ORIGINAL ARTICLE OTA HIGHLIGHT PAPER
Can We Trust Intraoperative Culture Results in Nonunions? Michael P. Palmer, MD,* Daniel T. Altman, MD,† Gregory T. Altman, MD,‡§ Jeffrey J. Sewecke, DO,‡k Garth D. Ehrlich, PhD,¶** Fen Z. Hu, PhD,¶** Laura Nistico, PhD,¶ Rachel Melton-Kreft, BSN,¶ Trent M. Gause, III, BS,†† and John W. Costerton, PhD¶
Objectives: To identify the presence of bacterial biofilms in
cultures to detect biofilms and bacteria previously exposed to antibiotic therapy.
nonunions comparing molecular techniques (multiplex polymerase chain reaction and mass spectrometry, fluorescent in situ hybridization) with routine intraoperative cultures.
Key Words: nonunion, infection, biofilm, Ibis, PCR, fracture, molecular diagnostics
Methods: Thirty-four patients with nonunions were scheduled for
Level of Evidence: Diagnostic Level I. See Instructions for Authors for a complete description of levels of evidence.
surgery and enrolled in this ongoing prospective study. Intraoperative specimens were collected from removed implants, surrounding tissue membrane, and local soft tissue followed by standard culture analysis, Ibis’s second generation molecular diagnostics (Ibis Biosystems), and bacterial 16S rRNA-based fluorescence in situ hybridization (FISH). Confocal microscopy was used to visualize the tissue specimens reacted with the FISH probes, which were chosen based on the Ibis analysis.
Results: Thirty-four patient encounters were analyzed. Eight were diagnosed as infected nonunions by positive intraoperative culture results. Ibis confirmed the presence of bacteria in all 8 samples. Ibis identified bacteria in a total of 30 of 34 encounters, and these data were confirmed by FISH. Twenty-two of 30 Ibis-positive samples were culture-negative. Four samples were negative by all methods of analysis. No samples were positive by culture, but negative by molecular techniques. Conclusions: Our preliminary data indicate that molecular diagnostics are more sensitive for identifying bacteria than cultures in cases of bony nonunion. This is likely because of the inability of Accepted for publication November 19, 2013. From the *Department of Orthopaedic Surgery, Allegheny General Hospital, Pittsburgh, PA; †Department of Orthopaedic Surgery, Allegheny General Hospital, Drexel University College of Medicine and Temple University School of Medicine, Pittsburgh, PA; ‡Division of Orthopaedic Trauma, Allegheny General Hospital, Pittsburgh, PA; §Department of Orthopaedic Surgery, Temple University School of Medicine, Pittsburgh, PA; kDepartment of Orthopaedic Surgery, Drexel University College of Medicine, Pittsburgh, PA; ¶Center for Genomic Sciences, Allegheny-Singer Research Institute, Pittsburgh, PA; **Department of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, PA; and ††Penn State University, State College, PA. Supported by grants from the Orthopedic Trauma Association and Synthes USA. Presented in part at the Orthopedic Trauma Association Annual Meeting, October 2011, San Antonio, TX, and at the American Academy of Orthopaedic Surgeons Annual Meeting, February 2012, San Francisco, CA. Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions this article on the journal’s Web site (www.jorthotrauma.com). The authors report no conflict of interest. G. D. Ehrlich has received grant money from Abbott (who purchased Ibis Biosciences) for other projects totaling ;$100K. None of this money was used to fund the current study. Reprints: Michael P. Palmer, MD, 1307 Federal St, 2nd Floor, Pittsburgh, PA 15212 (e-mail: [email protected]). Copyright © 2013 by Lippincott Williams & Wilkins
384
| www.jorthotrauma.com
(J Orthop Trauma 2014;28:384–390)
INTRODUCTION Nonunion of long bone fractures is a devastating complication with rates that vary depending on fracture severity and location.1 The rates of delayed union and nonunion are higher in open fractures and in patients with certain comorbidities such as smoking, obesity, diabetes mellitus, and peripheral vascular disease.2 Many factors are involved in nonunion, and combinations of factors have been noted. Instability can predispose to microbial infection, as evidenced in controlled animal studies.3 The use of internal fixation devices provides optimal stability but these inert biomaterials may, with avascular bone, provide an optimal environment around which bacterial infections can develop. However, the true extent to which the presence of bacteria precludes normal bony healing is unknown. Direct examination of failed implants4,5 and of bone from nonunions6 has shown that the bacteria on these biomaterials and in these tissues form slimy matrix-enclosed communities called biofilms. This mode of growth puts the bacteria involved in nonunions in the category of “biofilm pathogens,” as defined by Costerton et al.7 Systemic antibiotic therapy may be of limited use when combating a biofilm infection because biofilms have been shown to be resistant to concentrations of antibiotics 100–1000 times higher than those needed to kill their planktonic (free-swimming) counterparts.8,9 Biofilm infections are difficult to detect and identify using conventional culture techniques,10,11 yet cultural techniques are traditionally the only methodology that has been used to detect bacteria in nonunions. This raises the possibility that some nonunions assumed to be sterile, because of negative cultures, may actually be infected with a biofilm. If this is true, it is possible that treatment could be more effective if surgical debridement was combined with antibiotic therapy to target such previously undetected organism(s). New multiplex polymerase chain reaction–mass spectroscopic methods, developed by the Defense Advanced Research Projects J Orthop Trauma Volume 28, Number 7, July 2014
J Orthop Trauma Volume 28, Number 7, July 2014
Agency (DARPA) to counter bacterial bioterrorist weapons, are now being used to detect and identify any and all bacteria present in clinical specimens.11–13 In this study, we compared culture techniques to this DNA-based multiplex PCR–MS system (Ibis Biosystems, Carlsbad, CA), with respect to their sensitivity, in detecting and identifying bacteria, in 34 consecutive cases of surgical intervention for nonunion of long bone fractures.
MATERIALS AND METHODS Thirty-four consecutive patients were consented and enrolled in this ongoing IRB-approved prospective study. All patients were treated by 1 of 3 senior authors at a level 1 trauma center. The senior authors were blinded to the results of the molecular testing because the Ibis technology is not FDA approved for clinical diagnostic use. Nonunion was selected as a model because it provides a readily available source of removed implants and debrided tissue to study during the course of routine care. A nonunion was defined as radiographic evidence of nonprogression of healing for at least 3 months, or lack of healing by 9 months since the initial injury.14,15 Infection was suspected based on clinical examination (pain, swelling, erythema, warmth, draining sinus) but confirmed by positive intraoperative cultures. Administration of antibiotics was delayed until after intraoperative samples were collected, unless the patient was systemically ill. During surgery, the explanted hardware and specimens of local soft tissue and “membrane” (slimy amorphous accretions in the area of the nonunion) were collected aseptically and sent for analysis. Specimens were collected from the area immediately surrounding the hardware to be removed, with the exact location for each sample being chosen at the surgeons’ discretion. All specimens were analyzed separately by routine microbiological culture methods and Gram stain in the hospital’s onsite laboratory. Samples were also analyzed by the Ibis T-5000 multiplex PCR–MS system, and these results were independently confirmed by fluorescence in situ hybridization (FISH). Clinicians were blinded to the Ibis and the FISH data until after the expiration of the IRB mandate.
Gram Stain and Wound Cultures Wound cultures were collected intraoperatively using swabs to sample the immediate area surrounding the nonunion. After sampling the deepest portion of the wound, the swabs were replaced into the holder, placed into a biohazard bag, and transported immediately to the on-site laboratory. If a tissue sample was taken at the same time to be cultured, it was collected in a sterile container, placed in a biohazard bag, and transported immediately to the onsite laboratory. Routine wound cultures collected on a swab were used to inoculate blood agar plates (BAP), choclate agar plates (CHOC), MacConkey plates (MAC), and Columbia Colistin– Nalidix acid agar (CAN). A Gram stain was made next by rolling the other swab on a glass slide to make a thin film. The agar plates were then incubated in 5% CO2 at 358C. The tissue samples collected for culture, and Gram stain were first cut with a sterile scalpel to make a touch prep for Gram stain. The rest of the tissue was placed into a sterile disposable Ó 2013 Lippincott Williams & Wilkins
Intraoperative Culture Results in Nonunions
tissue grinder. The same plates were inoculated as previously stated for the wound swabs with the addition of thioglycollate media (THIO). The BAP and CHOC were incubated in 5% CO2 at 358C, and the MAC and THIO were incubated in the aerobic incubator at 358C. All slides made for Gram stain were examined for cells and bacteria under the oil immersion objective. Any polymorphonuclear leukocytes and mononuclear cells were reported. Any organisms seen were reported and quantified numerically. The incubated cultures (both agar plates and broth) were examined at 24 hours. If there was no growth on plates or in broth, they were incubated for an additional 24 hours. After day 2, if no growth was seen in broth or plates, the plates were discarded and reported as “no growth day 2” and the THIO were placed in the rack for an additional 3 days. The THIO was examined every 24 hours until 5 days, and if no growth was found “no growth day 5” was reported. If growth was seen on plates after first 24 hours, then the sample was reincubated on plates and in broth for an additional 24 hours. All significant isolates were reported on day 2, and any relevant plates were saved until day 5. If there was no growth on the plates, but growth in THIO, the THIO was Gram stained and subcultured on appropriate plates based on the findings. All plates were followed until day 5 and then disposed.
