Gene 538 (2014) 235–243

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Calcium–calmodulin dependent protein kinase I from Macrobrachium nipponense: cDNA cloning and involvement in molting Huaishun Shen a,b,⁎, Yacheng Hu a,b, Yuanqin Zhang a,b, Xin Zhou a, Zenghong Xu a a Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, PR China b Wuxi Fisheries College, Nanjing Agricultural University, Nanjing 210095, PR China

a r t i c l e

i n f o

Article history: Accepted 20 January 2014 Available online 31 January 2014 Keywords: Macrobrachium nipponense Calcium–calmodulin-dependent protein kinase I Molting Eyestalk ablation dsRNA-mediated RNA interference

a b s t r a c t Calcium–calmodulin dependent protein kinase I is a component of a calmodulin-dependent protein kinase cascade and involved in many physiological processes. The full-length cDNA of calcium–calmodulin dependent protein kinase I (MnCaMKI) was cloned from the freshwater prawn Macrobrachium nipponense and its expression pattern during the molt cycle and after eyestalk ablation is described. The full-length cDNA of MnCaMKI is 3262 bp in length and has an open reading frame (ORF) of 1038 bp, encoding a 345 amino acid protein. The expression of MnCaMKI in three examined tissues was upregulated in the premolt stage of the molt cycle. Its expression was induced after eyestalk ablation (ESA): the highest expression level was reached 1 day after ESA in hepatopancreas, and 3 days after ESA in muscle. By dsRNA-mediated RNA interference assay, expression of MnCaMKI and ecydone receptor gene (MnEcR) was significantly decreased in prawns treated by injection of dsMnCaMKI, while expression of these two genes was also significantly decreased in prawns treated by injection of dsMnEcR, demonstrating a close correlation between the expression of these two genes. These results suggest that CaMKI in M. nipponense is involved in molting. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Calcium ions (Ca2+) are important intracellular second messengers that regulate diverse cellular responses (Cheung, 1980; Means and Dedman, 1980). Ca2+ acts mainly through calmodulin (CaM), an important 17 kd calcium-sensor protein found in all eukaryotes (Ji et al., 2011). Calcium–calmodulin complexes bind Ca2+ responsive proteins, which in turn transmit signals to downstream targets. Over 50 calcium–calmodulin binding proteins have been identified, including kinases, phosphatases, nitric-oxide synthase, numerous receptors, ion channels, G-coupled proteins and transcription factors (Bachs et al., 1994; Crivici and Ikura, 1995; Cyert, 2001; Gao et al., 2009; Vogel, 1994). Among these calcium–calmodulin binding proteins, calcium–calmodulin dependent protein kinase I (CaMKI) serves as a component of a calmodulin-dependent protein kinase cascade and is involved in many physiological processes and expressed in many tissues. CaMKI regulates transcriptional activator activity

Abbreviations: MnCaMKI, Calcium–calmodulin dependent protein kinase I from Macrobrachium nipponense; MnEcR, ecydone receptor from Macrobrachium nipponense; RXR, retinoid-X receptor. ⁎ Corresponding author at: Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, PR China. Fax: +86 510 85551474. E-mail address: [email protected] (H. Shen). 0378-1119/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2014.01.055

(Condon et al., 2002), the cell cycle (Kahl and Means, 2004), cell differentiation (McKinsey et al., 2000), actin filament organization and neurite outgrowth (Saneyoshi et al., 2008; Uboha et al., 2007). Human CaMKI contains an autoinhibitory segment (residues 286–307) and an overlapping CaM-binding segment (residues 303–316) in the Cterminal regulatory region (Haribabu et al., 1995; Yokokura et al., 1995). CaM binds human CaMKI, relieving its autoinhibition and allowing phosphorylation of Thr-177 within the activation loop by CaMKK1 or CaMKK2 (Haribabu et al., 1995; Matsushita and Nairn, 1998). Phosphorylation of Thr-177 results in a several-fold increase in the total activity of CaMKI. Several substrates of CaMKI have been identified, including two synaptic vesicle-associated proteins (synapsins 1 and 2) (Nairn and Greengard, 1987); the cAMP response element-binding protein (CREB) (Sheng et al., 1991); and glial cell missing 1 (GCM1) (Chang et al., 2011). In these substrates, CaMKI recognizes a consensus sequence Hyd-X-Arg-X-X-Ser/Thr-XX-X-Hyd, in which Hyd is a hydrophobic residue (Lee et al., 1994). In arthropods, molting is the physiological process of removing the old exoskeleton and building a new exoskeleton, and is indispensable for development, growth and metamorphosis (Chang and Mykles, 2011). Ecdysteroids are major positive steroid hormone regulators of molting. They are secreted by the Y-organs. This synthesis is inhibited by molting inhibiting hormone (MIH), a member of a neuropeptide family produced by the X-organ/sinus gland complex in the eyestalk (Covi et al., 2009). Unilateral or bilateral surgical eyestalk removal relieves the suppression by MIH and leads to enhanced ecdysteroid

