Cadmium exposure affects iron acquisition in barley (Hordeum vulgare) seedlings Stefania Astolfia, Maria Raffaella Ortolania, Giulio Catarcionea, Anna Rita Paolaccia, Stefano Cescob, Roberto Pintonc and Mario Ciaffia,* a

Department of Agriculture, Forests, Nature and Energy (DAFNE), Università della Tuscia, I-01100

Viterbo, Italy b

Faculty of Science and Technology, Free University of Bozen, 39100 Bozen, Italy

c

DISA, University of Udine, 33100 Udine, Italy

*Corresponding author, e-mail: [email protected]

This study addresses the question of the interference between Fe nutrition and Cd toxicity at the level of growth performance, phytosiderophores (PS) release, micronutrient accumulation and expression of genes involved in Fe homeostasis in barley seedlings, a plant with Strategy II-based response to Fe shortage. Cd exposure induced responses similar to those of genuine Fe deficiency also in Fesufficient plants. Most genes involved in PS biosynthesis and secretion (HvNAS3, HvNAS4, HvNAS6, HvNAS7, HvNAAT-A, HvDMAS1 and HvTOM1) induced by Fe deprivation were also significantly upregulated in presence of Cd under Fe sufficient conditions. Accordingly, the enhanced expression of these genes in roots under Cd exposure was accompanied by an increase of PS release. However, induced expression of HvIRO2 and the down-regulation of HvIDEF1 and HvIRT1, after Cd exposure, suggested the presence of a pathway that induces HvIRO2-mediated PS biosynthesis under Cd stress, which probably is not simply caused by Fe deficiency. The down-regulation of HvIRT1 and HvNramp5 may represent a protective mechanism at transcriptional level against further Cd uptake by these transporters. These results likely indicate that Cd itself may be able to activate Fe acquisition mechanism in an Fe-independent manner.

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/ppl.12207

This article is protected by copyright. All rights reserved

Introduction Iron (Fe) is an essential metal that plays a central role in many plant processes, being required as a cofactor for many cellular functions (Guerinot and Ying 1994). However, despite its abundance, in neutral or alkaline soils and under aerobic conditions Fe is only poorly available to plants (Cornell and Schwertmann 2003), becoming even less available in the rhizosphere for its uptake by both roots and microbes (Loper and Buyer 1991). As a consequence, in order to guarantee an equilibrate growth coping with the low availability of the micronutrient in soil, plants have developed active uptake mechanisms that differ between graminaceous monocots and other plants, including dicots and nongraminaceous monocots (Kobayashi and Nishizawa 2012). In graminaceous monocots, Fe uptake is based on a chelation mechanism (Strategy II, Kobayashi and Nishizawa 2012) which involves the release of low molecular weight, high-affinity FeIII-chelating compounds (phytosiderophores, PS) and the uptake by roots of the Fe(III)-PS complex by a Yellow Stripe 1 (YS1) transporter (Curie et al. 2001). Differently, in dicots and non-graminaceous monocots the micronutrient is acquired by a reduction-based Fe uptake mechanism (Strategy I, Marschner and Römheld 1994), which involves two steps: a reduction of FeIII to FeII by plasma membrane-bound ferric reductase and the uptake of FeII in root epidermal cells by the IRT1 ferrous Fe transporter (Connolly et al. 2003). When Fe is limiting, the activities of both Strategies are markedly increased with consequent positive effects in the acquisition process of Fe by roots (Connolly et al. 2003, Nagasaka et al. 2009). Iron deficiency can be caused not only by the low solubility of Fe, but also by other environmental factors interfering with Fe acquisition. Cadmium contamination of agricultural soils via fertilizer (mainly phosphate) impurities, the use of sewage sludge and atmospheric fall-out from industrial and urban activities (Kirkam 2006) is a worldwide serious problem because it can cause agricultural yield losses; Cd can also easily enter the food chain representing a potential health risk for humans (Wagner 1993). Despite Cd has no plant nutritional function, it is readily taken up by plants and can be thus rapidly accumulated in different tissues (Sanità di Toppi and Gabrielli 1999). Once inside the plant Cd, even at low concentrations, influences many important physiological processes, either directly or indirectly. For example, Cd may inhibit chlorophyll synthesis, decrease the activity of enzymes and generate oxidative stress, resulting in poor growth and low biomass (Sanità di Toppi and Gabrielli 1999, Faller et al. 2005). The root is the first target of Cd phytotoxicity (Brune and Dietz 1995), and the interactions between Cd and root cells lead to nutritional imbalances in plants by affecting both the uptake and the allocation processes of plant nutrients (Gussarson et al. 1996, Rogers et al. 2000, Astolfi et al. 2003a, 2005, Azevedo et al. 2005). Thus, one possible explanation for the mechanism of Cd toxicity is the competition between Cd and other essential metals causing the socalled “inducible deficiency” (Clemens 2001). Several studies have, in fact, demonstrated that under Cd exposure the accumulation of Ca, Cu, Fe, Mn, and Zn decreases in plants (Clemens et al. 2002, Lux et al. 2011), whereas an increase in S accumulation was observed (Astolfi et al. 2004, 2012).

This article is protected by copyright. All rights reserved

Although the mechanism underlying the uptake and translocation of Cd in plants is not completely understood, some Fe transporters, such as IRT1-like proteins and members of the Nramp gene family, have been reported to be involved in the root Cd uptake in both Strategy I and Strategy II plants (Lux et al. 2011, Clemens et al. 2013, Uraguchi and Fujiwara 2013). In particular, Fe deficiency-induced expression of IRT1 in Arabidopsis and OsIRT1 in rice is thought to be a major route for the accumulation of Cd under Fe deprivation (Schaaf et al. 2006, Nakanishi et al. 2006, Morrissey et al. 2009). Interestingly, a recent study reported the isolation and characterization of an IRT1-like barley gene (HvIRT1), whose expression was induced by Fe and Mn deficiency (Pedas et al. 2008). Furthermore, HvIRT1 protein was described to be able to transport, besides Fe2+ and Mn2+, also Zn2+ and Cd2+ (Pedas et al. 2008). As for the effects on Fe acquisition, direct proof of Cd/Fe interaction comes from two lines of evidence. Plant exposure to Cd results in the development of Fe deficiency despite an adequate Fe supply and, on the other hand, it has been demonstrated that Cd uptake and accumulation in plants can be substantially higher when Fe availability is low. Several studies have shown, in fact, that Cd may affect the Fe content in plant tissues, inducing Fe-deficiency responses in both Strategy I and Strategy II plants (Alcantara et al. 1994, Sharma et al. 2004, Yoshihara et al. 2006, Lopez-Millan et al. 2004, Gao et al. 2011, Astolfi et al. 2012), thus indicating that some regulatory mechanisms involved in Fe homeostasis are induced by Cd either directly or indirectly. However, few studies have analyzed the regulatory mechanisms involved in the Fe-deficiency responses under Cd treatment, in particular in Strategy II plants (Sharma et al. 2004, Hodoshima et al. 2007, Meda et al. 2007). The fact that Cd is a toxic metal and Fe an essential metal makes this association interesting as it raises the possibility that toxic effects of Cd may be attributable to the decline in Fe content or prevented by exogenous supply of Fe. Therefore this study was aimed to analyze the role of Fe acquisition mechanisms operating in barley, a Strategy II plant, in conditions of increased Cd uptake when plants are grown under Felimiting condition. Barley seedlings were grown for 11 days under low (5 µM Fe3+-EDTA) and sufficient (100 µM Fe3+-EDTA) Fe supply with or without 20 µM Cd addition. The interaction between both metals was assessed by evaluating plant growth, mineral contents, PS release rate, levels of malondialdehyde, indicative of oxidative stress, and production of non-protein thiols, which reflect the production of phytochelatins (PCs). To further characterize and compare changes of the pathways triggered in genuine Fe deficiency or in Cd-induced Fe deficiency, we analyzed whether Cd addition altered the expression of some genes involved in the regulation of Fe deficiency responses (HvIDEF1, HvIDEF2, HvIRO2 and HvIRO3), in the PS-dependent system (HvTOM1, HvYS1, HvNAS3, HvNAS4, HvNAS6, HvNAS7, HvNAAT-A and HvDMAS1) and in the Fe uptake and transport (HvIRT1, HvNramp2, HvNramp5 and HvNramp7).