Ibis Technology One cubic millimeter biopsies collected from the immediate area surrounding the nonunion were placed into a sterile microcentrifuge tubes containing 270 mL of ATL lysis buffer (cat# 19076; Qiagen, Germantown, MD) and 30 mL proteinase K (cat# 19131; Qiagen). Samples were incubated at 568C until lysis of the material was noted by visual inspection (typically ;12 hours). One hundred microliters of a mixture containing 50 mL each of 0.1 mm and 0.7 mm Zirconia beads (cat# 11079101z and 11079107zx, respectively; Biospec) were added to the samples, which were then homogenized for 10 minutes at 25 Hz using a Qiagen Tissuelyser. Nucleic acids from the lysed sample were then extracted using the Qiagen DNeasy Tissue kit (cat# 69506; Qiagen). Ten microliters of each sample was loaded per well (16 wells/specimen) onto Ibis BAC detection PCR plates (cat# PN 05N13-01; Abbott Molecular). The BAC detection plate is a 96-well plate, which uses 16 separate PCRs for each sample to comprehensively (available at www.ibisbiosciences.com) survey all bacterial species, several important antibiotic resistance genes, and Candidal species. This is accomplished by using a combination of (1) domain-based omnipresent loci (eg, 16S and 18S rDNA), (2) various phyla/class-specific genes; and (3) pathogen-specific genes for key species of interest (eg, The Staphylococcusspecific tufB gene). An internal calibrant consisting of a synthetic nucleic acid template is also included in each well of each assay, controlling for false negatives (eg, from PCR inhibitors) and providing for quantitation of signal. PCR amplification was carried out as per Jiang and Hofstadtler.16 The PCR products were then desalted in a 96-well plate format and sequentially electrosprayed into a time-of-flight mass spectrometer. The Ibis technology can detect any bacterial genome that exceeds www.jorthotrauma.com |
385
J Orthop Trauma Volume 28, Number 7, July 2014
Palmer et al
1%–2% of the total bacterial population, and it identifies the cognate species by comparing the calculated base ratio with a database covering thousands of species.12 The inclusion of an internal calibrant provides a quantitative determination of the number of copies of any bacterial gene in the sample, which is expressed as “genomes per well.” All samples in which Staphylococcus epidermidis or P. acnes were found to contain ,10 genomes per well were excluded as potentially representing skin contaminants. However, all other species were recorded and considered significant. Currently, it takes 6–8 hours to complete a sample analysis with the Ibis. All Ibis-positive cases with suitable samples were then subjected to fluorescence in situ hybridization (FISH) using 16S RNA probes corresponding to the bacterial species identified by the Ibis as a confirmatory method. There were 3 cases where the tissue samples were insufficient to perform FISH.
FISH Technology Fluorescence in situ hybridization (FISH) analysis of the samples was carried out as previously described.17 Briefly, specimens were fixed in 4% para-formaldehyde, then washed 3 times with PBS, and stored at 2808C in 1:1 ethanol/PBS until processed. The bacterial cells were permeabilized and hybridized with FISH probes as described by Nistico et al.17 The FISH stained tissue was then mounted and imaged by confocal laser scanning microscopy. Probes used to perform FISH on any given sample were selected based on the Ibis or culture results and corresponded to species-specific, genusspecific, or “universal” eubacterial probes. A list of probes used in this study can be seen in Table 1.
RESULTS The culture and Ibis data for 34 patients with long bone nonunions were extracted (Table 2). There were 17 men and 17 women. The average age of the patients was 49 years (range, 18–71). The average body mass index of the patients was 29.1 kg/m2 (range, 20.4–46.9). The location and frequency of fractures were as follows: 19 tibiae (12 open) (OTA, 41–43), 12 femora (1 open) (OTA, 31–33), 3 humeri (1 open) (OTA, 12–13). Thirteen patients were smokers, 13 had hypertension, 8 had diabetes mellitus, 3 had hyperthyroidism, 3 had lung disease (OSA, COPD), 3 were being treated for depression, and 1 was HIV positive. The average time from initial injury to enrollment in this study was 10 months.
Of 34 patients with nonunions, 8 were culture positive (23.5%). Cultures grew 1 bacterium in 7 of 8 (87.5%) of the cases and multiple bacteria in 1 of 8 (12.5%). The cultures were positive for Staphyloccocus aureus in 4 patients (50%), coagulase-negative Staphylococci in 2 patients (25%), Pseudomonas aeruginosa in 1 patient (12.5%), and 1 patient (12.5%) grew both S. aureus and P. aeruginosa. When comparing nonunions secondary to open fractures (14 patients) to closed (20 patients) fractures, there were 4 culture-positive patients in the open fracture group (28.5%) and 4 of the closed fractures were culture positive (20%). The cultures from the open fracture nonunions grew S. aureus in 2 cases, P. aeruginosa in 1 case, and S. aureus and P. aeruginosa together in 1 case. The positive cultures from the closed fractures grew S. aureus in 2 cases and coagulase-negative staphylococcus in 2 cases. Ibis identified bacterial DNA in at least 1 sample (soft tissue or membrane swab) in 30 of 34 cases (88%). Ibis identified multiple bacteria in 21 of 34 cases (62%). The most common bacterium found was S. aureus (14 cases, 41%), followed by P. acnes (9 cases, 26%), S. epidermidis (6 cases, 17%), Treponema denticola (7 cases, 21%), Streptococcal species (2 cases, 6.6%), Enterococcal species (4 cases, 12%), P. aeruginosa (1 case, 3.3%), Acinetobacter species (1 case, 3.3%), and other Staphylococcal species in 6 cases (17%). Ibis and FISH (using the generic eubacterial probe) were negative in 4 samples (4 cases, 11.7%). There was 1 discrepancy between Ibis and culture results. In Table 2, Encounter 26, methicillin-resistant Staphylococcus aureus grew by culture, and Enterococcus faecalis was detected by Ibis and confirmed by FISH. The use of FISH probes targeted against the species or genus identified by the Ibis data confirmed their presence in 26 of 26 cases and the general 338 Eubacterial probe in 3 of 3 cases. In 2 cases where Ibis and cultures were negative, FISH was performed using the generic EUBAC338 probe, which will hybridize with any bacterial 16S sequence, and both were found to be negative. In 3 cases, insufficient samples were collected for FISH analysis (see Figure 1, Supplemental Digiatal Content 1, http://links.lww.com/BOT/A154).