236

H. Shen et al. / Gene 538 (2014) 235–243

secretion by Y-organs and eventually molting (Kim et al., 2005; McDonald et al., 2011; Uawisetwathana et al., 2011). Chen and Watson (2011) and Chen et al. (2012) have hypothesized that a calcium signal positively regulates molting. Eyestalk ablation produces an increase in free Ca2+ that is associated with an increase in the hemolymphatic ecdysteroid titer (Chen and Watson, 2011). During a natural molting cycle, the overall pattern of Ca2 + levels is similar to the observed ecdysteroid titer, which is elevated in the premolt stage and rapidly downregulated in the postmolt stage (Chen et al., 2012). The plasma membrane Ca2+ ATPase (PMCA) pump exports Ca2+ from the cytosol, and its expression in the Y-organs of the blue crab (Callinectes sapidus) is increased in the premolt stage (Chen et al., 2013). The expression levels of other Ca2 + signal-related proteins, such as the sarcoplasmic calcium-binding protein (SCP) (Gao et al., 2006), cyclic nucleotide phosphodiesterase (PDE) (Nakatsuji et al., 2006), and CaM (Gao et al., 2009), have also been reported to fluctuate over the molt cycle and their function is, therefore, supposed to be associated with molting (White et al., 2011). All these reports support the notion that a calcium signal is closely associated with the molting process, but a definite connection between calcium signaling and molting has yet to be demonstrated. The character and function of CaMKI have predominantly been described in vertebrates. As a step toward understanding CaMKI in invertebrates, we report the first molecular cloning of the full-length CaMKI cDNA from the freshwater prawn Macrobrachium nipponense, and investigate its expression through the molt cycle and after eyestalk ablation.

2. Materials and methods 2.1. Animal preparation, observation of molting stages and eyestalk ablation Freshwater prawns (M. nipponense) 4–5 cm long were collected from Tai Lake, Jiangsu, China, transported alive, grown in tanks with adequate aeration at 15 °C in a 12 h light and 12 h dark photoperiod and fed every day. To collect prawns at different molt stages, the animals were grown individually in glass trays (30 × 20 × 20 cm) in 120 L tanks (10 trays/tank). The molt stages of the female prawns were identified based on the criteria described by Chan et al. (1988) and Cesara et al. (2006). Female prawns in the intermolt stage were selected for the eyestalk ablation experiment, the eyestalks of individual prawns were clipped bilaterally using sterile scissors, and the wound was

cauterized to minimize loss of hemolymph and avoid infection. Intact prawns maintained under the same conditions served as controls (Salma et al., 2012). Samples from different tissues were collected from prawns at 1 and 3 days after eyestalk ablation and intact prawns. All collected samples were rapidly frozen in liquid nitrogen and then stored at −80 °C. 2.2. RNA extraction and cDNA synthesis Total RNA from various tissues was extracted using the TRIzol® Reagent (Invitrogen, USA) according to the manufacturer's protocol. RNA integrity was evaluated by 1.5% agarose gel electrophoresis. The concentrations were measured and the purity of the RNA was determined by use of a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, USA). For all RNA samples, A260/A280 and A260/A230 ratios were in the range 2.0–2.1 and 1.9–2.0, respectively. To obtain firststrand cDNA, 2 μg total RNA was first treated with RQ1 RNase-free DNase (Promega, USA) to avoid genomic DNA contamination, and then reverse transcribed by using M-MLV reverse transcriptase (Promega, USA) according to the manufacturer's instructions. The synthesized cDNA was used as template in subsequent PCRs. 2.3. Full-length cDNA cloning A partial sequence of prawn CaMKI of 1055 bp was identified from the GenBank EST database (Accession no. JK527056.1) (http://www. ncbi.nlm.nih.gov). BLASTX analysis revealed that it was homologous to the human CaMKI protein (Accession no. EAW63993.1), with 75% identity. RACE (5′ and 3′ rapid amplification of cDNA ends) was used to obtain the complete cDNA sequence. Gene-specific 5′ and 3′ primers were designed for RACE PCR based on the MnCaMKI partial sequences. All primers used in this study are listed in Table 1. RACE cDNA was prepared from total RNA of the hepatopancreas of M. nipponense. The 3′-RACE and 5′-RACE were performed using a 3′-Full RACE Core Set Ver.2.0 Kit and 5′-Full RACE Kit (Takara, Japan) according to the manufacturer's instructions. The final products of the 5′ and 3′ RACE PCR reactions were resolved by agarose gel (1.5%) electrophoresis and purified from gel slices using the TianGen DNA Gel Extraction kit (TianGen, China). The purified DNA products were ligated into a pEASY-T1 vector (TransGen, China) and used to transform Escherichia coli TOP 10 competent cells. White colonies, which were the clones with inserted fragments, were selected for sequencing. Finally, the primers, MnCaMKI-ORF-F and MnCaMKI-

Table 1 Primers for PCRs. Primer

Sequence (5′ to 3′)

Primer description

MnCaMKI-5a-Outer MnCaMKI-5a-Inner MnCaMKI-3a-Outer MnCaMKI-3a-Inner Rt-MnCaMKI-F Rt-MnCaMKI-R MnCaMKI-ORF-F MnCaMKI-ORF-R MnCaMKI-ri-555 F MnCaMKI-ri-981R MnEcR-ri-582 F MnEcR-ri-1041R GFP-ri-86 F GFP-ri-656R Rt-MnEcR-F Rt-MnEcR-R MnACTIN-F MnACTIN-R