This article is protected by copyright. All rights reserved

Materials and methods Growth conditions Barley (Hordeum vulgare cv. Europa) seeds were germinated on moistened paper in the dark at 26°C for 3 days. Seedlings were then transferred into plastic pots containing 2.2 L of nutrient solution (NS) (12 seedlings in each pot) and were grown for 11 days under low (5 µM FeIII-EDTA) or sufficient (100 µM FeIII-EDTA) Fe supply with or without 20 µM Cd addition. Composition of the NS (mM) was: K2SO4 0.7, MgSO4 0.5, Ca(NO3)2 2.0, KCl 0.1, KH2PO4 0.1, H3BO3 1 x 10–3, MnSO4 1 x 10–3, CuSO4 2.5 x 10–4, (NH4)6Mo7O24 1 x 10–5 and ZnSO4 1 x 10–3 (Astolfi et al. 2012). The nutrient solution was continuously aerated and renewed every 2 days. Plants were grown in a growth chamber under controlled climatic conditions: light 200 µmol m–2 s–1 PPF with a 14 h/10 h day/night regime (27/20°C day/night temperature cycling; 80% relative humidity).

Collection of root exudates and determination of PS release Phytosiderophores release from barley plants was analyzed by determining PS concentration in root washings. Barley plants were removed from the NS 2 h after the onset of the light period and roots were washed twice for 1 min in deionized water. Root systems were submerged into 500 ml deionized water for 3 h with continuous aeration. Thereafter, Micropur (10 mg l–1) (Roth, Karlsruhe, Germany) was added to prevent microbial degradation of PS. PS content in root washings was determined using the Fe-binding assay revised by Reichman and Parker (2006).

Non-protein thiols content Water soluble non-protein sulfhydryl (SH) compounds were determined colorimetrically with DTNB following the procedure described in Astolfi et al. (2004). Briefly, roots were homogenized in a solution containing 80 mM TCA acid, 1 mM EDTA acid, 0.15% (w/v) ascorbic acid and 10% (w/v) PVPP using 3 ml buffer per g fresh weight leaves. The DTNB-reactive compounds were measured spectrophotometrically at 415 nm.

Determination of malondialdehyde content The level of lipid peroxidation was expressed as malondialdehyde (MDA) content and was determined as TBA reactive metabolites as described in Astolfi et al. (2005). Root tissue (0.2 g) was homogenized in 10 ml of 0.25% TBA dissolved in 10% TCA. Extract was heated at 95°C for 30 min and then quickly cooled on ice. After centrifugation at 10 000 g for 10 min, the absorbance of the supernatant was measured at 532 nm. Correction of non-specific turbidity was made by subtracting the absorbance value taken at 600 nm. The level of lipid peroxidation was expressed as µmol g–1 fresh weight by using an extinction coefficient of 155 mM cm–1.

This article is protected by copyright. All rights reserved

RNA extraction and expression analysis by RT-PCR Total RNA was extracted from roots of barley plants using the Trizol reagent (Invitrogen) according to manufacturer’s instructions. The resulting RNA was treated with RNase-free DNase I (Promega) according to the manufacturer’s protocol. Following digestion, nucleotides were removed from RNA using a G50 Sepharose buffer exchange column (Amersham). RNA concentration and integrity were checked with a UV/VIS spectrophotometer Lambda 3B (Perkin Elmer). The quality of RNA samples was also assessed by electrophoresis on 1.2% (w/v) agarose gels. First-strand cDNA was synthesized from 1 μg of RNA by the M-MLV (H-) Reverse Transcriptase (Invitrogen) and the resulting cDNA was diluted 1/5. PCR reactions were performed by the HotMasterMix system (Eppendorf) using 1 μl of the diluted RT reaction and primer pairs as in Table 1. PCR conditions were: initial denaturation at 94°C for 5 min, 28–35 cycles of amplification, each at 94°C for 1 min, 56–62°C for 1 min (depending on the optimal annealing temperature of the different primer pairs employed) and 72°C for 2 min. Samples (5 μl) of the amplification products were collected after 28, 30, 32 and 35 PCR cycles and analyzed by electrophoresis on 1.5 (w/v) agarose gels for semi-quantitative PCR. Each RT-PCR experiment was independently repeated three times to test the amplification reproducibility. For semi-quantitative RT-PCR specific primers were designed within the 3’ end region of the genes involved in PS biosynthesis and secretion (HvNAS3, HvNAS4, HvNAS6, HvNAS7, HvNAAT-A, HvDMAS1 and HvTOM1) and Fe uptake (HvYS1 and HvIRT1) (Table 1) on the basis of cDNA sequences previously isolated by Higuchi et al. (1999), Herbik et al. (1999), Takahashi et al. (1999), Bashir et al. (2006), Nozoye et al. 2011, Murata et al. (2006) and Pedas et al. (2008). The barley cDNA sequences homologs to OsIDEF1, OsIDEF2, OsIRO2 and OsIRO3 rice genes involved in the regulation of Fe deficiency responses (Kobayashy et al. 2007, Ogo et al. 2006, 2008, Zheng et al. 2010) were identified by a BLAST search of the NCBI database using the four available rice sequences (Accession numbers BR000654, AK099540, FAA00382 and AK061515). Furthermore, a BLAST search against the NCBI database using the seven Nramp gene sequences present in rice (Accession numbers in Takahashi et al. 2011) allowed the identification of three barley full-length cDNAs homologs to OsNramp2, OsNramp5 and OsNramp7 genes. For the seven cDNA sequences identified by the database search specific primers were designed to amplify fragments within the 3’ end region of each sequence (Table 1). Actin and 18S cDNAs were also amplified as internal controls (Table 1). The specificity of the amplified fragments was checked by sequencing the PCR products to confirm that the sequences corresponded to the target genes.