DISCUSSION Surgeons confronted with long bone nonunions can search for mechanical causes for the failure to heal, but a microbiological etiology is difficult to establish unless there
TABLE 1. Probes Used for Fluorescence In Situ Hybridization (FISH) Probe Name
Intended Target Organisms
Sequence (50 –.30 )
EUB338 NONEUB338 Str Sau Sta TRE II ENF 191 PseaerA PAC 16S 598
Many Eubacteria None (control) Streptococcus sp. S. aureus Staphylococcus sp. (+Acinetobacter and few others) T. denticola E. faecalis P. aeruginosa P. acnes
GCT GCC TCC CGT AGG AGT ACT CCT ACG GGA GGC AGC CAC TCT CCC CTT CTG CAC GAA GCA AGC TTC TCG TCC G TCC TCC ATA TCT CTG CGC GCTCCTTTCCTCATTTACCTTTAT GAAAGCGCCTTTCACTCTTATGC TCT CGG CCT TGA AAC CCC GCC CCA AGA TTA CAC TTC CG
386
| www.jorthotrauma.com
Reference 39 40 41 42 41 43 44 45 46
Ó 2013 Lippincott Williams & Wilkins
J Orthop Trauma Volume 28, Number 7, July 2014
Intraoperative Culture Results in Nonunions
TABLE 2. Patient Data With Microbiological and Molecular Diagnostic Results Encounter
Age
Sex
63
49
Male
76
51
95 57
Hardware Removed
Open/ Closed
Fx Site
Culture
IBIS Tissue
IBIS Membrane
FISH
Closed
Tibia
neg
S. aureus
S. aureus
S. aureus
Male
Titanium plate, screws Titanium IM rod
Closed
Femur
neg
S. aureus, MecA
S. aureus
23 55
Male Male
Titanium IM rod Titanium IM rod
Closed Closed
Femur Tibia
neg neg
S. aureus S. aureus, P. acnes
S. aureus, MecA neg S. aureus
26
39
Female
Titanium IM rod
Closed
Femur
MRSA
neg
E. faecalis
64
69
Female
Closed
Femur
MSSA
S. aureus
S. aureus
28
18
Male
Titanium IM rod, titanium plate, screws Titanium IM rod
Open
Tibia
P. aeruginosa, MSSA
S. aureus, MecA
105
24
Female
Titanium IM rod
Open
Tibia
MRSA
neg
22
68
Female
Open
Tibia
neg
S. epidermidis, MecA
44
63
Female
Stainless steel plate, screws Titanium IM rod
S. aureus, MecA, T. denticola S. epidermidis, S. aureus N/A
Closed
Tibia
neg
51
61
Female
Stainless steel plate, screws
Closed
Humerus
neg
58
52
Male
Closed
Femur
neg
59
70
Female
Titanium solid IM nail Stainless steel wire
Closed
Tibia
61
70
Female
Titanium IM rod
Closed
Tibia
101
70
Female
Titanium IM rod
Closed
Tibia
Coag-neg staph Coag-neg staph neg
S. warneri, B. vesicularis S. epidermidis, S. capitis, S. simulans S. epidermidis, S. lugdunensis S. epidermidis
102
70
Male
Titanium IM rod
Closed
Femur
neg
48
35
Male
Titanium IM rod
Open
Tibia
P. aeruginosa
45
61
Female
Closed
Humerus
50
61
Female
Stainless steel plate, screws Stainless steel plate, screws
Open
72
31
Female
97
66
Female
87
50
Male
38
55
Male
99 103 94
21 34 47
Male Male Female
Stainless steel plate, screws Titanium plate, screws Stainless steel plate, screws Stainless steel plate, screws Titanium IM rod Titanium IM rod Stainless steel plate, screws
67
58
Male
Titanium IM rod
S. aureus Staph genus, P. acnes 338 Eubacterial probe S. aureus
S. aureus
Staph genus Streptococcus
S. aureus
Streptococcus
neg
Streptococcus
S. epidermidis
Streptococcus
B. subtile
Streptococcus
S. epidermidis
Streptococcus
S. agalacticae
Streptococcus Streptococcus
neg
P. aeruginosa, L. reuteri, T. denticola T. denticola
S. sobrinus, E. faecalis P. aeruginosa, L. delbrueckii E. faecalis
Tibia
neg
E. faecalis
S. aureus
Closed
Tibia
neg
P. acnes
Closed
Femur
neg
P. acnes, S. aureus
T. denticola, S. aureus S. aureus
Open
Tibia
neg
P. acnes
P. acnes
Open
Tibia
neg
P. acnes, T. denticola
Open Open Open
Tibia Tibia Tibia
neg neg MRSA
P. acnes N/A P. acnes, S. aureus
Closed
Tibia
neg
neg P. acnes P. acnes, S. aureus, MecA, Lactobacillus sp. neg
P. acnes, T. denticola P. acnes P. acnes S. aureus, MecA T. denticola
T. denticola
S. epidermidis, S. lugdunensis, MecA S. epidermidis, S. bovis S. pneumoniae
P. aeruginosa
E. faecalis S. aureus, 338 eubacterial probe P. acnes, T. denticola 338 Eubacterial probe P. acnes P. acnes
(continued on next page )
Ó 2013 Lippincott Williams & Wilkins
www.jorthotrauma.com |
387
J Orthop Trauma Volume 28, Number 7, July 2014
Palmer et al
TABLE 2. (Continued ) Patient Data With Microbiological and Molecular Diagnostic Results Hardware Removed
Open/ Closed
Female
Stainless steel plate, screws
Closed
Femur
neg
T. denticola
S. aureus
30
Female
Titanium IM rod
Open
Tibia
neg
neg
6
37
Male
Titanium IM rod
Open
Tibia
neg
4 5
61 68
Female Female
Closed Closed
Femur Femur
neg neg
neg neg
338 Eubacterial probe N/A neg
14 17
39 28
Male Female
Titanium IM rod Stainless steel plate, screws Titanium IM rod Stainless steel screws
A. capsulatus, S. pneumoniae neg neg
S. aureus, T. denticola, P. acnes neg
Open Open
Femur Femur
neg neg
neg neg
neg neg
neg N/A
Encounter
Age
Sex
73
45
74
Fx Site
Culture
IBIS Tissue
IBIS Membrane
FISH 338 Eubacterial probe, S. aureus T. denticola
Patients are grouped by the most common bacterial species found in the samples by the IBIS. neg, negative result; N/A, not enough tissue was sampled to perform the test; MSSA, methicillin-sensitive S. aureus; MRSA, methicillin-resistant S. aureus; MecA, methicillin resistance gene.
is a draining sinus tract or a positive culture of an intraoperative specimen.18 Intraoperative cultures are the gold standard for diagnosing infection. Unfortunately, these methods have variable and often inadequate sensitivity and specificity.7,10,19 Multiple surgical strategies are available when undertaking surgical repair of nonunions. A significant improvement in the detection and identification of bacteria and of specific antibiotic resistance genes would add another powerful tool to aid in the treatment of fracture nonunions.11,12,20 Cultures recover bacteria with very poor sensitivity but with good specificity, and this problem is compounded by biofilm infections7 such as otitis media21,22 and prostatitis23 because bacteria growing in this communal phenotype rarely grow when plated on agar surfaces. The DNA-based molecular methods that have replaced cultures in the analysis of bacterial populations in most natural and industrial ecosystems are not universally accepted in medicine. Molecular diagnostic methods are currently labor intensive and expensive.24 PCR-based methods have been slowly introduced into clinical use for the detection of prosthetic joint infections.25–27 However, the limitation of single-primer PCR is that it can only detect 1 target organism. At our institution, Stoodley et al4 in 2008 demonstrated a S. aureus biofilm by PCR and FISH on a total elbow prosthesis that was repeatedly culture-negative for several years despite suspected clinical infection. We reported a case study of a tibial nonunion that was culture-negative but shown to have an intramedullary polymicrobial biofilm with molecular techniques.13 In this study, 34 patients had been scheduled for surgery because of a long bone nonunion. Intraoperative specimens yielded positive cultures in 8 of 34 cases, and parallel specimens showed the presence of bacteria by the Ibis technology in 30 of 34 cases. Routine cultures identified bacteria in only 8 of 30 positive samples (27%) compared with molecular technologies. Looking at both culture-positive
388
| www.jorthotrauma.com
and culture-negative samples, routine culture results were confirmed in 12 of 34 cases (35%) also analyzed by Ibis and FISH. The high degree of sensitivity and specificity of the Ibis system is attested by the fact that it detected the same organism found by culture in 8 of 8 cases and that FISH probes reacted with the predominant organism found by the Ibis in at least 1 specimen in 29 of 29 (100%) cases. Our molecular findings in this study indicate that many of the infections associated with bony nonunion result from a polymicrobial process. This is consistent with what has been observed for multiple other chronic infections. Since the introduction of non-biased molecular diagnostic modalities, many microbially complex infectious etiologies have been observed, including chronic and recurrent otitis media22; adenoiditis,28 surgical site infections,29 infected arthroplasties30; and chronic nonhealing venous insufficiency wounds.31 Thus, it is likely that the majority of chronic infections result from the establishment of wound-specific infectious ecologies, each with its own interacting microbiome wherein the various species and strains present within the microbial community not only compete but in many cases protect and provide nutrients for one another.32 There has been reported concern for oversensitivity of molecular-based techniques regarding clinical relevance.27 The Ibis detects bacteria that are present at .1% of the overall microbial burden,12 and previous studies support the supposition that these bacteria are alive as dead bacteria and bacterial DNA are rapidly cleared by the body.22 Moreover, the universal finding in this study of nonunions that FISH confirms the Ibis results strongly indicates that the bacteria present are invested in the tissues in question. Preparing samples for FISH is a relatively harsh procedure during which a majority of biofilm is actually washed away, leaving behind only a small portion of the initial biofilm, which must be strongly adherent to the host tissue.22,27 The fact that we have been able to confirm the presence of biofilms imbedded in Ó 2013 Lippincott Williams & Wilkins
J Orthop Trauma Volume 28, Number 7, July 2014
tissue and hardware with FISH strengthens the argument for the accuracy of the Ibis. Orthopaedic surgeons must understand that many bacteria exist in a biofilm state and are thus difficult to culture. Our understanding of biofilms and their role in orthopaedic infections is evolving. Molecular techniques are becoming more available and promising in the diagnosis of infection in the face of negative cultures. A potential weakness of the study is the limited size and observational nature of the study. Preoperative antibiotics were only given to patients who exhibited signs of systemic infection. This could have negatively affected the ability to obtain positive cultures in these patients.33 We did not perform sonication of the culture samples because this is not a standard practice in routine clinical microbiology.34 Seven cases in our series identified a majority of P. acnes by molecular techniques, but not by culture. We recognize that P. acnes is a very slow growing bacteria in culture and that can take .10 days to grow.35,36 Given this fact, and the prevalence of P. acnes found in our study with the emerging recognition that this bacteria is an orthopaedic pathogen,37,38 all orthopaedic operating room culture samples at our institution are now held for 14 days to increase our ability to identify P. acnes infections. In conclusion, our study demonstrates the improved sensitivity of DNA-based molecular techniques over cultures for bacterial detection in bony nonunion. This is likely because of the inability of cultures to detect bacteria in a biofilm state. ACKNOWLEDGMENTS The authors specially thank Courtney Saltarski, MPH, MID, for her help in preparation of this manuscript. This study is in memory and honor of John William “Bill” Costerton, PhD. REFERENCES 1. Tzioupis C, Giannoudis PV. Prevalence of long-bone non-unions. Injury. 2007;38(suppl 2):S3–S9. 2. Cierny G III, Mader JT, Penninck JJ. A clinical staging system for adult osteomyelitis. Clin Orthop Relat Res. 2003;414:7–24. 3. Merritt K, Dowd JD. Role of internal fixation in infection of open fractures: studies with Staphylococcus aureus and proteus mirabilis. J Orthop Res. 1987;5:23–28. 4. Stoodley P, Nistico L, Johnson S, et al. Direct demonstration of viable Staphylococcus aureus biofilms in an infected total joint arthroplasty. A case report. J Bone Joint Surg Am. 2008;90:1751–1758. 5. Gristina AG, Costerton JW. Bacterial adherence to biomaterials and tissue. The significance of its role in clinical sepsis. J Bone Joint Surg Am. 1985;67:264–273. 6. Khoury AE, Lam K, Ellis B, et al. Prevention and control of bacterial infections associated with medical devices. ASAIO J. 1992;38:M174– M178. 7. Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science. 1999;284:1318–1322. 8. Nickel JC, Ruseska I, Wright JB, et al. Tobramycin resistance of Pseudomonas aeruginosa cells growing as a biofilm on urinary catheter material. Antimicrob Agents Chemother. 1985;27:619–624. 9. Patzakis MJ, Zalavras CG. Chronic posttraumatic osteomyelitis and infected nonunion of the tibia: current management concepts. J Am Acad Orthop Surg. 2005;13:417–427. 10. Costerton JW. Biofilm theory can guide the treatment of device-related orthopaedic infections. Clin Orthop Relat Res. 2005;437:7–11.