CCATGATCCCTGAATCTTCCATT TGAGATCCCTATGAACAACTCCC GCAAAGGACTTCATAAGGCAACT TAGCCACAACTACCACCCTCACC AGGCAAGCATACCATGCAAC GGTAGTTGTGGCTAGCGGTG GCTCTTCTGGAGTGCCGTAT AGGAGTGGTGTTGGCCATTG CATGGCTACTGCGTGTGGTA CATTTGGCGGATTACGGCTG GCCTTCTTCTCTCAACGGCT AGGAACTGAAGCACTCGACG CTGTCAGTGGAGAGGGTGAAG ATGTGGTCACGCTTTTCGTTG GATGCGAGCACAGACTCCAT CGGCAGAACTGGAAAATGGC CTCCCTGTACGCCTCCGGTC CTCGCTCGGCGGTGGTAGTG

5′ RACE Primer for first round 5′ RACE Primer for second round 3′ RACE Primer for first round 3′ RACE Primer for second round FWD primer for CaMKI expression RVS primer for CaMKI expression FWD primer for CaMKI ORF RVS primer for CaMKI ORF FWD primer for CaMKI fragment RVS primer for CaMKI fragment FWD primer for EcR fragment RVS primer for EcR fragment FWD primer for GFP fragment RVS primer for GFP fragment FWD primer for EcR expression RVS primer for EcR expression FWD primer for β-ACTIN expression RVS primer for β-ACTIN expression

H. Shen et al. / Gene 538 (2014) 235–243

ORF-R, which were directed at the 5′and 3′ termini of MnCaMKI, were used to amplify and confirm the full ORF of MnCaMKI. The following PCR program was used: denaturation at 94 °C for 3 min, 35 amplification cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1–2 min, and extension at 72 °C for 7 min. 2.4. Sequence alignments and phylogenetic analysis of MnCaMKI The coding sequence of MnCaMKI was identified based on alignments with known full-length CaMKI sequences in the NCBI GenBank database. ExPASy software was used to deduce the amino acid sequence of MnCaMKI (http://www.expasy.org/). The full amino acid sequence of M. nipponense CaMKI was aligned with those of six other species, derived from the NCBI GenBank database: CgCaMKI from Crassostrea gigas (Accession Number: EKC29392.1), DmCaMKI from Drosophila melanogaster (NP_726571.2), DpCaMKI from Daphnia pulex (EFX70647.1), DrCaMKI from Danio rerio (NP_001116532.1), HsCaMKI from Harpegnathos saltator (EFN82938.1) and XiCaMKI from Xenopus laevis (AAI10967.1). A neighbor-joining tree was constructed from multiple sequence alignments with 22 other CaMKI protein sequences derived from the GenBank database using the molecular evolutionary genetics analysis (MEGA) software, version 3.1. Bootstrap analysis of 1000 replicates was carried out to determine the confidence of tree branch positions. The names and the accession numbers of the included CaMKI proteins are as follows: Apis mellifera CaMKI (Accession Number: XP_001122959.1); Bombus terrestris CaMKI (XP_003397184.1); Bos grunniens mutus CaMKI (ELR48089.1); Brugia malayi CaMKI (XP_ 001897759.1); C. gigas CaMKI (EKC29392.1); Danaus plexippus CaMKI (EHJ78543.1); Danio rerio CaMKI (NP_001116532.1); D. pulex CaMKI (EFX70647.1); D. melanogaster CaMKI (NP_726571.2); Equus caballus CaMKI (XP_001915538.1); H. saltator CaMKI (EFN82938.1); Homo sapiens CaMKI (NP_003647.1); Loa loa CaMKI (EJD76692.1); Mus musculus CaMKI (AAP31673.1); Myotis davidii CaMKI (ELK34345.1); Oncorhynchus mykiss CaMKI (NP_001118110.1); Oreochromis niloticus CaMKI (XP_003444037.1); Ornithorhynchus anatinus CaMKI (XP_ 001506792.2); Oryzias latipes CaMKI (XP_004069971.1); Otolemur garnettii CaMKI (XP_003785503.1); Ovis aries CaMKI (XP_004014705.1); Pongo abelii CaMKI (XP_002813519.1); Salmo salar CaMKI (ACI3 3636.1); Taeniopygia guttata CaMKI (XP_002186833.1); Takifugu rubripes CaMKI (XP_003967700.1); Tribolium castaneum CaMKI (XP_ 967941.2); Trichechus manatus latirostris CaMKI (XP_004368364.1); X. laevis CaMKI (AAI10967.1). 2.5. Quantification of MnCaMKI transcripts by real-time PCR Relative expression levels of MnCaMKI mRNA were detected using a quantitative real-time PCR assay by the ABI 7500 System. The expression of the M. nipponense beta-actin gene (Accession Number: JK526420) was selected as an endogenous control, using the forward primer MnACTIN-F and the reverse primer MnACTIN-R, because it is widely used as an endogenous control in M. nipponense research (Ma et al., 2013; Wang et al., 2012; Zhang et al., 2011). The primers RtMnCaMKI-F and Rt-MnCaMKI-R were designed to detect the expression of MnCaMKI. PCR products of both primer pairs were 100–250 bp in length. PCR products of the expected sizes were sequenced to confirm specificity. The real-time PCR program was 40 cycles of 95 °C for 10 s, 60 °C for 20 s and 72 °C for 34 s. PCR reactions were performed in triplicate for each sample, and the expression levels were normalized to that of the beta actin gene. All the primers used are listed in Table 1. 2.6. RNA interference assay A 427 bp PCR fragment of MnCaMKI and a 463 bp PCR fragment of MnEcR were separately cloned in plasmid pEASY-BLUNT Zero. Simultaneously, a 571 bp GFP gene fragment was amplified from PRTL2-