Other measurements and statistics Chlorosis scoring in attached leaves was detected by a chlorophyll meter reading (SPAD) portable apparatus (Minolta Co., Osaka, Japan) on the first fully expanded leaf from the top of the plant. To determine Cd, Fe, Zn, Mn and Cu concentration, leaf or root tissues were oven-dried at 80°C

This article is protected by copyright. All rights reserved

to constant weight and thereafter ashed at 550°C for 6 h in a muffle furnace. The ashes were dissolved in 1 M HCl and analyzed by inductively coupled plasma atomic emission spectrometry in an ICPAES instrument (VISTA MPX, Varian, Torino, Italy). Each reported value represents the mean ± SD of measurements carried out in triplicate and obtained from four independent experiments. Statistical analyses of data were carried out by ANOVA with the GraphPad InStat Program (version 3.06). Significant differences were established by posthoc comparisons (HSD test of Tukey) at P < 0.01.

Results Plant growth parameters The Fe shortage caused no marked effect on plant phenotypes (Fig. 1). Plants grown under low Fe supply (5 µM FeIII-EDTA) showed only a slight decrease in fresh weight of both shoots (–20%) and roots (–30%) and in SPAD units (–10%) when compared with the respective Fe-sufficient (100 µM FeIII-EDTA) control. On the other hand, fresh biomass production was markedly inhibited (60–70%) by 20 µM Cd addition irrespective of the Fe nutritional regime; chlorophyll content (SPAD value) was also decreased in Cd-treated plants, although at a lower extent (20–30%) (Fig. 1).

Cd and thiols concentration in shoots and roots Most of the Cd taken up by barley plants was retained in roots, with only a small fraction translocated to the shoots. Under both Fe supply conditions, Cd concentration in plant roots was about 40-fold higher than in shoots (Fig. 2A, B). Interestingly, we found that low-Fe plants accumulated significantly more Cd in their tissues than control plants (from 30 to 40% in shoots and roots, respectively) (Fig. 2A, B). The concentration of total non-protein thiols, which likely reflects the production of PCs involved in Cd detoxification, was clearly increased by Cd treatment in both shoots and roots, with the exception of roots from low-Fe plants (Fig. 2C, D). In these plants, Cd-treated roots had a small but significantly lower thiol concentration than the untreated ones (–15%) (Fig. 2D). The highest value for thiols concentration was found in Cd-treated Fe-sufficient shoots, and was more than twice higher than that found in control shoots (Fig. 2C). However, the Fe-sufficient roots exposed to Cd showed the highest increase of thiols production (about threefold higher that the control) (Fig. 2D).

Root lipid peroxidation Malondialdehyde (MDA) content was used as a marker of lipid peroxidation. The effect of different nutritional supply and Cd exposure on lipid peroxidation in barley roots is shown in Fig. 3. There was no significant difference in MDA concentration between the low-Fe and the Fe-sufficient plants. On the other hand, Cd treatment induced a dramatic increase in the MDA concentration. Likely due to the

This article is protected by copyright. All rights reserved

presence of a higher Cd amount in Fe-deficient plants, the oxidative stress induced by the accumulation of the heavy metal seemed to be especially detrimental for plants grown under Fe limitation, which significantly accumulated MDA at root level (about fivefold higher than control) (Fig. 3). On the other hand, the effect on Fe sufficient roots was less pronounced and Cd addition led to an about twofold increase in MDA concentrations in comparison to the control (Fig. 3).

Fe concentration and PS release Low Fe supply obviously resulted in lower shoot and root Fe concentration in comparison to the control (–40 and –80%, respectively) (Fig. 4 A,B). Furthermore, it was found that Cd addition inhibited the plant capability to accumulate Fe in both shoots and roots (Fig. 4 A, B). When Cd was supplied to low-Fe plants, Fe concentration decreased from 30 to 35% of the control in shoots and roots, respectively, while in Fe-sufficient plants Cd produced a higher reduction, from 40 to 50% in shoots and roots, respectively (Fig. 4 A,B). As expected PS release was induced by Fe deficiency (Fig. 4C). In particular, when grown with low-Fe NS, PS release rate by barley roots reached values up to 3-times greater than those found in the Fe-sufficient plants. Exposure to Cd resulted in a PS release even more pronounced (twice higher) than that induced by Fe deficiency (Fig. 4C).

Micronutrients concentration in shoots and roots Fig. 5 shows the changes in mineral composition in barley plants subjected to Fe shortage and Cd stress. Fe limitation (5 µM) increased almost three-fold the shoot and root Zn concentrations as compared to the values found in Fe-sufficient controls (Fig. 5 A, B). Shoot Mn and Cu concentrations were not affected by low Fe supply (Fig. 5 C, E), while higher levels of Mn and Cu were found in Fedeficient roots compared to Fe-sufficient plants (Fig. 5 D, F). The addition of Cd to the NS significantly decreased root and shoot concentrations of Mn and Cu in barley plants, whereas Zn accumulation was reduced by Cd exposure only at shoot level (Fig. 5). In particular, the most pronounced effect of Cd was observed with respect to Mn concentration, with differences in levels between the Cd-treated and control plants ranging from 5 to 7-fold in shoots and from 10 to 15-fold in roots (Fig. 5 C,D).

Expression analyses In order to understand at molecular level how Cd interferes with the Fe acquisition process, the expression of some genes coding for transcription factors that regulate the Fe deficiency responses (HvIDEF1, HvIDEF2, HvIRO2 and HvIRO3), or involved in the Fe uptake and transport (HvIRT1, HvNramp2, HvNramp5, HvNramp7, HvYS1) and in PS biosynthesis and secretion (HvNAS3, HvNAS4, HvNAS6, HvNAS7, HvNAAT-A, HvDMAS1 and HvTOM1) was evaluated by RT-PCR in roots of barley plants grown with different Fe supply (5 or 100 µM) and exposed or not to 20 µM Cd.