Ó 2013 Lippincott Williams & Wilkins
Intraoperative Culture Results in Nonunions 11. Costerton JW, Post JC, Ehrlich GD, et al. New methods for the detection of orthopedic and other biofilm infections. FEMS Immunol Med Microbiol. 2011;61:133–140. 12. Ecker DJ, Sampath R, Massire C, et al. Ibis T5000: a universal biosensor approach for microbiology. Nat Rev Microbiol. 2008;6:553–558. 13. Palmer MP, Sewecke JJ, Altman DT, et al. Molecular techniques to detect biofilm bacteria in long bone nonunion: a case report. Clin Orthop Relat Res. 2011;469:3037–3042. 14. Bhandari M, Fong K, Sprague S, et al. Variability in the definition and perceived causes of delayed unions and nonunions: a cross-sectional, multinational survey of orthopaedic surgeons. J Bone Joint Surg Am. 2012;94:e1091–e1096. 15. Bhandari M, Guyatt GH, Swiontkowski MF, et al. A lack of consensus in the assessment of fracture healing among orthopaedic surgeons. J Orthop Trauma. 2002;16:562–566. 16. Jiang Y, Hofstadler SA. A highly efficient and automated method of purifying and desalting PCR products for analysis by electrospray ionization mass spectrometry. Anal Biochem. 2003;316:50–57. 17. Nistico L, Gieseke A, Stoodley P, et al. Fluorescence “in situ” hybridization for the detection of biofilm in the middle ear and upper respiratory tract mucosa. Methods Mol Biol. 2009;493:191–213. 18. Toh CL, Jupiter JB. The infected nonunion of the tibia. Clin Orthop Relat Res. 1995;315:176–191. 19. Moussa FW, Anglen JO, Gehrke JC, et al. The significance of positive cultures from orthopedic fixation devices in the absence of clinical infection. Am J Orthop (Belle Mead NJ). 1997;26:617–620. 20. Ehrlich GD, Stoodley P, Kathju S, et al. Engineering approaches for the detection and control of orthopaedic biofilm infections. Clin Orthop Relat Res. 2005;437:59–66. 21. Coates H, Vijayasekaran S. Bacterial biofilm in chronic suppurative otitis media. Otolaryngol Head Neck Surg. 2010;142:778; author reply 778. 22. Hall-Stoodley L, Hu FZ, Gieseke A, et al. Direct detection of bacterial biofilms on the middle-ear mucosa of children with chronic otitis media. JAMA. 2006;296:202–211. 23. Soto SM, Smithson A, Martinez JA, et al. Biofilm formation in uropathogenic Escherichia coli strains: relationship with prostatitis, urovirulence factors and antimicrobial resistance. J Urol. 2007;177:365–368. 24. Hugenholtz P, Goebel BM, Pace NR. Impact of culture-independent studies on the emerging phylogenetic view of bacterial diversity. J Bacteriol. 1998;180:4765–4774. 25. De Man FH, Graber P, Lüem M, et al. Broad-range PCR in selected episodes of prosthetic joint infection. Infection. 2009;37:292–294. 26. Gallo J, Kolar M, Dendis M, et al. Culture and PCR analysis of joint fluid in the diagnosis of prosthetic joint infection. New Microbiol. 2008;31: 97–104. 27. Panousis K, Grigoris P, Butcher I, et al. Poor predictive value of broadrange PCR for the detection of arthroplasty infection in 92 cases. Acta Orthop. 2005;76:341–346. 28. Nistico L, Kreft R, Gieseke A, et al. Adenoid reservoir for pathogenic biofilm bacteria. J Clin Microbiol. 2011;49:1411–1420. 29. Kathju S, Nistico L, Hall-Stoodley L, et al. Chronic surgical site infection due to suture-associated polymicrobial biofilm. Surg Infect (Larchmt). 2009;10:457–461. 30. Stoodley P, Conti SF, DeMeo PJ, et al. Characterization of a mixed MRSA/MRSE biofilm in an explanted total ankle arthroplasty. FEMS Immunol Med Microbiol. 2011;62:66–74. 31. Tuttle MS, Mostow E, Mukherjee P, et al. Characterization of bacterial communities in venous insufficiency wounds by use of conventional culture and molecular diagnostic methods. J Clin Microbiol. 2011;49: 3812–3819. 32. Ehrlich GD, Ahmed A, Earl J, et al. The distributed genome hypothesis as a rubric for understanding evolution in situ during chronic bacterial biofilm infectious processes. FEMS Immunol Med Microbiol. 2010;59: 269–279. 33. Malekzadeh D, Osmon DR, Lahr BD, et al. Prior use of antimicrobial therapy is a risk factor for culture-negative prosthetic joint infection. Clin Orthop Relat Res. 2010;468:2039–2045. 34. Trampuz A, Piper KE, Jacobson MJ, et al. Sonication of removed hip and knee prostheses for diagnosis of infection. N Engl J Med. 2007;357:654–663. 35. Schlecht S, Freudenberg MA, Galanos C. Culture and biological activity of Propionibacterium acnes. Infection. 1997;25:247–249.
www.jorthotrauma.com |
389
J Orthop Trauma Volume 28, Number 7, July 2014
Palmer et al
36. Marino C, Stoughton RB. Clinical use of a selective culture medium for wild and antibiotic-resistant Propionibacterium acnes. J Am Acad Dermatol. 1982;6:902–908. 37. Dodson CC, Craig EV, Cordasco FA, et al. Propionibacterium acnes infection after shoulder arthroplasty: a diagnostic challenge. J Shoulder Elbow Surg. 2010;19:303–307. 38. Millett PJ, Price CS, Horan MP, et al. Propionibacterium acnes infection as an occult cause of postoperative shoulder pain: a case series. Clin Orthop Relat Res. 2011;469:2824–2830. 39. Amann RI, Binder BJ, Olson RJ, et al. Combination of 16S rRNAtargeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol. 1990;56:1919–1925. 40. Manz W, Amann R, Ludwig W, et al. Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst Appl Microbiol. 1992;15:593–600. 41. Trebesius K, Leitritz L, Adler K, et al. Culture independent and rapid identification of bacterial pathogens in necrotising fasciitis and streptococcal
390
| www.jorthotrauma.com
42. 43. 44. 45. 46.
toxic shock syndrome by fluorescence in situ hybridisation. Med Microbiol Immunol. 2000;188:169–175. Kempf VA, Trebesius K, Autenrieth IB. Fluorescent in situ hybridization allows rapid identification of microorganisms in blood cultures. J Clin Microbiol. 2000;38:830–838. Moter A, Leist G, Rudolph R, et al. Fluorescence in situ hybridization shows spatial distribution of as yet uncultured treponemes in biopsies from digital dermatitis lesions. Microbiology. 1998;144:2459–2467. Wellinghausen N, Kochem AJ, Disqué C, et al. Diagnosis of bacteremia in whole-blood samples by use of a commercial universal 16S rRNA genebased PCR and sequence analysis. J Clin Microbiol. 2009;47:2759–2765. Hogardt M, Trebesius K, Geiger AM, et al. Specific and rapid detection by fluorescent in situ hybridization of bacteria in clinical samples obtained from cystic fibrosis patients. J Clin Microbiol. 2000;38:818–825. Poppert S, Riecker M, Essig A. Rapid identification of Propionibacterium acnes from blood cultures by fluorescence in situ hybridization. Diagn Microbiol Infect Dis. 2010;66:214–216.