237

mGFPS65T vector and cloned in plasmid pEASY-BLUNT Zero. All the primers used are listed in Table 1. The nucleotide sequences of the inserted fragments and their orientation were confirmed by automated DNA sequencing. Single-stranded RNA was transcribed in vitro from the linearized plasmid constructs with fragments inserted in reverse orientation using T7 RNA polymerase (Promega). The DNA template was then degraded by addition of DNase I (Promega). Equimolar amounts of complementary single-stranded RNA transcripts were then mixed and annealed by incubation at 70 °C for 5 min and gradually cooling to room temperature. The formation of dsRNA was monitored by determining the size shift in agarose gel electrophoresis, and the concentration of dsRNA was measured spectrophotometrically. The female prawns in the intermolt stage (C), about 4–5 cm long were selected for use in the dsRNA interference assay. dsRNAs for MnCaMKI (dsMnCaMKI) and MnEcR (dsMnEcR) were separately injected into the hemolymph of each prawn. A total of 15 healthy prawns were divided into 3 groups: the dsMnCaMKI, dsMnEcR and dsGFP groups. The injection volume for each prawn was 20 μL, with 10 μg dsRNA. The dsGFP group was treated by injection of 10 μg GFP dsRNA and was used as the control. The injection was performed using a 50 μL syringe with 22 s gauge needle. At 48 h post injection, the hepatopancreas of each prawn was collected, frozen and powdered for RNA extraction. cDNA was synthesized from the total RNA using M-MLV reverse transcriptase (Promega) according to the manufacturer's instructions. 3. Results 3.1. cDNA cloning The 3′ fragment and 5′ fragment of MnCaMKI cDNA were identified by 3′ RACE and 5′ RACE. The full length of the cDNA sequence was determined by combining the 5′ fragment sequences, the 3′ fragment sequence and the partial cDNA sequence of MnCaMKI. The sequence was submitted to the GenBank database (Accession no. KF469224). The resultant full-length MnCaMKI cDNA comprises 3262 bp. The open reading frame (ORF) for MnCaMKI starts with an ATG codon at position 1313 bp and ends at position 2350, yielding an ORF (1038 bp) that encodes a 345 amino acid protein (Fig. 1) of an estimated 39 kDa, with a theoretical pI of 6.2. 3.2. Sequence alignment The MnCaMKI amino acid sequence was aligned with those of six other CaMKIs from human and other species (Fig. 2). The alignment revealed that MnCAMKI has the typical conserved domains of CAMKIs: a catalytic domain adjacent to a C-terminal regulatory region that contains an overlapping autoinhibitory domain (AID) and the CaMbinding domain (CBD) (Fig. 2). The alignment shows that the conserved Thr-177 in human CAMKI that is responsible for activation is present in all of these CaMKIs. MnCaMKI exhibits a relatively high degree of identity with CaMKI proteins from other invertebrates: it shares 81.7% identity with D. plexippus CaMKI, another crustacean, and it shares 79.9% identity with the CaMKI from the insect D. melanogaster. In contrast, MnCaMKI is less similar to CaMKI proteins of the vertebrates, having 67.5% identity with X. laevis CaMKI, 67.0% identity with H. sapiens CaMKI and 62.7% identity with D. rerio CaMKI. 3.3. Phylogenic tree All 23 CaMKIs from the different species including vertebrates and invertebrates were used to construct a phylogenetic tree. These analyses were generally consistent with the results based on sequence similarity. On the whole, the phylogenetic tree of the CaMKI included two big clades: the vertebrate group and the invertebrate group (Fig. 3). In the

238

H. Shen et al. / Gene 538 (2014) 235–243

invertebrate clade, MnCaMKI was first clustered with CaMKI from the crustacean D. pulex, and the clade of the crustacean group was closest to the clade of insects.

3.4. Expression profiles of MnCAMKI in different tissues The real-time PCR was performed to investigate the expression profile of MnCaMKI in nine different tissues of the freshwater prawn M. nipponense. MnCaMKI was expressed in all nine tissues examined. The expression level in hepatopancreas was significantly higher than in other detected tissues (P b 0.01, Student's t-test) (Fig. 4). A high expression level of MnCaMKI expression was also detected in the gills (P b 0.05, student's t-test).

3.5. MnCaMKI expression over the molting cycle We assayed the expression of MnCaMKI in the hepatopancreas, muscles and epidermis of M. nipponense during the molt cycle using real-time PCR. There was a rapid elevation of MnEcR expression in the premolt stage. In the hepatopancreas, the expression level of MnCaMKI in the premolt stage was about 2.7-fold higher than that in the intermolt stage (P b 0.05, Student's t-test), while in muscle MnCaMKI expression was about 5.2-fold higher (P b 0.05, Student's t-test) and in epidermis MnCaMKI expression was about 2.3-fold higher (P b 0.05, Student's t-test) (Fig. 5). After molting, the expression level of MnCaMKI in hepatopancreas and muscles was downregulated rapidly to near the level of expression during the intermolt stage, but the expression level of MnCaMKI remained

Fig. 1. The full-length cDNA sequence of MnCAMKI and deduced amino acid sequence.

