from the residues that interact with CYP17A1. On the other hand, CYP2E1 uses K428 and K434 to interact with E58 and E61 of Even though K434 of CYP2E1 b5 (35). corresponds to K433 in CYP2B4, these residues do not interact with the same residue of b5. CYP3A4 interactions with b5 appear to be more complex than for these other P450s. K421 of CYP3A4 and R347/R358 of CYP17A1 were found to interact with the same acidic residues (E42, E48, and E49) of b5. In addition, CYP3A4 also uses another two cationic residues, K96 (corresponding to K88 of CYP17A1) and K127 (corresponding to R122 of CYP2B4) to interact with E61 of b5 (32), based on cross-linking data. One limitation to comparing our results with other EDC cross-linking studies of P450s with b5 is our use of lysine mutagenesis to target arginine residues implicated in interactions with b5. Therefore, we cannot exclude that additional arginine residues of these P450s participate in b5 binding, but these interactions remain occult. It is apparent that the b5 binding profiles of CYP2B4 is relatively similar to that of CYP2E1 but remarkably different than that of CYP17A1, yet promiscuous CYP3A4 enzyme shows a combination all of these interactions with b5.

hydroxypregnenolone (Fig. 3C). Minor discrepancies might result from different experimental conditions used, including protein concentrations and phospholipid presence, forms of CYP17A1 employed (amino-terminal truncated and soluble vs. modified and detergentsolubilized), and other factors. Nevertheless, the ability of substrate binding to affect CYP17A1-b5 complex formation is consistent in both studies.

Our data are consistent with the recent NMR study of Estrada et al. (8), in which acidic residues E48 and E49 of b5 and R347, R358, and R449 of CYP17A1 are all critical in proteinprotein binding. Evidence from chemical shift mapping also indicate that b5 and POR compete for a binding surface on CYP17A1 and that the presence of substrate influences b5-induced conformational changes in CYP17A1 (8). In our hands, cross-linking was most efficient in assays reconstituted with phospholipids (PE:PS = 1:1) and substrates, and the formation of CYP17A1-b5 complex increased in the order: no substrate < progesterone < pregnenolone = 179


In summary, we have described the electrostatic interactions of CYP17A1 with b5, using several methods to generate an internally consistent model. This work is an important step in elucidating the structural features responsible for the 17,20-lyase reaction and P450-redox partner binding in general. The 17,20-lyase activity of CYP17A1 is the only pathway to androgen biosynthesis known and an important target for drug discovery. Abiraterone, galeterone, and related steroid azoles (2,36,37) are potent CYP17A1 inhibitors that markedly suppress androgen synthesis, which is desirable for treating prostate cancer (37) and androgen excess disorders such as 21-hydroxylase deficiency (38). These tight-binding heme-directed inhibitors, however, have the undesirable consequence of inhibiting 17-hydroxylase activity as well, which leads to the accumulation of upstream steroids that cause hypertension (39,40) as occurs in genetic 17-hydroxylase deficiency (41), unless combined with glucocorticoid therapy. Our current results might be exploited to develop selective inhibitors of the 17,20-lyase reaction, by targeting this CYP17A1 interaction with b5, if such compounds do not disrupt reduction by POR. Protein-protein interactions are traditionally viewed as difficult targets for chemical intervention, as these interacting surfaces often lack the deeper pockets and clefts found in enzyme active sites. Nevertheless, there is a growing interest in this approach and success using fragment-based methods to target protein interfaces at 'hot spots' or allosteric sites that alter protein conformations (42). Given the immense burden of androgen-dependent diseases, further studies to define and to target the CYP17A1-b5 interaction are likely to yield clinically important results.


REFERENCES

1. 2.

3. 4. 5.

7. 8. 9.

α

10. 11.

12. 13.

14. 15.

10


6.