Ó 2013 Lippincott Williams & Wilkins
Can We Trust Intraoperative Culture Results in Nonunions? Michael P. Palmer, MD,* Daniel T. Altman, MD,† Gregory T. Altman, MD,‡§ Jeffrey J. Sewecke, DO,‡k Garth D. Ehrlich, PhD,¶** Fen Z. Hu, PhD,¶** Laura Nistico, PhD,¶ Rachel Melton-Kreft, BSN,¶ Trent M. Gause, III, BS,†† and John W. Costerton, PhD¶
Objectives: To identify the presence of bacterial biofilms in
cultures to detect biofilms and bacteria previously exposed to antibiotic therapy.
nonunions comparing molecular techniques (multiplex polymerase chain reaction and mass spectrometry, fluorescent in situ hybridization) with routine intraoperative cultures.
Key Words: nonunion, infection, biofilm, Ibis, PCR, fracture, molecular diagnostics
Methods: Thirty-four patients with nonunions were scheduled for
Level of Evidence: Diagnostic Level I. See Instructions for Authors for a complete description of levels of evidence.
surgery and enrolled in this ongoing prospective study. Intraoperative specimens were collected from removed implants, surrounding tissue membrane, and local soft tissue followed by standard culture analysis, Ibis’s second generation molecular diagnostics (Ibis Biosystems), and bacterial 16S rRNA-based fluorescence in situ hybridization (FISH). Confocal microscopy was used to visualize the tissue specimens reacted with the FISH probes, which were chosen based on the Ibis analysis.
Results: Thirty-four patient encounters were analyzed. Eight were diagnosed as infected nonunions by positive intraoperative culture results. Ibis confirmed the presence of bacteria in all 8 samples. Ibis identified bacteria in a total of 30 of 34 encounters, and these data were confirmed by FISH. Twenty-two of 30 Ibis-positive samples were culture-negative. Four samples were negative by all methods of analysis. No samples were positive by culture, but negative by molecular techniques. Conclusions: Our preliminary data indicate that molecular diagnostics are more sensitive for identifying bacteria than cultures in cases of bony nonunion. This is likely because of the inability of Accepted for publication November 19, 2013. From the *Department of Orthopaedic Surgery, Allegheny General Hospital, Pittsburgh, PA; †Department of Orthopaedic Surgery, Allegheny General Hospital, Drexel University College of Medicine and Temple University School of Medicine, Pittsburgh, PA; ‡Division of Orthopaedic Trauma, Allegheny General Hospital, Pittsburgh, PA; §Department of Orthopaedic Surgery, Temple University School of Medicine, Pittsburgh, PA; kDepartment of Orthopaedic Surgery, Drexel University College of Medicine, Pittsburgh, PA; ¶Center for Genomic Sciences, Allegheny-Singer Research Institute, Pittsburgh, PA; **Department of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, PA; and ††Penn State University, State College, PA. Supported by grants from the Orthopedic Trauma Association and Synthes USA. Presented in part at the Orthopedic Trauma Association Annual Meeting, October 2011, San Antonio, TX, and at the American Academy of Orthopaedic Surgeons Annual Meeting, February 2012, San Francisco, CA. Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions this article on the journal’s Web site (www.jorthotrauma.com). The authors report no conflict of interest. G. D. Ehrlich has received grant money from Abbott (who purchased Ibis Biosciences) for other projects totaling ;$100K. None of this money was used to fund the current study. Reprints: Michael P. Palmer, MD, 1307 Federal St, 2nd Floor, Pittsburgh, PA 15212 (e-mail: [email protected]). Copyright © 2013 by Lippincott Williams & Wilkins
384
| www.jorthotrauma.com
(J Orthop Trauma 2014;28:384–390)
INTRODUCTION Nonunion of long bone fractures is a devastating complication with rates that vary depending on fracture severity and location.1 The rates of delayed union and nonunion are higher in open fractures and in patients with certain comorbidities such as smoking, obesity, diabetes mellitus, and peripheral vascular disease.2 Many factors are involved in nonunion, and combinations of factors have been noted. Instability can predispose to microbial infection, as evidenced in controlled animal studies.3 The use of internal fixation devices provides optimal stability but these inert biomaterials may, with avascular bone, provide an optimal environment around which bacterial infections can develop. However, the true extent to which the presence of bacteria precludes normal bony healing is unknown. Direct examination of failed implants4,5 and of bone from nonunions6 has shown that the bacteria on these biomaterials and in these tissues form slimy matrix-enclosed communities called biofilms. This mode of growth puts the bacteria involved in nonunions in the category of “biofilm pathogens,” as defined by Costerton et al.7 Systemic antibiotic therapy may be of limited use when combating a biofilm infection because biofilms have been shown to be resistant to concentrations of antibiotics 100–1000 times higher than those needed to kill their planktonic (free-swimming) counterparts.8,9 Biofilm infections are difficult to detect and identify using conventional culture techniques,10,11 yet cultural techniques are traditionally the only methodology that has been used to detect bacteria in nonunions. This raises the possibility that some nonunions assumed to be sterile, because of negative cultures, may actually be infected with a biofilm. If this is true, it is possible that treatment could be more effective if surgical debridement was combined with antibiotic therapy to target such previously undetected organism(s). New multiplex polymerase chain reaction–mass spectroscopic methods, developed by the Defense Advanced Research Projects J Orthop Trauma Volume 28, Number 7, July 2014
J Orthop Trauma Volume 28, Number 7, July 2014
Agency (DARPA) to counter bacterial bioterrorist weapons, are now being used to detect and identify any and all bacteria present in clinical specimens.11–13 In this study, we compared culture techniques to this DNA-based multiplex PCR–MS system (Ibis Biosystems, Carlsbad, CA), with respect to their sensitivity, in detecting and identifying bacteria, in 34 consecutive cases of surgical intervention for nonunion of long bone fractures.
MATERIALS AND METHODS Thirty-four consecutive patients were consented and enrolled in this ongoing IRB-approved prospective study. All patients were treated by 1 of 3 senior authors at a level 1 trauma center. The senior authors were blinded to the results of the molecular testing because the Ibis technology is not FDA approved for clinical diagnostic use. Nonunion was selected as a model because it provides a readily available source of removed implants and debrided tissue to study during the course of routine care. A nonunion was defined as radiographic evidence of nonprogression of healing for at least 3 months, or lack of healing by 9 months since the initial injury.14,15 Infection was suspected based on clinical examination (pain, swelling, erythema, warmth, draining sinus) but confirmed by positive intraoperative cultures. Administration of antibiotics was delayed until after intraoperative samples were collected, unless the patient was systemically ill. During surgery, the explanted hardware and specimens of local soft tissue and “membrane” (slimy amorphous accretions in the area of the nonunion) were collected aseptically and sent for analysis. Specimens were collected from the area immediately surrounding the hardware to be removed, with the exact location for each sample being chosen at the surgeons’ discretion. All specimens were analyzed separately by routine microbiological culture methods and Gram stain in the hospital’s onsite laboratory. Samples were also analyzed by the Ibis T-5000 multiplex PCR–MS system, and these results were independently confirmed by fluorescence in situ hybridization (FISH). Clinicians were blinded to the Ibis and the FISH data until after the expiration of the IRB mandate.
Gram Stain and Wound Cultures Wound cultures were collected intraoperatively using swabs to sample the immediate area surrounding the nonunion. After sampling the deepest portion of the wound, the swabs were replaced into the holder, placed into a biohazard bag, and transported immediately to the on-site laboratory. If a tissue sample was taken at the same time to be cultured, it was collected in a sterile container, placed in a biohazard bag, and transported immediately to the onsite laboratory. Routine wound cultures collected on a swab were used to inoculate blood agar plates (BAP), choclate agar plates (CHOC), MacConkey plates (MAC), and Columbia Colistin– Nalidix acid agar (CAN). A Gram stain was made next by rolling the other swab on a glass slide to make a thin film. The agar plates were then incubated in 5% CO2 at 358C. The tissue samples collected for culture, and Gram stain were first cut with a sterile scalpel to make a touch prep for Gram stain. The rest of the tissue was placed into a sterile disposable Ó 2013 Lippincott Williams & Wilkins
Intraoperative Culture Results in Nonunions
tissue grinder. The same plates were inoculated as previously stated for the wound swabs with the addition of thioglycollate media (THIO). The BAP and CHOC were incubated in 5% CO2 at 358C, and the MAC and THIO were incubated in the aerobic incubator at 358C. All slides made for Gram stain were examined for cells and bacteria under the oil immersion objective. Any polymorphonuclear leukocytes and mononuclear cells were reported. Any organisms seen were reported and quantified numerically. The incubated cultures (both agar plates and broth) were examined at 24 hours. If there was no growth on plates or in broth, they were incubated for an additional 24 hours. After day 2, if no growth was seen in broth or plates, the plates were discarded and reported as “no growth day 2” and the THIO were placed in the rack for an additional 3 days. The THIO was examined every 24 hours until 5 days, and if no growth was found “no growth day 5” was reported. If growth was seen on plates after first 24 hours, then the sample was reincubated on plates and in broth for an additional 24 hours. All significant isolates were reported on day 2, and any relevant plates were saved until day 5. If there was no growth on the plates, but growth in THIO, the THIO was Gram stained and subcultured on appropriate plates based on the findings. All plates were followed until day 5 and then disposed.