H. Shen et al. / Gene 538 (2014) 235–243

239

Fig. 1 (continued).

high, becoming about 2.4-fold higher than that in the intermolt stage in epidermis (P b 0.05, Student's t-test). Thus, MnCaMKI expression is correlated with molt stage. 3.6. Induction of MnCaMKI by ESA The expression of MnCaMKI was measured in two tissues of prawns at 1 d, and 3 d after bilateral eyestalk ablation. As shown in Fig. 6, the expression of MnCaMKI was induced in both hepatopancreas (Fig. 6A) and muscle (Fig. 6B) after eyestalk ablation. By day 1 following eyestalk ablation, the expression level of MnCaMKI reached the highest level in hepatopancreas, which was about 3.9-fold higher than that in the intact prawns (P b 0.05, Student's t-test). In muscle, the highest expression level of MnCaMKI was reached by day 3 following eyestalk ablation, to a level 19.7-fold higher than that in the intact prawns (P b 0.05, Student's t-test). 3.7. Silence response of dsMnCaMKI Real-time PCR was performed to monitor MnCaMKI and MnEcR transcript levels at 48 h post dsRNA injection. As shown in Fig. 7, the transcript levels of MnCaMKI and MnEcR were significantly knocked down, to 19.5% and 24.6% of that observed in control injected prawns, respectively. In prawns treated by injection of MnCaMKI dsRNA, the transcript abundance of MnEcR was significantly decreased to 21.2%, while in those receiving MnEcR dsRNA, the transcript abundance of MnCaMKI was also significantly decreased to 35.9%. Thus, there was a close correlation between the expression of MnCaMKI and that of MnEcR.

4. Discussion CaMKI is an important part of the CaM-dependent protein kinase cascade, and regulates many physiological processes (Condon et al., 2002; Kahl and Means, 2004; McKinsey et al., 2000; Saneyoshi et al., 2008; Uboha et al., 2007). Prior research has focused on vertebrates while invertebrate CaMKIs have seldom been investigated. In this study, we cloned the full-length cDNA of CaMKI from M. nipponense, an economically important crustacean in China and other East Asian countries. The deduced amino acid sequence of CaMKI from M. nipponense shows it has all the conserved domains that are necessary for kinase activity, such as the conserved Thr in the activation loop. The sequence conservation of CaMKI suggests that CaMKIs in both vertebrates and in invertebrates have a conserved role in intracellular Ca2 + signaling. Molting, as a specific physiological phenomenon in invertebrate animals, is crucial for incremental growth. Here we found that CAMKI expression in prawn is induced during molting and after eyestalk ablation. Ecdysteroid titers fluctuate over the course of the molt cycle (Chang and Bruce, 1980; Chen et al., 2012; Chung et al., 1998) and are increased by eyestalk ablation in crustaceans (Chen and Watson, 2011; Hopkins, 1983; Keller and Schmid, 1979). The expression pattern of CaMKI through the molt cycle and after eyestalk ablation suggests a close correlation between ecdysteroid titer and the expression level of CaMKI. This pattern is similar to that of other molt-responsive genes, including E75 (Priya et al., 2010), ecdysone receptor (EcR) (Kim et al., 2005) and retinoid-X receptor (RXR) (Shen et al., 2013). These results suggest that MnCaMKI is also a molt-responsive gene.

240

H. Shen et al. / Gene 538 (2014) 235–243

Fig. 2. Comparison of deduced amino acid sequence of MnCAMKI with other CAMKIs. Sequence names and accession numbers were supplied in the part of Methods and materials. *, conserved threonine residue; AID, autoinhibitory domain; CBD, CaM-binding domain.

Fig. 3. Phylogenetic tree of CAMKIs. The tree was constructed by the neighbor-joining method using amino acid sequences CAMKI. Numbers represent bootstrap values (%). Sequence names and accession numbers were supplied in the part of Methods and materials.

H. Shen et al. / Gene 538 (2014) 235–243

Fig. 4. Real-time PCR analysis of relative expression levels of MnCaMKI in nine different tissues. Hem: hemocytes; Te: testis; Ov: ovary; Hea: heart; Hep: hepatopancreas; Gi: gill; Ey: eyestalk; Mu: muscle; Ep: epidermis. Each data point represents the mean and standard deviation (n = 3 samples). The expression level in hepatopancreas and gill was significantly higher than other tissues (**P b 0.01 and *P b 0.05 with Student's t-test).