This article is protected by copyright. All rights reserved

In rice both OsIDEF1 and OsIDEF2 are constitutively expressed in roots, leaves, flowers and seeds and their expression levels are not affected by the Fe nutritional status of plants (Kobayashi et al. 2007, 2009, 2010), whereas the two basic helix-loop-helix (bHLH) transcription factor genes OsIRO2 and OsIRO3 are strongly up-regulated by Fe deficiency in both shoots and roots (Ogo et al. 2006, Zheng et al. 2010); in contrast their expression is not induced by deficiency of other minerals such as Zn, Mn and Cu (Ogo et al. 2006, Zheng et al. 2010). In agreement with the observations in rice, the expression levels of HvIDEF1 and HvIDEF2 were unaffected in barley roots by the Fe availability (Fig. 6), whereas the amount of HvIRO2 and HvIRO3 transcripts was markedly increased in low-Fe plants as compared to Fe-sufficient ones (Fig. 6). Furthermore, the expression of HvIRT1, HvNramp2, HvNramp5 and HvNramp7, likely involved in the uptake and transport of multiple classes of cations including the essential metals Mn and Fe and the toxic metal Cd (Pedas et al. 2008, Colangelo and Guerinot 2006), was markedly up-regulated by Fe-deficiency (Fig. 7). In agreement with the observations in rice, the expression levels of HvIDEF1 and HvIDEF2 were unaffected in barley roots by the Fe availability (Fig. 6), whereas the amount of HvIRO2 and HvIRO3 transcripts was markedly increased in low-Fe plants as compared to Fe-sufficient ones (Fig. 1). In agreement with previous findings, the expression of HvIRT1, encoding a plasma membrane-localized metal transport protein able to transport a wide range of trace elements including Fe2+/Fe3+, Mn2+, Cd2+ and Zn2+ (Pedas et al. 2008), was markedly up-regulated by Fe-deficiency (Fig. 7). Natural resistance associate macrophage protein (Nramp) family members, which have been identified in many plant species, have been shown to function as metal transporters of multiple classes of cations, including the essential metals Mn and Fe and the toxic metal Cd (Colangelo and Guerinot 2006). A database search allowed the identification of three barley Nramp genes, which, among the seven Nramp genes identified in the rice genome, showed the highest homologies with OsNramp2, OsNramp5 and OsNramp7. All three barley genes, named according to their closest rice homologs, were up-regulated by Fe shortage (Fig. 7). In agreement with previous findings (Nagasaka et al. 2009), the expression of genes involved in the synthesis of nicotianamine (NA) and 2’deoxymugineic acid (DMA), which are the precursors of the mugineic acid family PS (MAs), was up-regulated by Fe limitation (Fig. 8). These genes include NA synthase genes (HvNAS3, HvNAS4, HvNAS6 and HvNAS7), a gene coding for nicotianamine aminotransferase (NAAT-A) and the DMA synthase gene (DMAS1). A similar expression pattern under Fe deprivation was detected for Fe-deficiency responsive gene HvYS1, coding for the major Fe-PS complex transporter involved in the primary Fe acquisition by barley roots (Ueno et al. 2009) and for HvTOM1, a gene coding for the barley transporter directly involved in the MAs efflux (Nozoye et al. 2011) (Fig. 9). Interestingly, the regulation of the expression of some analyzed genes was different in response to Cd exposure, when compared to that observed under Fe deprivation. When Cd was added to the NS the expression of the genes coding for the two transcription factors HvIDEF1 and HvIDEF2 and for the metal transporters HvIRT1 and HvNramp5 was significantly down-regulated in roots of barley

This article is protected by copyright. All rights reserved

plants, irrespective of the Fe nutritional status (Figs 6 and 7). In agreement to that observed under Fe deficiency, the Cd treatment positively regulate the transcription of the two barley bHLH transcription factor genes HvIRO2 and HvIRO3, whose transcript levels even being similar to that of Fe-deficient roots, was comparatively higher than that of Fe sufficient control plants (Fig. 6). Similarly, the transcript levels of HvNramp2 and HvNramp7 increased markedly after Cd treatment in both the Fe sufficient and deficient conditions, with the highest transcript levels detected in Fe-deficient plants (Fig. 7). Furthermore, Figures 8 and 9 show that Cd induced the transcription of genes involved in the synthesis (HvNAS3, HvNAS4, HvNAS6, HvNAS7, NAAT-A and DMAS1) and transport (HvTOM1 and HvYS1) of PS.

Discussion Cadmium addition to NS resulted in a significant reduction of the growth capability of barley plants (Fig. 1) as previously reported by Sharma et al. (2004) and Astolfi et al. (2012). Long-term exposure to 20 µM Cd also resulted in significant decrease in shoot dry matter production (data not shown), likely ascribable to reduced photosynthesis rate related with a decrease in chlorophyll content (Fig. 1). Additional visual symptoms of Cd toxicity were inhibition of root elongation and reduction of root hair number and length (data not shown). The accumulation of Cd was higher at root than at shoot level (Fig. 2), as often observed in higher plants and as reported by other authors (Sandalio et al. 2001, Sharma et al. 2004, Kirkham 2006). Furthermore, under Fe deficiency the accumulation of Cd in roots was significantly higher than in Fe sufficiency condition (Fig. 2). This phenomenon has also been described in rice and barley (Nakanishi et al. 2006, Astolfi et al. 2012), suggesting that the capability to accumulate Cd could depend, at least in part, also on the level of Fe availability in the growth medium. Due to the presence of higher Cd amounts in roots of Fe-deficient plants and to their lower capability to produce thiols, and thus PC (Fig. 2), it was evidenced a substantial accumulation of MDA at root level (Fig. 3). Accumulation of MDA is commonly used to estimate lipid peroxidation, a widely used stress index of plant membranes, which commonly leads to physiological alterations of plasma membrane properties, affecting uptake and transport of mineral nutrients. These results suggest that the Fe-uptake system, that is activated by Fe deficiency, may be involved in the enhanced uptake of Cd under Fe limiting conditions. For this reason, we focused on characterizing at the transcriptional level the regulation of plant Fe-acquisition mechanism as affected by Fe deficiency and/or Cd exposure. The transcriptional responses to Fe deficiency in Strategy II plants are regulated by two specific cis-acting elements, IDE1 and IDE2 (iron deficiency-responsive elements 1 and 2) (Kobayashi et al. 2003). IDEF1 and IDEF2, which specifically bind to IDE1 and IDE2, respectively, were identified as key transcription factors in response to Fe deficiency in rice (Kobayashi et al. 2007, Ogo et al. 2008). Both IDEF1 and IDEF2 are constitutively expressed in different rice tissues, such as roots, leaves,