Miller, W. L., and Auchus, R. J. (2011) The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr Rev 32, 81-151 Attard, G., Reid, A. H., Yap, T. A., Raynaud, F., Dowsett, M., Settatree, S., Barrett, M., Parker, C., Martins, V., Folkerd, E., Clark, J., Cooper, C. S., Kaye, S. B., Dearnaley, D., Lee, G., and de Bono, J. S. (2008) Phase I clinical trial of a selective inhibitor of CYP17, abiraterone acetate, confirms that castration-resistant prostate cancer commonly remains hormone driven. J Clin Oncol 26, 4563-4571 Mostaghel, E. A., and Nelson, P. S. (2008) Intracrine androgen metabolism in prostate cancer progression: mechanisms of castration resistance and therapeutic implications. Best Pract Res Clin Endocrinol Metab 22, 243-258 Miller, W. L., Auchus, R. J., and Geller, D. H. (1997) The regulation of 17,20 lyase activity. Steroids 62, 133-142 Auchus, R. J., Lee, T. C., and Miller, W. L. (1998) Cytochrome b5 augments the 17,20lyase activity of human P450c17 without direct electron transfer. J Biol Chem 273, 31583165 Naffin-Olivos, J. L., and Auchus, R. J. (2006) Human cytochrome b5 requires residues E48 and E49 to stimulate the 17,20-lyase activity of cytochrome P450c17. Biochemistry 45, 755-762 Peng, H. M., and Auchus, R. J. (2013) The Action of Cytochrome b5 on CYP2E1 and CYP2C19 Activities Requires Anionic Residues D58 and D65. Biochemistry 52, 210-220 Estrada, D. F., Laurence, J. S., and Scott, E. E. (2013) Substrate-modulated Cytochrome P450 17A1 and Cytochrome b5 Interactions Revealed by NMR. J Biol Chem 288, 1700817018 Lee-Robichaud, P., Kaderbhai, M. A., Kaderbhai, N., Wright, J. N., and Akhtar, M. (1997) Interaction of human CYP17 (P-450(17 ), 17α-hydroxylase-17,20-lyase) with cytochrome b5: importance of the orientation of the hydrophobic domain of cytochrome b5. Biochem J 321 (Pt 3), 857-863 Geller, D. H., Auchus, R. J., and Miller, W. L. (1999) P450c17 mutations R347H and R358Q selectively disrupt 17,20-lyase activity by disrupting interactions with P450 oxidoreductase and cytochrome b5. Mol Endocrinol 13, 167-175 Lee-Robichaud, P., Akhtar, M. E., Wright, J. N., Sheikh, Q. I., and Akhtar, M. (2004) The cationic charges on Arg347, Arg358 and Arg449 of human cytochrome P450c17 (CYP17) are essential for the enzyme's cytochrome b5 -dependent acyl-carbon cleavage activities. J Steroid Biochem Mol Biol 92, 119-130 Geller, D. H., Auchus, R. J., Mendonca, B. B., and Miller, W. L. (1997) The genetic and functional basis of isolated 17,20-lyase deficiency. Nat Genet 17, 201-205 Hershkovitz, E., Parvari, R., Wudy, S. A., Hartmann, M. F., Gomes, L. G., Loewental, N., and Miller, W. L. (2008) Homozygous mutation G539R in the gene for P450 oxidoreductase in a family previously diagnosed as having 17,20-lyase deficiency. J Clin Endocrinol Metab 93, 3584-3588 Kok, R. C., Timmerman, M. A., Wolffenbuttel, K. P., Drop, S. L. S., and de Jong, F. H. (2010) Isolated 17,20-lyase deficiency due to the cytochrome b5 mutation W27X. J Clin Endocrinol Metab 95, 994-999 Idkowiak, J., Randell, T., Dhir, V., Patel, P., Shackleton, C. H. L., Taylor, N. F., Krone, N., and Arlt, W. (2012) A missense mutation in the human cytochrome b5 gene causes


16. 17.

18. 19. 20.

22. 23. 24. 25. 26. 27. 28. 29. 30. 31.

11


21.