dsRNA-mediated RNA interference (RNAi) can specifically silence a target gene, and it has become an effective tool to study gene function in crustaceans (Das and Durica, 2013; Liu et al., 2014; Priya et al., 2009). In order to further clarify the role of MnCaMKI in molting, a dsRNA-mediated RNA interference assay was performed to repress MnCaMKI gene expression. Considering that the ecdysone receptor is the key factor in the regulation of molting, the method was also used to repress MnEcR gene expression. Here injection of dsRNA corresponding to MnCaMKI into prawns resulted in a 80.5% decrease of MnCAMKI expression and a 75.4% decrease in MnEcR expression in prawns treated with MnEcR dsRNA. The expression of both MnCaMKI and MnEcR were significantly decreased in the dsMnEcR-silenced prawns, suggesting MnCaMKI may be regulated by a molting signal, consistent with the conclusion that MnCaMKI is a molt-responsive gene. On the other hand, an interesting observation is that MnEcR expression was also significantly decreased in the dsMnCaMKI-silenced prawns, suggesting a feedback control by which MnEcR regulates MnCaMKI. Several proteins related to Ca2 + signaling have been investigated in the context of the molt cycle. The expression of plasma membrane Ca2 + ATPase (PMCA) from blue crab (C. sapidus) changes during the molt cycle, with peak expression occurring during premolt stage D2 (Chen et al., 2013). A similar expression pattern was reported for cyclic nucleotide phosphodiesterase (PDE), which is also involved in Ca2+ signaling (Nakatsuji et al., 2006). Calmodulin is the major sensor of Ca2 +, and the expression level of the calmodulin gene in crayfish Procambarus clarkii was increased in both the pre- and postmolt stages compared with the intermolt stage, with the highest expression level reached in the postmolt stage (Gao et al., 2009). The

241

sarcoplasmic calcium-binding protein (SCP) functions as a “buffer” of cytosolic Ca 2 +. The expression of SCP is downregulated in the pre- and postmolt stages compared with the intermolt stage (Gao et al., 2006). Though the expression patterns of these Ca2 + signaling-related genes are not fully similar, the genes all exhibit a molt-induced expression pattern, proving that there is a close relationship between molting and Ca2 + signaling. There are reports that changes in intracellular calcium concentration in a crustacean's (C. sapidus) Y-organs are related to the hemolymphatic ecdysteroid titer in a natural molt cycle and after ESA (Chen and Watson, 2011; Chen et al., 2012). A similar change in Ca2+ concentration and expression levels of CaM, CaMKI and the downstream members of the Ca2 + signaling cascade demonstrate coordination and interaction between Ca2+ and its signal transducers. This is beneficial for crustaceans in allowing efficient transduction of Ca2 + signals for specific biological functions in the molt cycle. Calcium signaling is hypothesized to be involved in the regulation of steroid hormone secretion by crustacean molting glands. Increased intracellular Ca2+ stimulates steroidogenesis during the molt cycle and after ESA (Chen and Watson, 2011; Chen et al., 2012). However, this hypothesis cannot clarify the connection between stage-specific changes in Ca2+ and the increase in CaM, CaMKI and other Ca2+-related genes' expression during the premolt stage and after eyestalk ablation. It is widely known that eyestalk ablation stimulates molting by relieving MIH suppression of ecdysteroid synthesis, leading to continually elevated ecdysteroid titers. The direct result of ESA is the elevation of ecdysteroid concentrations, not an increase of Ca2 + concentration. Ecdysteroids, as the molting hormone, bind and activate hetero-dimers of the ecdysone receptor and retinoid-X receptor. The ecdysone receptor and retinoid-X receptor are transcription factors; the activated hetero-dimers bind the promoters of molt-responsive genes and regulate these genes' expression. In considering the previous hypothesis that ecdysteroidogenesis is stimulated by an increase in intracellular Ca2+, it is more believable that the relationship between Ca2+ signaling and ecdysteroid is not unidirectional, but more complicated. Thus, further work needs to be done to clarify the actions of Ca2+ signaling and related proteins in molting. In summary, we report the first cloning of the CaMKI gene from the freshwater prawn M. nipponense. It has the classical domain organization of CaM-dependent protein kinases. Its expression is induced in the molt cycle and after ESA, and correlated with the expression of the ecdysone receptor gene, indicating that CaMKI has a molt-specific function in crustaceans.

Conflict of interest statement No potential conflicts of interest were disclosed.

Fig. 5. Real-time PCR analysis of relative MnCAMKI expression levels in the molting cycle in (A) hepatopancreas, (B) muscle and (C) epidermis. Each data point represents the mean and standard deviation (n = 3 samples). The expression level in the premolt stage is significantly higher than in the intermolt stage (*P b 0.05 with Student's t-test).

242

H. Shen et al. / Gene 538 (2014) 235–243

Fig. 6. Expression level of MnCAMKI after eyestalk ablation in (A) hepatopancreas, and (B) muscle. Each data point represents the mean and standard deviation (n = 3 samples). Statistical analyses were performed using Student's t-test (*P b 0.05).

Fig. 7. Relative expression of MnCaMKI and MnEcR in prawns treated by injection of dsGFP, dsMnCaMKI and dsMnEcR, respectively. Statistical analyses were performed using Student's t-test (**P b 0.01 and *P b 0.05).