This article is protected by copyright. All rights reserved

flowers and seeds, and their expression levels are not affected by the Fe nutritional status of the plant (Kobayashi et al. 2007, 2009, Ogo et al. 2008). Under Fe sufficiency and during the early stage of Fe deficiency, IDEF1 positively regulates the majority of the known Fe acquisition/utilization-related genes, such as OsIRO2, OsIRT1, OsYSL15, OsYSL2, OsNAS1, OsNAS2, OsNAS3, OsNAAT1 and OsDMAS1, whereas in late stages of Fe deficiency IDEF1 regulates only a limited subset of the genes involved in Fe uptake, including OsIRO2, OsIRT1 and OsNAS3 (Kobayashi et al. 2009, 2010). At this stage, IDEF1 also regulates another subset of Fe-deficiency-induced genes, such as those encoding for late embryogenesis-abundant proteins (Kobayashi et al. 2009). In contrast to the positive regulation of Fe uptake/utilization-related genes by IDEF1 in the early stages, the bHLH transcription factor OsIRO2 is thought to be especially important for sustaining the induction of the same genes during the late stages of Fe deficiency and in particular during prolonged periods of Fe deprivation (Kobayashi et al. 2009). OsIRO2 expression is strongly induced under Fe deficiency (Ogo et al. 2006) and is positively regulated by IDEF1 (Kobayashi et al. 2009). Overexpression and knockout studies demonstrated that OsIRO2 positively regulates various genes involved in PS synthesis and transport including OsNAS1, OsNAS2, OsNAS3, OsNAAT1, OsDMAS1, OsYSL15 and OsTOM1 but not OsIRT1 (Ogo et al. 2007), suggesting that OsIRO2 is responsible for regulation of PS-mediated Fe uptake, but not for Fe(II) acquisition. More recently the role of another bHLH transcription factor, OsIRO3, in Fe homeostasis has been clarified. OsIRO3 is upregulated under Fe deprivation downstream OsIRO2 and rice plants overexpressing it were hypersensitive to Fe deficiency and accumulated less Fe in shoots than the wild type (Zheng et al. 2010). Moreover, genes normally induced under Fe deprivation, such as OsIRO2, OsNAS1, OsNAS2, OsIRT1, OsYSL15 and OsNramp1 are no longer induced in OsIRO3 overexpressing plants, indicating that this bHLH transcription factor is a negative regulator of the Fe deficiency response in rice (Zheng et al. 2010). In this study, barley plants showed a classical response to Fe-deficiency, as evidenced by the expression of both HvIDEF1 and HvIDEF2, the barley orthologs of OsIDEF1 and OsIDEF2, which was unaffected by the Fe availability, and, on the other hand, by the enhanced expression of both HvIRO2, the barley ortholog of OsIRO2, and HvIRO3, the barley ortholog of the negative regulator of Fe deficiency response in rice OsIRO3 (Fig. 6). In particular, as previously reported by Nagasaka et al. (2009), the up-regulation of HvIRO2 under Fe limiting conditions was accompanied by a significant up-regulation of most genes involved in PS biosynthesis and secretion (Figs. 8 and 9) and by a consequent increased PS release rate (Fig. 4C). Furthermore, the genes encoding four metal transport proteins, HvIRT1, HvNramp2, HvNramp5 and HvNramp7, were up-regulated by Fe deprivation (Fig. 7) and their enhanced expression could reasonably explain higher Zn, Mn and Cu concentrations in roots of -Fe plants (Fig. 5). Similar responses have been observed in rice for OsIRT1 (Bughio et al. 2002, Ishimaru et al. 2006), whereas the expression of OsNramp5 was unaffected by Fe deprivation, although it contributes to Fe transport (Ishimaru et al. 2012). In contrast to what has been observed under the Fe deficiency condition, when plants were

This article is protected by copyright. All rights reserved

exposed to Cd, both HvIDEF1 and HvIDEF2 transcript levels were markedly decreased in roots, irrespective of the Fe nutritional status (Fig. 6), and, as expected on the basis of the gene regulation network mediated by OsIDEF1 in rice in response to Fe deficiency, also HvIRT1, one of HvIDEF1 putative target genes, was down-regulated in response to Cd exposure, suggesting the activation of one of the mechanisms involved in the negative regulation of the genes responsible for the Cd uptake to prevent the accumulation of the metal at toxic levels within the plant. In agreement with this hypothesis, the expression of HvNramp5, the barley ortholog of OsNramp5, which has been identified as the major transporter for Cd and Mn uptake in rice (Sasaki et al. 2012, Ishimaru et al. 2012), was also significantly down-regulated in roots of plants exposed to Cd treatment (Fig. 7). However, while the expression of HvNramp5 in Cd-treated plants decreased at the same level in Fe-sufficient and Fe-deficient conditions, the transcript levels of HvIRT1 remained significantly higher in roots of Fe-deficient plants when compared to sufficient ones. The higher amount of transcripts of HvIRT1 in roots of Fe-deficient plants than in Fe-sufficient ones after Cd treatment might be responsible for the higher Cd accumulation in low-Fe plants (Fig. 2). As previously discussed, the down-regulation of HvIRT1 and HvNramp5 observed in this study after Cd treatment in both Fe sufficient and deficient conditions may represent a protective mechanism at transcriptional level against further Cd uptake by these transporters that seem to be conserved in both Strategy I and Strategy II plants. For instance, in Arabidopsis, transcript and protein levels of IRT1 were down-regulated already after 12 h of Cd supply even under Fe-limiting growth conditions (Connolly et al. 2002). Moreover, the expression of NtIRT1 in tobacco roots under Fe deficiency was higher than that under Cd exposure (Hodoshima et al. 2007). On the other hand, it was reported that the expression of OsNramp5 decreased significantly in both roots and shoots in the presence of Cd (Ishimaru et al. 2012). However, we could not reasonably rule out that this inhibition is only a toxic effect of Cd. As expected, Cd-induced down-regulation of HvIRT1 and HvNramp5 was accompanied by a significant decrease of Fe and Mn concentrations in both shoots and roots of barley plants (Figs. 4 and 5), although the most pronounced effect was observed for Mn, which almost completely dropped after Cd treatment (Fig. 5). These findings, besides supporting a role for HvIRT1 and HvNramp5 as the major Mn transporters in barley, also suggest that the decrease in Fe uptake due to the Cd-induced down-regulation of those transporters, would be possibly balanced by increasing Fe uptake through other components of the Strategy II system (see below). On the other hand, in contrast to that observed for HvIDEF1 and HvIDEF2, and similar to what has been previously described for Fe deficiency, plants exposed to Cd showed an increase in the root transcript levels of HvIRO2, the barley ortholog of OsIRO2, with the highest transcript levels observed in low-Fe plants exposed to the Cd treatment (Fig. 6). As expected on the basis of the gene regulation network controlled by OsIRO2 in rice under Fe limiting conditions, the overexpression of HvIRO2 induced by Cd exposure was accompanied, as previously reported for Fe-deficient plants, by

This article is protected by copyright. All rights reserved

a significant up-regulation of most genes involved in PS biosynthesis and secretion (Figs. 8 and 9) and by a consequent increased PS release rate (Fig. 4C), suggesting that Cd stress can induce an Fedeficiency-like response and that HvIRO2 could play an important role in the regulation of this response independently on HvIDEF1. There is controversy in literature about the effect of Cd on Fe accumulation and consequently on the PS secretion process by roots of grasses. Several authors reported that Fe concentration in plants is reduced as a result of Cd exposure, leading to the appearance of typical Fe deficiency symptoms (Sharma et al. 2004, Kudo et al. 2007, Astolfi et al. 2012, Bao et al. 2012). On the other hand, Hodoshima et al. (2007) showed that Fe concentration in shoots of Cd-exposed barley plants was unaffected after two days treatment, while Liu et al. (2003) found also significant and positive correlations between Cd and Fe content in both roots and shoots of rice plants. The reduced Fe accumulation in plants would cause a higher degree of PS release from roots of plants under Cd toxicity, which in turn may rapidly balance internal Fe concentration by Fe uptake from the external medium. Consistent with this suggestion, results of the present study showed that Cd stress inhibited Fe accumulation in both roots and shoots (Fig. 4A, B) and, as a consequence, increased the PS release rate (Fig. 4C) and the expression levels of genes involved in PS synthesis and secretion (Fig. 8 and 9). Previous findings that Cd exposure is able to increase the amount of PS (DMA) released from maize roots (Hill et al. 2002), although this effect was not associated with a higher Fe-DMA uptake (Meda et al. 2007), support our results. However, in contrast to this pattern, other authors reported that the presence of Cd inhibits PS release (Kudo et al. 2007, Astolfi et al. 2012, Bao et al. 2012) and/or Fe-PS uptake (Meda et al. 2007), leading anyway to a reduced plant capability to acquire Fe. These contrasting reports could be likely the result of differing plant developmental stage and of the severity of Cd stress (metal concentration and treatment length), which affect the extent to which the plant is able to cope with the stress situation and the response pathway. Our experimental data seem consistent with an increased release rate of PS from Cd-treated barley roots most likely attributable to the impaired Fe nutritional status of the plants, confirming previous suggestions (Meda et al. 2007). Why PS release rate is increased after Cd treatment has long been debated. Some authors suggested the possibility of Cd uptake via the PS-dependent pathway (Sharma et al. 2004). It has also been suggested that the increased secretion of PS may represent a protection mechanism against Cd toxicity, thanks to the potential Cd-chelating capability of DMA (Hill et al. 2002). However, later studies showed that PS are not able to efficiently mobilize Cd, due to weak or inefficient complex formation (Meda et al. 2007). On the other hand, it does not appear that PS could play a role in Cd uptake, as demonstrated in maize and barley plants (Meda et al. 2007, Kudo et al. 2007). Consistent with this observation, it has also been clearly demonstrated that HvYS1 is a specific transporter for Fe(III)-PS, unlike ZmYS1 (Murata et al. 2006). The most likely explanation for the reported increased