46,XY disorder of sex development due to true isolated 17,20 lyase deficiency. J Clin Endocrinol Metab 97, E465-475 Peng, H. M., and Auchus, R. J. (2014) Two surfaces of cytochrome b5 with major and minor contributions to CYP3A4-catalyzed steroid and nifedipine oxygenation chemistries. Arch Biochem Biophys 541, 53-60 Yoshimoto, F. K., Zhou, Y., Peng, H. M., Stidd, D., Yoshimoto, J. A., Sharma, K. K., Matthew, S., and Auchus, R. J. (2012) Minor activities and transition state properties of the human steroid hydroxylases cytochromes P450c17 and P450c21, from reactions observed with deuterium-labeled substrates. Biochemistry 51, 7064-7077 Sandee, D., and Miller, W. L. (2011) High-yield expression of a catalytically active membrane-bound protein: human P450 oxidoreductase. Endocrinology 152, 2904-2908 Mulrooney, S. B., and Waskell, L. (2000) High-level expression in Escherichia coli and purification of the membrane-bound form of cytochrome b5. Protein Expr Purif 19, 173178 Sherbet, D. P., Tiosano, D., Kwist, K. M., Hochberg, Z., and Auchus, R. J. (2003) CYP17 mutation E305G causes isolated 17,20-lyase deficiency by selectively altering substrate binding. J Biol Chem 278, 48563-48569 Gotze, M., Pettelkau, J., Schaks, S., Bosse, K., Ihling, C. H., Krauth, F., Fritzsche, R., Kuhn, U., and Sinz, A. (2012) StavroX--a software for analyzing crosslinked products in protein interaction studies. J Am Soc Mass Spectrom 23, 76-87 Li, W., O'Neill, H. A., and Wysocki, V. H. (2012) SQID-XLink: implementation of an intensity-incorporated algorithm for cross-linked peptide identification. Bioinformatics 28, 2548-2550 Tovchigrechko, A., and Vakser, I. A. (2006) GRAMM-X public web server for proteinprotein docking. Nucleic Acids Res 34, W310-314 de Vries, S. J., van Dijk, M., and Bonvin, A. M. (2010) The HADDOCK web server for data-driven biomolecular docking. Nat Protoc 5, 883-897 Dominguez, C., Boelens, R., and Bonvin, A. M. (2003) HADDOCK: a protein-protein docking approach based on biochemical or biophysical information. J Am Chem Soc 125, 1731-1737 de Vries, S. J., van Dijk, A. D., Krzeminski, M., van Dijk, M., Thureau, A., Hsu, V., Wassenaar, T., and Bonvin, A. M. (2007) HADDOCK versus HADDOCK: new features and performance of HADDOCK2.0 on the CAPRI targets. Proteins 69, 726-733 DeVore, N. M., and Scott, E. E. (2012) Structures of cytochrome P450 17A1 with prostate cancer drugs abiraterone and TOK-001. Nature 482, 116-119 Dehouck, Y., Kwasigroch, J. M., Rooman, M., and Gilis, D. (2013) BeAtMuSiC: Prediction of changes in protein-protein binding affinity on mutations. Nucleic Acids Res 41, W333-339 Hlavica, P., Schulze, J., and Lewis, D. F. (2003) Functional interaction of cytochrome P450 with its redox partners: a critical assessment and update of the topology of predicted contact regions. J Inorg Biochem 96, 279-297 Lewis, D. F., and Lee-Robichaud, P. (1998) Molecular modelling of steroidogenic cytochromes P450 from families CYP11, CYP17, CYP19 and CYP21 based on the CYP102 crystal structure. J Steroid Biochem Mol Biol 66, 217-233 Auchus, R. J., and Miller, W. L. (1999) Molecular modeling of human P450c17 (17αhydroxylase/17,20-lyase): insights into reaction mechanisms and effects of mutations.


32.

33. 34.

35.

37. 38.

39.

40. 41. 42.

12


36.