Acknowledgment This work is supported by the Science & Technology Pillar Program of Jiangsu Province (BE2013316), the Natural Science Foundation of Jiangsu Province (BK2012534) and the Special Scientific Research Funds for Central Non-profit Institutes, Chinese Academy of Fishery Sciences (2013A0405). References Bachs, O., Agell, N., Carafoli, E., 1994. Calmodulin and calmodulin-binding proteins in the nucleus. Cell Calcium 16, 289–296. Cesara, J.R.d.O., Zhao, B., Malechaa, S., Akob, H., Yang, J., 2006. Morphological and biochemical changes in the muscle of the marine shrimp Litopenaeus vannamei during the molt cycle. Aquaculture 261, 688–694. Chan, S.-M., Rankin, S.M., Keeley, L.L., 1988. Characterization of the molt stages in Penaeus vannamei: setogenesis and hemolymph levels of total protein, ecdysteroids, and glucose. Biol. Bull. 175, 185–192. Chang, E.S., Bruce, M.J., 1980. Ecdysteroid titers of juvenile lobsters following molt induction. J. Exp. Zool. 214, 157–160. Chang, E.S., Mykles, D.L., 2011. Regulation of crustacean molting: a review and our perspectives. Gen. Comp. Endocrinol. 172, 323–330. Chang, C.W., Chang, G.D., Chen, H., 2011. A novel cyclic AMP/Epac1/CaMKI signaling cascade promotes GCM1 desumoylation and placental cell fusion. Mol. Cell. Biol. 31, 3820–3831. Chen, H.Y., Watson, R.D., 2011. Changes in intracellular calcium concentration in crustacean (Callinectes sapidus) Y-organs: relation to the hemolymphatic ecdysteroid titer. J. Exp. Zool. A Ecol. Genet. Physiol. 315, 56–60. Chen, H.Y., Dillaman, R.M., Roer, R.D., Watson, R.D., 2012. Stage-specific changes in calcium concentration in crustacean (Callinectes sapidus) Y-organs during a natural

molting cycle, and their relation to the hemolymphatic ecdysteroid titer. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 163, 170–173. Chen, H.L., Cao, M.J., Cai, Q.F., Su, W.J., Mao, H.Y., Liu, G.M., 2013. Purification and characterisation of sarcoplasmic calcium-binding protein, a novel allergen of red swamp crayfish (Procambarus clarkii). Food Chem. 139, 213–223. Cheung, W.Y., 1980. Calmodulin plays a pivotal role in cellular regulation. Science 207, 19–27. Chung, A.C., Durica, D.S., Hopkins, P.M., 1998. Tissue-specific patterns and steady-state concentrations of ecdysteroid receptor and retinoid-X-receptor mRNA during the molt cycle of the fiddler crab, Uca pugilator. Gen. Comp. Endocrinol. 109, 375–389. Condon, J.C., Pezzi, V., Drummond, B.M., Yin, S., Rainey, W.E., 2002. Calmodulin-dependent kinase I regulates adrenal cell expression of aldosterone synthase. Endocrinology 143, 3651–3657. Covi, J.A., Chang, E.S., Mykles, D.L., 2009. Conserved role of cyclic nucleotides in the regulation of ecdysteroidogenesis by the crustacean molting gland. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 152, 470–477. Crivici, A., Ikura, M., 1995. Molecular and structural basis of target recognition by calmodulin. Annu. Rev. Biophys. Biomol. Struct. 24, 85–116. Cyert, M.S., 2001. Genetic analysis of calmodulin and its targets in Saccharomyces cerevisiae. Annu. Rev. Genet. 35, 647–672. Das, S., Durica, D.S., 2013. Ecdysteroid receptor signaling disruption obstructs blastemal cell proliferation during limb regeneration in the fiddler crab, Uca pugilator. Mol. Cell. Endocrinol. 365, 249–259. Gao, Y., Gillen, C.M., Wheatly, M.G., 2006. Molecular characterization of the sarcoplasmic calcium-binding protein (SCP) from crayfish Procambarus clarkii. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 144, 478–487. Gao, Y., Gillen, C.M., Wheatly, M.G., 2009. Cloning and characterization of a calmodulin gene (CaM) in crayfish Procambarus clarkii and expression during molting. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 152, 216–225. Haribabu, B., et al., 1995. Human calcium–calmodulin dependent protein kinase I: cDNA cloning, domain structure and activation by phosphorylation at threonine-177 by calcium–calmodulin dependent protein kinase I kinase. EMBO J. 14, 3679–3686. Hopkins, P.M., 1983. Patterns of serum ecdysteroids during induced and uninduced proecdysis in the fiddler crab, Uca pugilator. Gen. Comp. Endocrinol. 52, 350–356. Ji, P.F., Yao, C.L., Wang, Z.Y., 2011. Two types of calmodulin play different roles in Pacific white shrimp (Litopenaeus vannamei) defenses against Vibrio parahaemolyticus and WSSV infection. Fish Shellfish Immunol. 31, 260–268. Kahl, C.R., Means, A.R., 2004. Regulation of cyclin D1/Cdk4 complexes by calcium/ calmodulin-dependent protein kinase I. J. Biol. Chem. 279, 15411–15419. Keller, R., Schmid, E., 1979. In vitro secretion of ecdysteroids by Y-organs and lack of secretion by mandibular organs of the crayfish following molt induction. J. Comp. Physiol. 130, 247–353. Kim, H.W., Chang, E.S., Mykles, D.L., 2005. Three calpains and ecdysone receptor in the land crab Gecarcinus lateralis: sequences, expression and effects of elevated ecdysteroid induced by eyestalk ablation. J. Exp. Biol. 208, 3177–3197. Lee, J.C., Kwon, Y.G., Lawrence, D.S., Edelman, A.M., 1994. A requirement of hydrophobic and basic amino acid residues for substrate recognition by Ca2+/calmodulindependent protein kinase Ia. Proc. Natl. Acad. Sci. U. S. A. 91, 6413–6417. Liu, Y., Hou, F., He, S., Qian, Z., Wang, X., Mao, A., Sun, C., Liu, X., 2014. Identification, characterization and functional analysis of a serine protease inhibitor (Lvserpin) from the Pacific white shrimp, Litopenaeus vannamei. Dev Comp Immunol 43, 35–46. Ma, K.Y., Lin, J.Y., Guo, S.Z., Chen, Y., Li, J.L., Qiu, G.F., 2013. Molecular characterization and expression analysis of an insulin-like gene from the androgenic gland of the oriental river prawn, Macrobrachium nipponense. Gen. Comp. Endocrinol. 185C, 90–96. Matsushita, M., Nairn, A.C., 1998. Characterization of the mechanism of regulation of Ca2+/ calmodulin-dependent protein kinase I by calmodulin and by Ca2+/calmodulindependent protein kinase kinase. J. Biol. Chem. 273, 21473–21481. McDonald, A.A., Chang, E.S., Mykles, D.L., 2011. Cloning of a nitric oxide synthase from green shore crab, Carcinus maenas: a comparative study of the effects of eyestalk ablation on expression in the molting glands (Y-organs) of C. maenas, and blackback land crab, Gecarcinus lateralis. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 158, 150–162.