This article is protected by copyright. All rights reserved

amounts of PS seems to be the activation of the Strategy II mechanism as a response to decreased Fe concentration occurring after Cd treatment. This overall effect was particularly evident in Fesufficient plants where also HvYS1 was overexpressed. Since the activation of PS-based Fe-acquisition mechanism, though being necessary to maintain an adequate Fe nutritional status under Cd exposure, requires a high energy costs, the enhanced expression of HvIRO3, the barley ortholog of the negative regulator of Fe deficiency response in rice OsIRO3, observed under Cd treatment might be at least in part explained as a switch to smart energy utilization allowing plant to keep a balanced uptake of the micronutrient, possibly without hindering an adequate growth. This idea seems to be supported by the transcriptional activation of HvNramp2 and HvNarmp7 following Cd exposure (Fig. 7). The deduced amino acid sequence of HvNramp2 showed the highest level of similarity with that of OsNramp2 from rice (identity of 91%) and AtNramp2 from Arabidopsis (identity of 68%), whereas that of HvNramp7 was more closely related to the predicted protein sequences of OsNramp7 (identity of 86%) and AtNramp3/4 (identity ranging from 71 to 70%) (results not shown). In Arabidopsis, both AtNramp3 and AtNramp4 act as tonoplast localized metal efflux transporters, needed for vacuolar remobilization of Fe and Mn but also contributing to Cd tolerance (Lanquar et al. 2005, 2010, Oomen et al. 2008). nramp3nramp4 double mutant is hypersensitive to Cd (Oomen et al. 2008) in addition to its previously described sensitivity to low Fe supply (Lanquar et al. 2005). It was proposed that nramp3nramp4 hypersensitivity to Cd is related to a general defect in mobilization of essential metals from the vacuole, which would be required for tolerance of toxic levels of the non essential metal Cd (Oomen et al. 2008). In contrast, the function of OsNramp2 and AtNramp2, the putative rice and Arabidopsis orthologs of HvNramp2, is unknown. However, the deduced amino acid sequence of HvNramp2 is identical to a vacuolar membrane protein that is up-regulated in barley plants exposed for 7 day to 20 μM Cd (Schneider et al. 2009). Thus the increased expression of HvNramp2 and HvNarmp7, encoding two putative tonoplast localized metal efflux transporters, observed in this study after Cd treatment in both Fe sufficient and deficient conditions, may be necessary for the mobilization of essential metals such as Fe and Mn from the vacuole to counteract the effects of Cdinduced deficiencies. In conclusion, in this study we demonstrated that Cd exposure decreased Fe concentration in both shoots and roots of barley seedlings, suggesting that also in Strategy II plants Cd interferes with the Fe acquisition and transport mechanism. Our results clearly indicate that Cd exposure under adequate Fe supply can induce an Fe-deficiency like response. Most of the genes involved in PS biosynthesis and secretion (HvNAS3, HvNAS4, HvNAS6, HvNAS7, HvNAAT-A, HvDMAS1 and HvTOM1) induced by Fe deprivation were also significantly up-regulated in presence of Cd under Fe sufficient conditions (Fig. 10). Accordingly, the enhanced expression of these genes in roots under Cd exposure was accompanied by an increase of PS release. However, induced expression of HvIRO2 and downregulation of HvIDEF1 and HvIRT1, after Cd exposure, suggests the presence of a pathway that

This article is protected by copyright. All rights reserved

induces HvIRO2-mediated PS biosynthesis under Cd stress, which probably is not simply caused by Fe deficiency (Fig. 10). The down-regulation of HvIRT1 and HvNramp5, whose orthologous genes OsIRT1 and OsNramp5 have been shown to function as major Cd transporters in rice, may represent a protective mechanism at transcriptional level against further Cd uptake by these transporters. In contrast the up-regulation of genes involved in PS biosynthesis and the consequent increment of their release can improve Fe uptake in the presence of Cd and thereby provides an advantage under Cd stress relative to Fe acquisition via ferrous Fe.

Author contributions SA and MC designed experiments, supervised the study and wrote the manuscript. SA, MRO, GC and ARP performed sample preparation and experimental procedures. SA, MC and RP provided financial support to the study. All authors contributed to the analysis and interpretation of data. SC and RP revised critically the manuscript. All authors read, discussed and approved the final manuscript. Acknowledgements – Research was financially supported by grants from Italian M.I.U.R.-PRIN 2009

References Alcantara E, Romera FJ, Cañete M, De la Guardia MD (1994) Effects of heavy metals on both induction and function of root Fe(III) reductase in Fe-deficient cucumber (Cucumis sativus L.) plants. J Exp Bot 45: 1893–1898 Astolfi S, Cesco S, Zuchi S, Neumann G, Roemheld V (2006) Sulphur starvation reduces phytosiderophores release by Fe-deficient barley plants. Soil Sci Plant Nutr 52: 80–85 Astolfi S, Zuchi S, Chiani A, Passera C (2003a) In vivo and in vitro effects of cadmium on H+ATPase activity of plasma membrane vesicles from oat (Avena sativa L.) roots. J Plant Physiol 160: 387– 393 Astolfi S, Zuchi S, Neumann G, Cesco S, Sanità di Toppi L, Pinton R (2012) Response of barley plants to Fe deficiency and Cd contamination as affected by S starvation. J Exp Bot 63: 1241– 1250 Astolfi S, Zuchi S, Passera C, Cesco S (2003b) Does the sulphur assimilation pathway play a role in the response to Fe deficiency in maize (Zea mays L.) plants? J Plant Nutr 26: 2111–2121 Astolfi S, Zuchi S, Passera C (2004) Role of sulphur availability on cadmium-induced changes of nitrogen and sulphur metabolism in maize (Zea mays L.) leaves. J Plant Physiol 161: 795–802 Astolfi S, Zuchi S, Passera C (2005) Effect of cadmium on H+ATPase activity of plasma membrane vesicles isolated from roots of different S-supplied maize (Zea mays L.) plants. Plant Sci 169: 361–368 Azevedo H, Pinto CGG, Santos C (2005) Cd effects in sunflower: nutritional imbalances in plants and