Mol Endocrinol 13, 1169-1182 Zhao, C., Gao, Q., Roberts, A. G., Shaffer, S. A., Doneanu, C. E., Xue, S., Goodlett, D. R., Nelson, S. D., and Atkins, W. M. (2012) Cross-linking mass spectrometry and mutagenesis confirm the functional importance of surface interactions between CYP3A4 and holo/apo cytochrome b5. Biochemistry 51, 9488-9500 Im, S. C., and Waskell, L. (2011) The interaction of microsomal cytochrome P450 2B4 with its redox partners, cytochrome P450 reductase and cytochrome b5. Arch Biochem Biophys 507, 144-153 Pandey, M. K., Vivekanandan, S., Ahuja, S., Huang, R., Im, S. C., Waskell, L., and Ramamoorthy, A. (2013) Cytochrome-P450-cytochrome- b5 interaction in a membrane environment changes 15N chemical shift anisotropy tensors. J Phys Chem B 117, 1385113860 Gao, Q., Doneanu, C. E., Shaffer, S. A., Adman, E. T., Goodlett, D. R., and Nelson, S. D. (2006) Identification of the interactions between cytochrome P450 2E1 and cytochrome b5 by mass spectrometry and site-directed mutagenesis. J Biol Chem 281, 20404-20417 Handratta, V. D., Vasaitis, T. S., Njar, V. C. O., Gediya, L. K., Kataria, R., Chopra, P., Newman, D., Jr., Farquhar, R., Guo, Z., Qiu, Y., and Brodie, A. M. H. (2005) Novel C17-heteroaryl steroidal CYP17 inhibitors/antiandrogens: synthesis, in vitro biological activity, pharmacokinetics, and antitumor activity in the LAPC4 human prostate cancer xenograft model. J Med Chem 48, 2972-2984 Schweizer, M. T., and Antonarakis, E. S. (2012) Abiraterone and other novel androgendirected strategies for the treatment of prostate cancer: a new era of hormonal therapies is born. Ther Adv Urol 4, 167-178 Auchus, R. J., Buschur, E. O., Chang, A. Y., Hammer, G. D., Ramm, C., Madrigal, D., Wang, G., Gonzalez, M., Xu, X. S., Smit, J. W., Jiao, J., and Yu, M. K. (2014) Abiraterone acetate to lower androgens in women with classic 21-hydroxylase deficiency. J Clin Endocrinol Metab 99, 2763-2770 Attard, G., Reid, A. H., Auchus, R. J., Hughes, B. A., Cassidy, A. M., Thompson, E., Oommen, N. B., Folkerd, E., Dowsett, M., Arlt, W., and de Bono, J. S. (2012) Clinical and biochemical consequences of CYP17A1 inhibition with abiraterone given with and without exogenous glucocorticoids in castrate men with advanced prostate cancer. J Clin Endocrinol Metab 97, 507-516 Auchus, M. L., and Auchus, R. J. (2012) Human steroid biosynthesis for the oncologist. J Investig Med 60, 495-503 Kater, C. E., and Biglieri, E. G. (1994) Disorders of steroid 17α-hydroxylase deficiency. Endocrinol Metab Clin North Am 23, 341-357 Friberg, A., Vigil, D., Zhao, B., Daniels, R. N., Burke, J. P., Garcia-Barrantes, P. M., Camper, D., Chauder, B. A., Lee, T., Olejniczak, E. T., and Fesik, S. W. (2013) Discovery of potent myeloid cell leukemia 1 (Mcl-1) inhibitors using fragment-based methods and structure-based design. J Med Chem 56, 15-30


Acknowledgements ̶We thank Dr. Jacqueline Naffin-Olivos for constructing the expression plasmids for b5 E48G/E49G mutations and Dr. Richard Jones for assistance with mass spectrometry. FOOTNOTES *This work was supported by grant R01-GM086596-04 from the National Institutes of Health. To whom correspondence should be addressed: Richard J. Auchus, Division of Metabolism, Endocrinology, and Diabetes, Department of Internal Medicine, University of Michigan, Ann Arbor, MI 48109, Tel: (734)-764-7764. Fax: (734)-936-6684. E-mail: [email protected] 2 Abbreviations: b5, cytochrome b5; CYMS, control yeast microsomes; CYP17A1, cytochrome P450 17A1; PE, 1,2-diacyl-sn-glycero-3-phosphoethanolamine; PS, 1,2-diacyl-sn-glycero-3-phospho-L-serine; IPTG, isopropyl-β-D-thiogalactopyranoside; POR, cytochrome P450 oxidoreductase; EDC, ethyl-3-(3dimethylaminopropyl)carbodiimide. 1