H. Shen et al. / Gene 538 (2014) 235–243 McKinsey, T.A., Zhang, C.L., Olson, E.N., 2000. Activation of the myocyte enhancer factor-2 transcription factor by calcium/calmodulin-dependent protein kinase-stimulated binding of 14-3-3 to histone deacetylase 5. Proc. Natl. Acad. Sci. U. S. A. 97, 14400–14405. Means, A.R., Dedman, J.R., 1980. Calmodulin—an intracellular calcium receptor. Nature 285, 73–77. Nairn, A.C., Greengard, P., 1987. Purification and characterization of Ca2+/calmodulindependent protein kinase I from bovine brain. J. Biol. Chem. 262, 7273–7281. Nakatsuji, T., Sonobe, H., Watson, R.D., 2006. Molt-inhibiting hormone-mediated regulation of ecdysteroid synthesis in Y-organs of the crayfish (Procambarus clarkii): involvement of cyclic GMP and cyclic nucleotide phosphodiesterase. Mol. Cell. Endocrinol. 253, 76–82. Priya, T.A., Li, F., Zhang, J., Wang, B., Zhao, C., Xiang, J., 2009. Molecular characterization and effect of RNA interference of retinoid X receptor (RXR) on E75 and chitinase gene expression in Chinese shrimp Fenneropenaeus chinensis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 153, 121–129. Priya, T.A., Li, F., Zhang, J., Yang, C., Xiang, J., 2010. Molecular characterization of an ecdysone inducible gene E75 of Chinese shrimp Fenneropenaeus chinensis and elucidation of its role in molting by RNA interference. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 156, 149–157. Salma, U., et al., 2012. Five hepatopancreatic and one epidermal chitinases from a pandalid shrimp (Pandalopsis japonica): cloning and effects of eyestalk ablation on gene expression. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 161, 197–207. Saneyoshi, T., et al., 2008. Activity-dependent synaptogenesis: regulation by a CaM-kinase kinase/CaM-kinase I/betaPIX signaling complex. Neuron 57, 94–107. Shen, H., Zhou, X., Bai, A., Ren, X., 2013. cDNA cloning of retinoid-X receptor gene from Macrobrachium nipponense and different responses of two splice variants during

243

the molting cycle. Crustacean 86 (13-14), 1586–1604. http://dx.doi.org/10.1163/ 15685403-00003248. Sheng, M., Thompson, M.A., Greenberg, M.E., 1991. CREB: a Ca(2 +)-regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science 252, 1427–1430. Uawisetwathana, U., Leelatanawit, R., Klanchui, A., Prommoon, J., Klinbunga, S., Karoonuthaisiri, N., 2011. Insights into eyestalk ablation mechanism to induce ovarian maturation in the black tiger shrimp. PLoS One 6, e24427. Uboha, N.V., Flajolet, M., Nairn, A.C., Picciotto, M.R., 2007. A calcium- and calmodulin-dependent kinase Ialpha/microtubule affinity regulating kinase 2 signaling cascade mediates calcium-dependent neurite outgrowth. J. Neurosci. 27, 4413–4423. Vogel, H.J., 1994. The Merck Frosst Award Lecture 1994. Calmodulin: a versatile calcium mediator protein. Biochem. Cell Biol. 72, 357–376. Wang, Y.T., et al., 2012. Characterization and expression pattern of KIFC1-like kinesin gene in the testis of the Macrobrachium nipponense with discussion of its relationship with structure lamellar complex (LCx) and acroframosome (AFS). Mol. Biol. Rep. 39, 7591–7598. White, A.J., et al., 2011. Characterization of sarcoplasmic calcium binding protein (SCP) variants from freshwater crayfish Procambarus clarkii. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 160, 8–14. Yokokura, H., Picciotto, M.R., Nairn, A.C., Hidaka, H., 1995. The regulatory region of calcium/calmodulin-dependent protein kinase I contains closely associated autoinhibitory and calmodulin-binding domains. J. Biol. Chem. 270, 23851–23859. Zhang, F., Chen, L., Qin, J., Zhao, W., Wu, P., 2011. A novel gene with a vWD domain and three Kazal-type domains: molecular cloning and expression in the ovary of the oriental river prawn, Macrobrachium nipponense. Genetika 47, 1190–1195.