Ibis Technology One cubic millimeter biopsies collected from the immediate area surrounding the nonunion were placed into a sterile microcentrifuge tubes containing 270 mL of ATL lysis buffer (cat# 19076; Qiagen, Germantown, MD) and 30 mL proteinase K (cat# 19131; Qiagen). Samples were incubated at 568C until lysis of the material was noted by visual inspection (typically ;12 hours). One hundred microliters of a mixture containing 50 mL each of 0.1 mm and 0.7 mm Zirconia beads (cat# 11079101z and 11079107zx, respectively; Biospec) were added to the samples, which were then homogenized for 10 minutes at 25 Hz using a Qiagen Tissuelyser. Nucleic acids from the lysed sample were then extracted using the Qiagen DNeasy Tissue kit (cat# 69506; Qiagen). Ten microliters of each sample was loaded per well (16 wells/specimen) onto Ibis BAC detection PCR plates (cat# PN 05N13-01; Abbott Molecular). The BAC detection plate is a 96-well plate, which uses 16 separate PCRs for each sample to comprehensively (available at www.ibisbiosciences.com) survey all bacterial species, several important antibiotic resistance genes, and Candidal species. This is accomplished by using a combination of (1) domain-based omnipresent loci (eg, 16S and 18S rDNA), (2) various phyla/class-specific genes; and (3) pathogen-specific genes for key species of interest (eg, The Staphylococcusspecific tufB gene). An internal calibrant consisting of a synthetic nucleic acid template is also included in each well of each assay, controlling for false negatives (eg, from PCR inhibitors) and providing for quantitation of signal. PCR amplification was carried out as per Jiang and Hofstadtler.16 The PCR products were then desalted in a 96-well plate format and sequentially electrosprayed into a time-of-flight mass spectrometer. The Ibis technology can detect any bacterial genome that exceeds www.jorthotrauma.com |
385
J Orthop Trauma Volume 28, Number 7, July 2014
Palmer et al
1%–2% of the total bacterial population, and it identifies the cognate species by comparing the calculated base ratio with a database covering thousands of species.12 The inclusion of an internal calibrant provides a quantitative determination of the number of copies of any bacterial gene in the sample, which is expressed as “genomes per well.” All samples in which Staphylococcus epidermidis or P. acnes were found to contain ,10 genomes per well were excluded as potentially representing skin contaminants. However, all other species were recorded and considered significant. Currently, it takes 6–8 hours to complete a sample analysis with the Ibis. All Ibis-positive cases with suitable samples were then subjected to fluorescence in situ hybridization (FISH) using 16S RNA probes corresponding to the bacterial species identified by the Ibis as a confirmatory method. There were 3 cases where the tissue samples were insufficient to perform FISH.
FISH Technology Fluorescence in situ hybridization (FISH) analysis of the samples was carried out as previously described.17 Briefly, specimens were fixed in 4% para-formaldehyde, then washed 3 times with PBS, and stored at 2808C in 1:1 ethanol/PBS until processed. The bacterial cells were permeabilized and hybridized with FISH probes as described by Nistico et al.17 The FISH stained tissue was then mounted and imaged by confocal laser scanning microscopy. Probes used to perform FISH on any given sample were selected based on the Ibis or culture results and corresponded to species-specific, genusspecific, or “universal” eubacterial probes. A list of probes used in this study can be seen in Table 1.
RESULTS The culture and Ibis data for 34 patients with long bone nonunions were extracted (Table 2). There were 17 men and 17 women. The average age of the patients was 49 years (range, 18–71). The average body mass index of the patients was 29.1 kg/m2 (range, 20.4–46.9). The location and frequency of fractures were as follows: 19 tibiae (12 open) (OTA, 41–43), 12 femora (1 open) (OTA, 31–33), 3 humeri (1 open) (OTA, 12–13). Thirteen patients were smokers, 13 had hypertension, 8 had diabetes mellitus, 3 had hyperthyroidism, 3 had lung disease (OSA, COPD), 3 were being treated for depression, and 1 was HIV positive. The average time from initial injury to enrollment in this study was 10 months.
Of 34 patients with nonunions, 8 were culture positive (23.5%). Cultures grew 1 bacterium in 7 of 8 (87.5%) of the cases and multiple bacteria in 1 of 8 (12.5%). The cultures were positive for Staphyloccocus aureus in 4 patients (50%), coagulase-negative Staphylococci in 2 patients (25%), Pseudomonas aeruginosa in 1 patient (12.5%), and 1 patient (12.5%) grew both S. aureus and P. aeruginosa. When comparing nonunions secondary to open fractures (14 patients) to closed (20 patients) fractures, there were 4 culture-positive patients in the open fracture group (28.5%) and 4 of the closed fractures were culture positive (20%). The cultures from the open fracture nonunions grew S. aureus in 2 cases, P. aeruginosa in 1 case, and S. aureus and P. aeruginosa together in 1 case. The positive cultures from the closed fractures grew S. aureus in 2 cases and coagulase-negative staphylococcus in 2 cases. Ibis identified bacterial DNA in at least 1 sample (soft tissue or membrane swab) in 30 of 34 cases (88%). Ibis identified multiple bacteria in 21 of 34 cases (62%). The most common bacterium found was S. aureus (14 cases, 41%), followed by P. acnes (9 cases, 26%), S. epidermidis (6 cases, 17%), Treponema denticola (7 cases, 21%), Streptococcal species (2 cases, 6.6%), Enterococcal species (4 cases, 12%), P. aeruginosa (1 case, 3.3%), Acinetobacter species (1 case, 3.3%), and other Staphylococcal species in 6 cases (17%). Ibis and FISH (using the generic eubacterial probe) were negative in 4 samples (4 cases, 11.7%). There was 1 discrepancy between Ibis and culture results. In Table 2, Encounter 26, methicillin-resistant Staphylococcus aureus grew by culture, and Enterococcus faecalis was detected by Ibis and confirmed by FISH. The use of FISH probes targeted against the species or genus identified by the Ibis data confirmed their presence in 26 of 26 cases and the general 338 Eubacterial probe in 3 of 3 cases. In 2 cases where Ibis and cultures were negative, FISH was performed using the generic EUBAC338 probe, which will hybridize with any bacterial 16S sequence, and both were found to be negative. In 3 cases, insufficient samples were collected for FISH analysis (see Figure 1, Supplemental Digiatal Content 1, http://links.lww.com/BOT/A154).