FIGURE LEGENDS

FIGURE 2. Stimulation of CYP17A1 17,20-lyase activity by b5 and effect of mutations. A, Effect of b5 and b5 mutations on catalytic activities of yeast microsomes containing CYP17A1 and POR. Incubations contained 10 µM 17-hydroxypregnenolone, and results are shown as the percentage activity compared to wild-type b5 values (=100%) from triplicate determinations, means ± standard deviations. B, Effect of b5 and b5 mutations on catalytic activities of reconstituted, purified CYP17A1 and POR. Purified CYP17A1 (10 pmol) was reconstituted with POR, various b5 mutations, and CYMS as phospholipid for reconstitution with molar ratio of P450:POR:b5 at 1:4:2. Results are shown as the percentage activity compared to wild-type b5 values (=100%) from triplicate determinations, means ± standard deviations. The 17-hydroxylase (C) and 17,20-lyase activities (D) of CYP17A1 mutations R347K and R358K are not different than the activities of wild-type CYP17A1. Incubations were carried out with 10 µM progesterone and a 1:4 molar ratio of P450:POR (C) or 10 µM 17-hydroxypregnenolone and a 1:4 molar ratio of P450:POR:b5 (D) as described in the Experimental Procedures. Values are the averages of duplicate determinations. The rate of DHEA formation without b5 added is 7−9% the rates in the presence of b5. FIGURE 3. Immunoblots of CYP17A1 and b5 or b5 mutation E48G/E49G cross-linked with EDC, and effect of steroid substrates on complex formation. Reactions were performed in 50 mM potassium phosphate buffer pH 7.0, containing 2.5 µM CYP17A1, 37.5 µM b5, 250 µM phospholipid, and 2 mM EDC in total volume of 20 µl. A 1-µl aliquot of the reaction mixture was loaded in each lane and subjected to SDS-PAGE and immunoblot with anti-polyhistidine antibody, which detects both CYP17A1 and b5. A, Wild-type b5 (17 kDa) and CYP17A1 (55 kDa), wild-type or mutations R347K and R358K as indicated, was incubated with PE+PS (1:1) in the absence of presence of EDC. B, The b5 mutation E48G/E49G and CYP17A1, wild-type or mutations R347K and R358K as indicated, was incubated with PE+PS (1:1) in the absence or presence of EDC. C, CYP17A1 and b5 were incubated with PE+PS (1:1) and EDC in the absence or presence of steroid substrates: Prog = progesterone, Preg = pregnenolone; 17Preg = 17-hydroxypregnenolone. The immunoreactive bands corresponding to CYP17A1 and the 1:1 CYP17A1-b5 complex (“complex”) are indicated.

13


FIGURE 1. Absorbance spectra of the purified recombinant human b5 mutations. Characteristic spectra with maximum absorption wavelength for oxidized (412 nm, native) and reduced (424 nm, after adding solid sodium dithionite) forms are shown. Spectra were recorded with 4-8.5 µM b5 in 1 mL of 10 mM potassium phosphate buffer, pH 7.4; ordinates are 0.5-1.5 AU full scale.


FIGURE 4. Mass spectrometry of peptide pair derived from CYP17A1 crosslinked with b5. A, EDC cross-linking of wild-type CYP17A1 and b5 followed by SDS−PAGE analysis with Denville blue staining. Reactions were performed as described in Figure 3, and the entire reaction mixture was loaded on the gel. B, Representative high-resolution fragmentation spectrum of cross-linked peptide between CYP17A1 and b5 identified by StavroX: CYP17A1-WT (84EVLIKK89) and b5 (53EQAGGDATENFEDVGHSTDAR73). The numbers in parentheses indicate the positions of the crosslinked peptide sequences with the cross-linked residues underlined. Signals of y-type ions are shown in blue, while signals of b-type ions are shown in red. The measurement error of the ion is 0.3 ppm. C, EDC cross-linking of R358K and b5 followed by SDS−PAGE and Denville blue staining. D, Representative high-resolution fragmentation spectrum of cross-linked peptide pair between CYP17A1-R358K and b5: CYP17A1-R358K (84EVLIKK89) and b5 (53EQAGGDATENFEDVGHSTDAR73). Residue numbering and spectrum annotation are the same as in panels A and B. The measurement error of the ion is 1.5 ppm.