This article is protected by copyright. All rights reserved

calluses. J Plant Nutr 28: 2221–2231 Bao T, Sun TH, Sun LN (2012) Effect of cadmium on physiological responses of wheat and corn to iron deficiency. J Plant Nutr 35: 1937–1948 Bashir K, Inoue H, Nagasaka S, Takahashi M, Nakanishi H, Mori S, Nishizawa NK (2006) Cloning and characterization of deoxymugineic acid synthase genes from graminaceous plants. J Biol Chem 43: 32395–32402 Brune A, Dietz KJ (1995) A comparative analysis of element composition of barley roots and leaves under cadmium-, molybdenum-, nickel- and zinc-stress. J Plant Nutr 18: 853–868 Bughio N, Yamaguchi H, Nishizawa NK, Nakanishi H, Mori S (2002) Cloning an iron-regulated metal transporter from rice. J Exp Bot 53: 1677–1682 Cailliatte R, Lapeyre B, Briat JF, Mari S, Curie C (2009) The NRAMP6 metal transporter contributes to cadmium toxicity. Biochem J 422: 217–228 Cailliatte R, Schikora A, Briat JF, Mari S, Curie C (2010) High affinity manganese uptake by the metal transporter NRAMP1 is essential for Arabidopsis growth in low manganese conditions. Plant Cell 22: 904–917 Cheng L, Wang F, Shou H, Huang F, Zheng L, He F, Li J, Zhao F-J, Ueno D, Ma JF, Wu P (2007) Mutation in nicotianamine aminotransferase stimulated the Fe(II) acquisition system and led to iron accumulation in rice. Plant Physiol 145: 1647–1657 Clemens S, Aarts MGM, Thomine S, Verbruggen N (2013) Plant science: the key to preventing slow cadmium poisoning. Trends Plant Sci 18: 92–99 Clemens S, Palmgren MG, Kramer U (2002) A long way ahead: understanding and engineering plant metal accumulation. Trends Plant Sci 7: 309–315 Clemens S (2001) Molecular mechanisms of plant metal tolerance and homeostasis. Planta 212: 475– 486 Colangelo EP, Guerinot ML (2006) Put the metal to the petal: metal uptake and transport throughout plants. Curr Opin Plant Biol 9: 322–330 Connolly EL, Campbell NH, Grotz N, Prichard CL, Guerinot ML (2003) Overexpression of the FRO2 ferric chelate reductase confers tolerance to growth on low iron and uncovers post transcriptional control. Plant Physiol 133: 1102–1110 Connolly EL, Fett JP, Guerinot ML (2002) Expression of the IRT1 metal transporter is controlled by metals at the levels of transcript and protein accumulation. Plant Cell 14: 1347–1357 Curie C, Alonso JM, Jean ML, Ecker JR, Briat JF (2000) Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochem J 347: 749–55 Curie C, Panaviene Z, Loulergue C, Dellaporta SL, Briat J-F, Walker EL (2001) Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature 409: 346–349 Faller P, Kienzler K, Liszlay AK (2005) Mechanism of Cd2+ toxicity: Cd2+ inhibited photoactivation of photosystem II by competitive binding to the essential Ca2+ site. Biochim Biophys Acta 1706:

This article is protected by copyright. All rights reserved

158–164 Gao C, Wang Y, Xiao D-S, Qiu C-P, Han D-G, Zhang X-Z, Wu T, Han Z-H (2011) Comparison of cadmium-induced iron-deficiency responses and genuine iron-deficiency responses in Malus xiiaojinensis. Plant Sci 181: 269–274 Gussarson M, Asp H, Adalsteinsson S, Jensén P (1996) Enhancement of Cd effects on growth and nutrient composition of birch (Betula pendula) by buthionine sulphoxinine (BSO). J Exp Bot 47: 211–215 Hebbern CA, Laursen KH, Ladegaard AH, Schmidt SB, Pedas P, Bruhn D, Schjoerring JK, Wulfsohn D, Husted S (2009) Latent manganese deficiency increases transpiration in barley (Hordeum vulgare). Physiol Plant 135: 307–316 Herbik A, Koch G, Mock H-P, Dushkov D, Czihal A, Thielmann J, Stephan UW, Bäumlein H (1999) Isolation, characterization and cDNA cloning of nicotianamine synthase from barley. Eur J Biochem 265: 231–239 Higuchi K, Suzuki K, Nakanishi H, Yamaguchi H, Nishizawa NK, Mori S (1999) Cloning of nicotianamine synthase genes, novel genes involved in the biosynthesis of phytosiderophores. Plant Physiol 119: 471–479 Hill KA, Lion LW (2002) Reduced Cd Accumulation in Zea mays: A Protective Role for Phytosiderophores? Environ Sci Technol 36: 5363–5368 Hodoshima H, Enomoto Y, Shoji K, Shimada H, Goto F, Yoshihara T (2007) Differential regulation of cadmium-inducible expression of iron-deficiency-responsive genes in tobacco and barley. Physiol Plant 129: 622–634 Husted S, Laursen KH, Hebbern CA, Schmidt SB, Pedas P, Haldrup A, Jensen PE (2009) Manganese deficiency leads to genotype-specific changes in fluorescence induction kinetics and state transitions. Plant Physiol 150: 825–833 Ishikawa S, Ishimaru Y, Igura M, Kuramata M, Abe T, Senoura T, Hase Y, Arao T, Nishizawa NK, Nakanishi H (2012) Ion-beam irradiation, gene identification, and marker-assisted breeding in the development of low-cadmium rice. Proc Natl Acad Sci USA 109: 19166–19171 Ishimaru Y, Masuda H, Bashir K, Inoue H, Tsukamoto T, Takahashi M, et al. (2010) Rice metalnicotianamine transporter, OsYSL2, is required for the long-distance transport of iron and manganese. Plant J 62: 379–390 Ishimaru Y, Suzuki M, Tsukamoto T, Suzuki K, Nakazono M, Kobayashi T, et al. (2006) Rice plants take up iron as an Fe3+-phytosiderophore and as Fe2+. Plant J 45: 335–346 Ishimaru Y, Takahashi R, Bashir K, Shimo H, Senoura T, Sugimoto K, et al. (2012) Characterizing the role of rice NRAMP5 in Manganese. Iron and Cadmium Transport. Sci Rep 2: 286 Kirkham MB (2006) Cadmium in plants on polluted soils: effects of soil factors, hyperaccumulation, and amendments. Geoderma 137: 19–32 Kobayashi M, Ogo Y, Nakanishi Itai R, Nakanishi H, Takahashi M, Mori S, Nishizawa NK (2007)