DISCUSSION Surgeons confronted with long bone nonunions can search for mechanical causes for the failure to heal, but a microbiological etiology is difficult to establish unless there
TABLE 1. Probes Used for Fluorescence In Situ Hybridization (FISH) Probe Name
Intended Target Organisms
Sequence (50 –.30 )
EUB338 NONEUB338 Str Sau Sta TRE II ENF 191 PseaerA PAC 16S 598
Many Eubacteria None (control) Streptococcus sp. S. aureus Staphylococcus sp. (+Acinetobacter and few others) T. denticola E. faecalis P. aeruginosa P. acnes
GCT GCC TCC CGT AGG AGT ACT CCT ACG GGA GGC AGC CAC TCT CCC CTT CTG CAC GAA GCA AGC TTC TCG TCC G TCC TCC ATA TCT CTG CGC GCTCCTTTCCTCATTTACCTTTAT GAAAGCGCCTTTCACTCTTATGC TCT CGG CCT TGA AAC CCC GCC CCA AGA TTA CAC TTC CG
386
| www.jorthotrauma.com
Reference 39 40 41 42 41 43 44 45 46
Ó 2013 Lippincott Williams & Wilkins
J Orthop Trauma Volume 28, Number 7, July 2014
Intraoperative Culture Results in Nonunions
TABLE 2. Patient Data With Microbiological and Molecular Diagnostic Results Encounter
Age
Sex
63
49
Male
76
51
95 57
Hardware Removed
Open/ Closed
Fx Site
Culture
IBIS Tissue
IBIS Membrane
FISH
Closed
Tibia
neg
S. aureus
S. aureus
S. aureus
Male
Titanium plate, screws Titanium IM rod
Closed
Femur
neg
S. aureus, MecA
S. aureus
23 55
Male Male
Titanium IM rod Titanium IM rod
Closed Closed
Femur Tibia
neg neg
S. aureus S. aureus, P. acnes
S. aureus, MecA neg S. aureus
26
39
Female
Titanium IM rod
Closed
Femur
MRSA
neg
E. faecalis
64
69
Female
Closed
Femur
MSSA
S. aureus
S. aureus
28
18
Male
Titanium IM rod, titanium plate, screws Titanium IM rod
Open
Tibia
P. aeruginosa, MSSA
S. aureus, MecA
105
24
Female
Titanium IM rod
Open
Tibia
MRSA
neg
22
68
Female
Open
Tibia
neg
S. epidermidis, MecA
44
63
Female
Stainless steel plate, screws Titanium IM rod
S. aureus, MecA, T. denticola S. epidermidis, S. aureus N/A
Closed
Tibia
neg
51
61
Female
Stainless steel plate, screws
Closed
Humerus
neg
58
52
Male
Closed
Femur
neg
59
70
Female
Titanium solid IM nail Stainless steel wire
Closed
Tibia
61
70
Female
Titanium IM rod
Closed
Tibia
101
70
Female
Titanium IM rod
Closed
Tibia
Coag-neg staph Coag-neg staph neg
S. warneri, B. vesicularis S. epidermidis, S. capitis, S. simulans S. epidermidis, S. lugdunensis S. epidermidis
102
70
Male
Titanium IM rod
Closed
Femur
neg
48
35
Male
Titanium IM rod
Open
Tibia
P. aeruginosa
45
61
Female
Closed
Humerus
50
61
Female
Stainless steel plate, screws Stainless steel plate, screws
Open
72
31
Female
97
66
Female
87
50
Male
38
55
Male
99 103 94
21 34 47
Male Male Female
Stainless steel plate, screws Titanium plate, screws Stainless steel plate, screws Stainless steel plate, screws Titanium IM rod Titanium IM rod Stainless steel plate, screws
67
58
Male
Titanium IM rod
S. aureus Staph genus, P. acnes 338 Eubacterial probe S. aureus
S. aureus
Staph genus Streptococcus
S. aureus
Streptococcus
neg
Streptococcus
S. epidermidis
Streptococcus
B. subtile
Streptococcus
S. epidermidis
Streptococcus
S. agalacticae
Streptococcus Streptococcus
neg
P. aeruginosa, L. reuteri, T. denticola T. denticola
S. sobrinus, E. faecalis P. aeruginosa, L. delbrueckii E. faecalis
Tibia
neg
E. faecalis
S. aureus
Closed
Tibia
neg
P. acnes
Closed
Femur
neg
P. acnes, S. aureus
T. denticola, S. aureus S. aureus
Open
Tibia
neg
P. acnes
P. acnes
Open
Tibia
neg
P. acnes, T. denticola
Open Open Open
Tibia Tibia Tibia
neg neg MRSA
P. acnes N/A P. acnes, S. aureus
Closed
Tibia
neg
neg P. acnes P. acnes, S. aureus, MecA, Lactobacillus sp. neg
P. acnes, T. denticola P. acnes P. acnes S. aureus, MecA T. denticola
T. denticola
S. epidermidis, S. lugdunensis, MecA S. epidermidis, S. bovis S. pneumoniae
P. aeruginosa
E. faecalis S. aureus, 338 eubacterial probe P. acnes, T. denticola 338 Eubacterial probe P. acnes P. acnes
(continued on next page )
Ó 2013 Lippincott Williams & Wilkins
www.jorthotrauma.com |
387
J Orthop Trauma Volume 28, Number 7, July 2014
Palmer et al
TABLE 2. (Continued ) Patient Data With Microbiological and Molecular Diagnostic Results Hardware Removed
Open/ Closed
Female
Stainless steel plate, screws
Closed
Femur
neg
T. denticola
S. aureus
30
Female
Titanium IM rod
Open
Tibia
neg
neg
6
37
Male
Titanium IM rod
Open
Tibia
neg
4 5
61 68
Female Female
Closed Closed
Femur Femur
neg neg
neg neg
338 Eubacterial probe N/A neg
14 17
39 28
Male Female
Titanium IM rod Stainless steel plate, screws Titanium IM rod Stainless steel screws
A. capsulatus, S. pneumoniae neg neg
S. aureus, T. denticola, P. acnes neg
Open Open
Femur Femur
neg neg
neg neg
neg neg
neg N/A
Encounter
Age
Sex
73
45
74
Fx Site
Culture
IBIS Tissue
IBIS Membrane
FISH 338 Eubacterial probe, S. aureus T. denticola
Patients are grouped by the most common bacterial species found in the samples by the IBIS. neg, negative result; N/A, not enough tissue was sampled to perform the test; MSSA, methicillin-sensitive S. aureus; MRSA, methicillin-resistant S. aureus; MecA, methicillin resistance gene.
is a draining sinus tract or a positive culture of an intraoperative specimen.18 Intraoperative cultures are the gold standard for diagnosing infection. Unfortunately, these methods have variable and often inadequate sensitivity and specificity.7,10,19 Multiple surgical strategies are available when undertaking surgical repair of nonunions. A significant improvement in the detection and identification of bacteria and of specific antibiotic resistance genes would add another powerful tool to aid in the treatment of fracture nonunions.11,12,20 Cultures recover bacteria with very poor sensitivity but with good specificity, and this problem is compounded by biofilm infections7 such as otitis media21,22 and prostatitis23 because bacteria growing in this communal phenotype rarely grow when plated on agar surfaces. The DNA-based molecular methods that have replaced cultures in the analysis of bacterial populations in most natural and industrial ecosystems are not universally accepted in medicine. Molecular diagnostic methods are currently labor intensive and expensive.24 PCR-based methods have been slowly introduced into clinical use for the detection of prosthetic joint infections.25–27 However, the limitation of single-primer PCR is that it can only detect 1 target organism. At our institution, Stoodley et al4 in 2008 demonstrated a S. aureus biofilm by PCR and FISH on a total elbow prosthesis that was repeatedly culture-negative for several years despite suspected clinical infection. We reported a case study of a tibial nonunion that was culture-negative but shown to have an intramedullary polymicrobial biofilm with molecular techniques.13 In this study, 34 patients had been scheduled for surgery because of a long bone nonunion. Intraoperative specimens yielded positive cultures in 8 of 34 cases, and parallel specimens showed the presence of bacteria by the Ibis technology in 30 of 34 cases. Routine cultures identified bacteria in only 8 of 30 positive samples (27%) compared with molecular technologies. Looking at both culture-positive
388
| www.jorthotrauma.com
and culture-negative samples, routine culture results were confirmed in 12 of 34 cases (35%) also analyzed by Ibis and FISH. The high degree of sensitivity and specificity of the Ibis system is attested by the fact that it detected the same organism found by culture in 8 of 8 cases and that FISH probes reacted with the predominant organism found by the Ibis in at least 1 specimen in 29 of 29 (100%) cases. Our molecular findings in this study indicate that many of the infections associated with bony nonunion result from a polymicrobial process. This is consistent with what has been observed for multiple other chronic infections. Since the introduction of non-biased molecular diagnostic modalities, many microbially complex infectious etiologies have been observed, including chronic and recurrent otitis media22; adenoiditis,28 surgical site infections,29 infected arthroplasties30; and chronic nonhealing venous insufficiency wounds.31 Thus, it is likely that the majority of chronic infections result from the establishment of wound-specific infectious ecologies, each with its own interacting microbiome wherein the various species and strains present within the microbial community not only compete but in many cases protect and provide nutrients for one another.32 There has been reported concern for oversensitivity of molecular-based techniques regarding clinical relevance.27 The Ibis detects bacteria that are present at .1% of the overall microbial burden,12 and previous studies support the supposition that these bacteria are alive as dead bacteria and bacterial DNA are rapidly cleared by the body.22 Moreover, the universal finding in this study of nonunions that FISH confirms the Ibis results strongly indicates that the bacteria present are invested in the tissues in question. Preparing samples for FISH is a relatively harsh procedure during which a majority of biofilm is actually washed away, leaving behind only a small portion of the initial biofilm, which must be strongly adherent to the host tissue.22,27 The fact that we have been able to confirm the presence of biofilms imbedded in Ó 2013 Lippincott Williams & Wilkins
J Orthop Trauma Volume 28, Number 7, July 2014
tissue and hardware with FISH strengthens the argument for the accuracy of the Ibis. Orthopaedic surgeons must understand that many bacteria exist in a biofilm state and are thus difficult to culture. Our understanding of biofilms and their role in orthopaedic infections is evolving. Molecular techniques are becoming more available and promising in the diagnosis of infection in the face of negative cultures. A potential weakness of the study is the limited size and observational nature of the study. Preoperative antibiotics were only given to patients who exhibited signs of systemic infection. This could have negatively affected the ability to obtain positive cultures in these patients.33 We did not perform sonication of the culture samples because this is not a standard practice in routine clinical microbiology.34 Seven cases in our series identified a majority of P. acnes by molecular techniques, but not by culture. We recognize that P. acnes is a very slow growing bacteria in culture and that can take .10 days to grow.35,36 Given this fact, and the prevalence of P. acnes found in our study with the emerging recognition that this bacteria is an orthopaedic pathogen,37,38 all orthopaedic operating room culture samples at our institution are now held for 14 days to increase our ability to identify P. acnes infections. In conclusion, our study demonstrates the improved sensitivity of DNA-based molecular techniques over cultures for bacterial detection in bony nonunion. This is likely because of the inability of cultures to detect bacteria in a biofilm state. ACKNOWLEDGMENTS The authors specially thank Courtney Saltarski, MPH, MID, for her help in preparation of this manuscript. This study is in memory and honor of John William “Bill” Costerton, PhD. REFERENCES 1. Tzioupis C, Giannoudis PV. Prevalence of long-bone non-unions. Injury. 2007;38(suppl 2):S3–S9. 2. Cierny G III, Mader JT, Penninck JJ. A clinical staging system for adult osteomyelitis. Clin Orthop Relat Res. 2003;414:7–24. 3. Merritt K, Dowd JD. Role of internal fixation in infection of open fractures: studies with Staphylococcus aureus and proteus mirabilis. J Orthop Res. 1987;5:23–28. 4. Stoodley P, Nistico L, Johnson S, et al. Direct demonstration of viable Staphylococcus aureus biofilms in an infected total joint arthroplasty. A case report. J Bone Joint Surg Am. 2008;90:1751–1758. 5. Gristina AG, Costerton JW. Bacterial adherence to biomaterials and tissue. The significance of its role in clinical sepsis. J Bone Joint Surg Am. 1985;67:264–273. 6. Khoury AE, Lam K, Ellis B, et al. Prevention and control of bacterial infections associated with medical devices. ASAIO J. 1992;38:M174– M178. 7. Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science. 1999;284:1318–1322. 8. Nickel JC, Ruseska I, Wright JB, et al. Tobramycin resistance of Pseudomonas aeruginosa cells growing as a biofilm on urinary catheter material. Antimicrob Agents Chemother. 1985;27:619–624. 9. Patzakis MJ, Zalavras CG. Chronic posttraumatic osteomyelitis and infected nonunion of the tibia: current management concepts. J Am Acad Orthop Surg. 2005;13:417–427. 10. Costerton JW. Biofilm theory can guide the treatment of device-related orthopaedic infections. Clin Orthop Relat Res. 2005;437:7–11.