FIGURE 6. Docking model of CYP17A1 interaction with b5, based on crystal structures of CYP17A1 (3RUK) and b5 (2I96). The docking was performed using the programs HADDOCK with the distance constraints of two intermolecular cross-links, K88(CYP17A1)-E61(b5) and R347(CYP17A1)E42(b5), as well as E48 and E49 of b5. A, The interaction of amino acid K88 (red) in CYP17A1 and E61 (blue) of b5 are shown on a surface model. E49 of b5 in the center of complex is shown in blue. B, Cartoon model of CYP17A1 interacting with b5. The heme groups in CYP17A1 and b5 are shown in red and orange sticks, respectively, and the abiraterone molecule in the crystal structure is shown in green. The central I–helix is displayed in purple, and amino acid K88, R347 and R358 of CYP17A1, which interact with b5, are shown in magenta. The side chain of glutamic acids 42, 48, and 49 of b5 are shown in blue. C, A close-up view of the CYP17A1-b5 interaction interface is shown, where the glutamic acid residues in b5 interacting with CYP17A1 are visible. D, CYP17A1-b5 interactions were detected using the PISA server and presented as a space-filled model. Interface residues at less than 3.9 Å from interaction sites are shown in red (including R347, R358, and R449) for CYP17A1 and green (including E42, E48, E49 and R52) for b5, respectively. The buried residues were colored in grey, and the rest of the residues are shown in blue for CYP17A1 and cyan for b5.

14


FIGURE 5. Mass spectrometry of peptide pair derived from CYP17A1 mutation R347K crosslinked with b5. A, EDC cross-linking of CYP17A1 mutation R347K and b5 followed by SDS−PAGE analysis with Denville blue staining. Reactions were performed as described in Figure 3, and the entire reaction mixture was loaded on the gel. B. Representative high-resolution fragmentation spectrum of cross-linked peptide between CYP17A1-R347K and b5 identified by StavroX: R347K (341TPTISDKNR349) and b5 (40FLEEHPGGEEVLR52). The numbers in parentheses indicate the positions of the cross-linked peptide sequences with the cross-linked residues underlined. Signals of y-type ions are shown in blue, while signals of b-type ions are shown in red. The measurement error of the ion is 1.6 ppm.


TABLE 1 Primer pairs for generating E48/49 mutations of b5 and R-to-K mutations of CYP17A1 Capitalized letters indicate replacing nucleotides. Cytochrome b5 Mutation Forward primers GA catcctggtggAgGagCagttttaagggaacaag AG gagcatcctggtggAgCagGagttttaagggaac GC gagcatcctggtggAgGaTGCgttttaagggaacaagctg CG ggaagagcatcctggtggATGCgGagttttaagggaacaag GD gcatcctggtggAgGaGACgttttaagggaacaagc DG gaagagcatcctggtggAgATgGagttttaagggaacaag DD gagcatcctggtggagatgATgttttaagggaacaagctg GQ gagcatcctggtggAgGaCAagttttaagggaacaag QG gaagagcatcctggtggACAAgGagttttaagggaac Forward primers atcagtgacAAGaaccgtctcc ggacttctctgggcggcctcaaatg ggccaccatcAAGgaggtgcttcgc

Reverse primers ggagacggttCTTgtcactgat gcgaagcacctcCTTgatggtggcc cccaagcttcagtgatggtgatggtg

TABLE 2 Cross-linked peptide pairs between CYP17A1 and cytochrome b5 _____________________________________________________________________________________ CYP17A1 Cytochrome b5 [M+H]+cal [M+H]+exp Deviation ____________________ ___________________________________ (ppm) Cross-linked Cross-linked Sequence amino acid Sequence amino acid _____________________________________________________________________________________ EVLIKK

88

EQAGGDATENFEDVGHSTDAR

61

2916.396

2916.397

0.3

TPTISDKNR* 347 FLEEHPGGEEVLR 42 2524.279 2524.275 1.6 _____________________________________________________________________________________ Filtering cutoff: FDR < 0.05; spectral count >2 *Cross-linking between CYP17A1 mutation R347K and b5

15


CYP17A1 Mutation R347K R358K-1 R358K-2

Reverse primers cttgttcccttaaaactGctCcTccaccaggatg gttcccttaaaactCctGcTccaccaggatgctc cagcttgttcccttaaaacGCAtCcTccaccaggatgctc cttgttcccttaaaactCcGCATccaccaggatgctcttcc gcttgttcccttaaaacGTCtCcTccaccaggatgc cttgttcccttaaaactCcATcTccaccaggatgctcttc cagcttgttcccttaaaacATcatctccaccaggatgctc cttgttcccttaaaactTGtCcTccaccaggatgctc gttcccttaaaactCcTTGTccaccaggatgctcttc


TABLE 3 PISA analysis of the salt-bridge and H-bonding interactions between the residues in the interface of CYP17A1 and wild-type b5

Salt Bridges 1 ARG 347 (NE) 2 ARG 347 (NH1) 3 LYS 136 (NZ) 4 LYS 136 (NZ) 5 ARG 449 (NE) 6 ARG 449 (NH2) 7 ARG 347 (NH2) 8 ARG 358 (NH2) 9 ARG 449 (NE) 10 ARG 347 (NH2) 11 ARG 358 (NH1) 12 ARG 358 (NH2) 13 ARG 347 (NH1) 14 ARG 449 (NH2) 15 ARG 358 (NE) 16 ARG 358 (NH2) 17 ARG 358 (NE) 18 ARG 358 (NH2) 19 LYS 83 (NZ) 20 LYS 83 (NZ) 21 LYS 88 (NZ) 22 LYS 88 (NZ) 23 LYS 91 (NZ)

Cytochrome b5 Residue (Atom)

Distance (Å)

GLU 62 (OE1) GLU 62 (O) GLU 63 (OE2) GLU 68 (OE1) GLU 68 (OE2) GLU 68 (OE2) GLU 69 (OE1) GLU 69 (OE1) GLU 69 (OE2) GLU 69 (OE2) GLU 73 (OE1) GLU 73 (OE2) GLU 81 (OE1) ASP 85 (OD2) ASP 85 (O) LYS 44 (HZ2) GLY 67 (N) GLU 68 (N) GLU 69 (N) ARG 72 (HE)

1.68 2.27 1.63 1.66 1.66 1.68 2.49 1.63 2.14 1.75 1.62 2.25 1.67 1.57 1.93 1.68 2.71 2.88 2.99 1.99

GLU 62 (OE1) GLU 62 (OE1) GLU 63 (OE1) GLU 63 (OE2) GLU 68 (OE1) GLU 68 (OE1) GLU 68 (OE1) GLU 68 (OE1) GLU 68 (OE2) GLU 68 (OE2) GLU 68 (OE2) GLU 68 (OE2) GLU 68 (OE2) GLU 69 (OE1) GLU 69 (OE1) GLU 69 (OE1) GLU 69 (OE2) GLU 69 (OE2) GLU 73 (OE1) GLU 73 (OE2) GLU 81 (OE1) GLU 81 (OE2) ASP 85 (OD2)

3.88 2.66 3.59 2.67 2.61 3.29 3.92 3.17 3.72 2.66 3.83 2.67 3.75 2.97 3.19 3.60 2.96 2.68 2.66 2.65 2.68 2.95 2.61

16


CYP17A1 Residue (Atom) Hydrogen Bonds 1 ARG 347 (HH11) 2 LYS 136 (HZ1) 3 LYS 136 (HZ3) 4 ARG 449 (HE) 5 ARG 347 (HH22) 6 ARG 358 (HH22) 7 ARG 449 (HH22) 8 TYR 432 (HH) 9 ARG 358 (HE) 10 ARG 358 (HH21) 11 LYS 83 (HZ3) 12 LYS 83 (HZ1) 13 LYS 88 (HZ2) 14 LYS 91 (HZ1) 15 LYS 91 (HZ2) 16 ASN 348 (OD1) 17 GLU 445 (OE1) 18 GLU 445 (OE1) 19 GLU 445 (OE2) 20 SER 427 (OG)