Ó 2013 Lippincott Williams & Wilkins
Intraoperative Culture Results in Nonunions 11. Costerton JW, Post JC, Ehrlich GD, et al. New methods for the detection of orthopedic and other biofilm infections. FEMS Immunol Med Microbiol. 2011;61:133–140. 12. Ecker DJ, Sampath R, Massire C, et al. Ibis T5000: a universal biosensor approach for microbiology. Nat Rev Microbiol. 2008;6:553–558. 13. Palmer MP, Sewecke JJ, Altman DT, et al. Molecular techniques to detect biofilm bacteria in long bone nonunion: a case report. Clin Orthop Relat Res. 2011;469:3037–3042. 14. Bhandari M, Fong K, Sprague S, et al. Variability in the definition and perceived causes of delayed unions and nonunions: a cross-sectional, multinational survey of orthopaedic surgeons. J Bone Joint Surg Am. 2012;94:e1091–e1096. 15. Bhandari M, Guyatt GH, Swiontkowski MF, et al. A lack of consensus in the assessment of fracture healing among orthopaedic surgeons. J Orthop Trauma. 2002;16:562–566. 16. Jiang Y, Hofstadler SA. A highly efficient and automated method of purifying and desalting PCR products for analysis by electrospray ionization mass spectrometry. Anal Biochem. 2003;316:50–57. 17. Nistico L, Gieseke A, Stoodley P, et al. Fluorescence “in situ” hybridization for the detection of biofilm in the middle ear and upper respiratory tract mucosa. Methods Mol Biol. 2009;493:191–213. 18. Toh CL, Jupiter JB. The infected nonunion of the tibia. Clin Orthop Relat Res. 1995;315:176–191. 19. Moussa FW, Anglen JO, Gehrke JC, et al. The significance of positive cultures from orthopedic fixation devices in the absence of clinical infection. Am J Orthop (Belle Mead NJ). 1997;26:617–620. 20. Ehrlich GD, Stoodley P, Kathju S, et al. Engineering approaches for the detection and control of orthopaedic biofilm infections. Clin Orthop Relat Res. 2005;437:59–66. 21. Coates H, Vijayasekaran S. Bacterial biofilm in chronic suppurative otitis media. Otolaryngol Head Neck Surg. 2010;142:778; author reply 778. 22. Hall-Stoodley L, Hu FZ, Gieseke A, et al. Direct detection of bacterial biofilms on the middle-ear mucosa of children with chronic otitis media. JAMA. 2006;296:202–211. 23. Soto SM, Smithson A, Martinez JA, et al. Biofilm formation in uropathogenic Escherichia coli strains: relationship with prostatitis, urovirulence factors and antimicrobial resistance. J Urol. 2007;177:365–368. 24. Hugenholtz P, Goebel BM, Pace NR. Impact of culture-independent studies on the emerging phylogenetic view of bacterial diversity. J Bacteriol. 1998;180:4765–4774. 25. De Man FH, Graber P, Lüem M, et al. Broad-range PCR in selected episodes of prosthetic joint infection. Infection. 2009;37:292–294. 26. Gallo J, Kolar M, Dendis M, et al. Culture and PCR analysis of joint fluid in the diagnosis of prosthetic joint infection. New Microbiol. 2008;31: 97–104. 27. Panousis K, Grigoris P, Butcher I, et al. Poor predictive value of broadrange PCR for the detection of arthroplasty infection in 92 cases. Acta Orthop. 2005;76:341–346. 28. Nistico L, Kreft R, Gieseke A, et al. Adenoid reservoir for pathogenic biofilm bacteria. J Clin Microbiol. 2011;49:1411–1420. 29. Kathju S, Nistico L, Hall-Stoodley L, et al. Chronic surgical site infection due to suture-associated polymicrobial biofilm. Surg Infect (Larchmt). 2009;10:457–461. 30. Stoodley P, Conti SF, DeMeo PJ, et al. Characterization of a mixed MRSA/MRSE biofilm in an explanted total ankle arthroplasty. FEMS Immunol Med Microbiol. 2011;62:66–74. 31. Tuttle MS, Mostow E, Mukherjee P, et al. Characterization of bacterial communities in venous insufficiency wounds by use of conventional culture and molecular diagnostic methods. J Clin Microbiol. 2011;49: 3812–3819. 32. Ehrlich GD, Ahmed A, Earl J, et al. The distributed genome hypothesis as a rubric for understanding evolution in situ during chronic bacterial biofilm infectious processes. FEMS Immunol Med Microbiol. 2010;59: 269–279. 33. Malekzadeh D, Osmon DR, Lahr BD, et al. Prior use of antimicrobial therapy is a risk factor for culture-negative prosthetic joint infection. Clin Orthop Relat Res. 2010;468:2039–2045. 34. Trampuz A, Piper KE, Jacobson MJ, et al. Sonication of removed hip and knee prostheses for diagnosis of infection. N Engl J Med. 2007;357:654–663. 35. Schlecht S, Freudenberg MA, Galanos C. Culture and biological activity of Propionibacterium acnes. Infection. 1997;25:247–249.
www.jorthotrauma.com |
389
J Orthop Trauma Volume 28, Number 7, July 2014
Palmer et al
36. Marino C, Stoughton RB. Clinical use of a selective culture medium for wild and antibiotic-resistant Propionibacterium acnes. J Am Acad Dermatol. 1982;6:902–908. 37. Dodson CC, Craig EV, Cordasco FA, et al. Propionibacterium acnes infection after shoulder arthroplasty: a diagnostic challenge. J Shoulder Elbow Surg. 2010;19:303–307. 38. Millett PJ, Price CS, Horan MP, et al. Propionibacterium acnes infection as an occult cause of postoperative shoulder pain: a case series. Clin Orthop Relat Res. 2011;469:2824–2830. 39. Amann RI, Binder BJ, Olson RJ, et al. Combination of 16S rRNAtargeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol. 1990;56:1919–1925. 40. Manz W, Amann R, Ludwig W, et al. Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst Appl Microbiol. 1992;15:593–600. 41. Trebesius K, Leitritz L, Adler K, et al. Culture independent and rapid identification of bacterial pathogens in necrotising fasciitis and streptococcal
390
| www.jorthotrauma.com
42. 43. 44. 45. 46.
toxic shock syndrome by fluorescence in situ hybridisation. Med Microbiol Immunol. 2000;188:169–175. Kempf VA, Trebesius K, Autenrieth IB. Fluorescent in situ hybridization allows rapid identification of microorganisms in blood cultures. J Clin Microbiol. 2000;38:830–838. Moter A, Leist G, Rudolph R, et al. Fluorescence in situ hybridization shows spatial distribution of as yet uncultured treponemes in biopsies from digital dermatitis lesions. Microbiology. 1998;144:2459–2467. Wellinghausen N, Kochem AJ, Disqué C, et al. Diagnosis of bacteremia in whole-blood samples by use of a commercial universal 16S rRNA genebased PCR and sequence analysis. J Clin Microbiol. 2009;47:2759–2765. Hogardt M, Trebesius K, Geiger AM, et al. Specific and rapid detection by fluorescent in situ hybridization of bacteria in clinical samples obtained from cystic fibrosis patients. J Clin Microbiol. 2000;38:818–825. Poppert S, Riecker M, Essig A. Rapid identification of Propionibacterium acnes from blood cultures by fluorescence in situ hybridization. Diagn Microbiol Infect Dis. 2010;66:214–216.
Ó 2013 Lippincott Williams & Wilkins