17


TABLE 4 Interaction sites identified by chemical cross-linking, NMR mapping, and site-directed mutagenesis of b5 and P450s b5 Alignment Interaction site Residue Position* on CYP enzyme References _____________________________________ 2B4 2E1 3A4 17A1 E42 62 K421 R347 [32, this paper] E48/E49 68/69 K421 R358 [32, 6, 7, this paper] D58 78 K428 [35] E61 81 K434 K96/K127 K88 [35, 32, 29, this paper] E64 84 R122/R126 [33, 34] D65 85 R122/K433 [33, 34] V66 86 R125/K433 [33, 34] G67 87 R126 [33, 34] T70 90 A130/D134/G136 [33] *Positions are numbered according to the crystal structure of human cytochrome b5 (PDB 2I96)



Figure 1

18



Figure 2

19



Figure 3

20



Figure 4

21



Figure 5

22



Figure 6

23

Mechanistic Scrutiny Identifies a Kinetic Role for Cytochrome b5 Regulation of Human Cytochrome P450c17 (CYP17A1, P450 17A1).

The diverse chemistry of cytochrome P450 17A1 (P450c17, CYP17A1).

Interaction between cytochrome c and cytochrome b5.

Apparent dependence of interactions between cytochrome b5 and cytochrome b5 reductase upon translational diffusion in dimyristoyl lecithin liposomes.

NMR characterization of surface interactions in the cytochrome b5-cytochrome c complex.

Redox properties of microsomal reduced nicotinamide adenine dinucleotide-cytochrome b5 reductase and cytochrome b5.

Effects of membrane mimetics on cytochrome P450-cytochrome b5 interactions characterized by NMR spectroscopy.

Evidence that cytochrome b5 acts as a redox donor in CYP17A1 mediated androgen synthesis.

Studies on methemoglobin reductase. Immunochemical similarity of soluble methemoglobin reductase and cytochrome b5 of human erythrocytes with NADH-cytochrome b5 reductase and cytochrome b5 of rat liver microsomes.

Cytochrome b5-mediated redox cycling of estrogen.

Evidence that two forms of bovine erythrocyte cytochrome b5 are identical to segments of microsomal cytochrome b5.

Chromosomal localization of a cytochrome b5 gene to human chromosome 18 and a cytochrome b5 pseudogene to the X chromosome.

Effect of KCl on the interactions between NADPH:cytochrome P-450 reductase and either cytochrome c, cytochrome b5 or cytochrome P-450 in octyl glucoside micelles.

NADH-cytochrome c reductase activity in cultured human lymphocytes. Similarity to the liver microsomal NADH-cytochrome b5 reductase and cytochrome b5 enzyme system.

Optimization of yeast-expressed human liver cytochrome P450 3A4 catalytic activities by coexpressing NADPH-cytochrome P450 reductase and cytochrome b5.

Direct electrochemistry of protein-protein complexes involving cytochrome c, cytochrome b5, and plastocyanin.

Study of lipid-protein interactions in membrane models: intrinsic fluorescence of cytochrome b5-phospholipid complexes.

Human cytochrome P450 17A1 conformational selection: modulation by ligand and cytochrome b5.

Site of action of substrates requiring cytochrome b5 for oxidation by cytochrome P450.

The obligatory requirement of cytochrome b5 in the p-nitroanisole O-demethylation reaction catalyzed by cytochrome P-450 with a high affinity for cytochrome b5.

The roles of cytochrome b5 in a reconstituted N-demethylase system containing cytochrome P-450.

Primary structure of the membranous segment of cytochrome b5.

Lipid-protein interactions in membrane models. Fluorescence polarization study of cytochrome b5-phospholipids complexes.

Cytochrome b5 modulates multiple reactions in steroidogenesis by diverse mechanisms.