This article is protected by copyright. All rights reserved

The transcription factor IDEF1 regulates the esponse to and tolerance of iron deficiency in plants. Proc Natl Acad Sci USA 104: 19150–19155 Kobayashi T, Itai RN, Ogo Y, Kakei Y, Nakanishi H, Takahashi M, Nishizawa NK (2009) The rice transcription factor IDEF1 is essential for the early response to iron deficiency, and induces vegetative expression of late embryogenesis abundant genes. Plant J 60: 948–961 Kobayashi T, Nakayama Y, Nakanishi Itai R, Nakanishi H, Yoshihara T, Mori S, Nishizawa NK (2003) Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants. Plant J 36: 780–793 Kobayashi T, Nishizawa NK (2012) Iron uptake, translocation, and regulation in higher plants. Ann Rev Plant Biol 63: 1–22 Kobayashi T, Ogo Y, Aung MS, Nozoye T, Nakanishi Itai R, Nakanishi H, Yamakawa T, Nishizawa NK (2010) The spatial expression and regulation of transcription factors IDEF1 and IDEF2. Ann Bot 105: 1109–1117 Kudo K, Kudo H, Kawai S (2007) Cadmium uptake in barley affected by iron concentration of the medium: Role of phytosiderophores. Soil Sci Plant Nutr 53: 259–266 Lanquar V, Lelievre F, Bolte S, Hames C, Alcon C, Neumann D, Vansuyt G, Curie C, Schröder A, Krämer U, Barbier-Brygoo H, Thomine S (2005) Mobilization of vacuolar iron by AtNRAMP3 and AtNRAMP4 is essential for seed germination on low iron. EMBO J 24: 4041–4051 Lanquar V, Ramos MS, Lelièvre F, Barbier-Brygoo H, Krieger-Liszkay A, Krämer U, Thomine S (2010) Export of vacuolar manganese by AtNRAMP3 and AtNRAMP4 is required for optimal photosynthesis and growth under manganese deficiency. Plant Physiol 152: 1986–1999 Lee S, Jeon US, Lee SJ, Kim YK, Persson DP, Husted S, Schjørring JK, Kakei Y, Masuda H, Nishizawa NK, An G (2009) Iron fortification of rice seeds through activation of the nicotianamine synthase gene. Proc Natl Acad Sci USA 106: 22014–22019 Liu J, Liang J, Li K, Zhang Z, Yu B, Lu X, Yang J, Zhu Q (2003) Correlations between cadmium and mineral nutrients in absorption and accumulation in various genotypes of rice under cadmium stress. Chemosphere 52: 1467–1473 Lopez-Millan AF, Ellis DR, Grusak MA (2004) Identification and characterization of several new members of the ZIP family of metal ion transporters in Medicago truncatula. Plant Mol Biol 54: 583–596 Lux A, Martinka M, Vaculik M, White PJ (2011) Root responses to cadmium in the rhizosphere: a review. J Exp Bot 62: 21–37 Marschner H, Römheld V (1994) Strategies of plants for acquisition of iron. Plant Soil 165: 275–283 Meda AR, Scheuermann EB, Prechsl UE, Erenoglu B, Schaaf G, Hayen H, Weber G, von Wiren N (2007) Iron Acquisition by Phytosiderophores Contributes to Cadmium Tolerance. Plant Physiol 143: 1761–1773

This article is protected by copyright. All rights reserved

Morrissey J, Baxter IR, Lee J, Li L, Lahner B, Grotz N, Kaplan J, Salt DE, Guerinot ML (2009) The ferroportin metal efflux proteins function in iron and cobalt homeostasis in Arabidopsis. Plant Cell 21: 3326–3338 Murata Y, Ma JF, Yamaji N, Ueno D, Nomoto K, Iwashita T (2006) A specific transporter for iron(III)-phytosiderophore in barley roots. Plant J 46: 563–572 Nagasaka S, Takahashi M, Nakanishi-Itai R, Bashir K, Nakanishi H, Mori S, Nishizawa NK (2009) Time course analysis of gene expression over 24 hours in Fe-deficient barley roots. Plant Mol Biol 69: 621–631 Nakanishi H, Ogawa I, Ishimaru Y, Mori S, Nishizawa NK (2006) Iron deficiency enhances cadmium uptake and translocation mediated by the Fe2+ transporters OsIRT1 and OsIRT2 in rice. Soil Sci Plant Nutr 52: 464–469 Nozoye T, Nagasaka S, Kobayashi T, Takahashi M, Sato Y, Sato Y, Uozumi N, Nakanishi H, Nishizawa NK (2011) Phytosiderophore efflux transporters are crucial for iron acquisition in graminaceous plants. J Biol Chem 286: 5446–5454 Ogawa I, Nakanishi H, Mori S, Nishizawa NK (2009) Time course analysis of gene regulation under cadmium stress in rice. Plant Soil 325: 97–108 Ogo Y, Itai RN, Nakanishi H, Inoue H, Kobayashi T, Suzuki M, Takahashi M, Mori S, Nishizawa NK (2006) Isolation and characterization of IRO2, a novel iron-regulated bHLH transcription factor in graminaceous plants. J Exp Bot 57: 2867–2878 Ogo Y, Itai RN, Nakanishi H, Kobayashi T, Takahashi M, Mori S, Nishizawa NK (2007) The rice bHLH protein OsIRO2 is an essential regulator of the genes involved in Fe uptake under Fedeficient conditions. Plant J 51: 366–377 Ogo Y, Kobayashi T, Nakanishi Itai R, Nakanishi H, Kakei Y, Takahashi M, Toki S, Mori S, Nishizawa NK (2008) A novel NAC transcription factor, IDEF2, that recognizes the iron deficiency-responsive element 2 regulates the genes involved in iron homeostasis in plants. J Biol Chem 283: 13407–13417 Oomen RJFJ, Wu J, Lelievre F, Blanchet S, Richaud P, Barbier-Brygoo H, Aarts MGM, Thomine S (2009) Functional characterization of NRAMP3 and NRAMP4 from the metal hyperaccumulator Thlaspi caerulescens. New Phytol 181: 637–650 Pedas P, Ytting CK, Fuglsang AT, Jahn TP, Schjoerring JK, Husted S (2008) Manganese Efficiency in Barley: Identification and Characterization of the Metal Ion Transporter HvIRT1.Plant Physiol 148: 455–466 Reichman SM, Parker DR (2006) Critical evaluation of three indirect assays for quantifying phytosiderophores released by the roots of Poaceae. Eur J Soil Sci 28: 844–853 Rogers EE, Eide DJ, Guerinot ML (2000) Altered selectivity in an Arabidopsis metal transporter. Proc Natl Acad Sci USA 97: 12356–12360 Sandalio LM, Dalurzo HC, Gomez M, Romero-Puertas MC, del Rio LA (2001) Cadmium-induced

This article is protected by copyright. All rights reserved

changes in the growth and oxidative metabolism of pea plants. J Exp Bot 52: 2115–2126 Sanità di Toppi L, Gabbrielli R (1999) Response to cadmium in higher plants. Env Exp Bot 41: 105– 130 Sasaki A, Yamaji N, Yokosho K, Ma JF (2012) Nramp5 Is a major transporter responsible for manganese and cadmium uptake in rice. Plant Cell 24: 2155–2167 Schaaf G, Honsbein A, Meda AR, Kirchner S, Wipf D, von Wiren N (2006) AtIREG2 encodes a tonoplast transport protein involved in iron-dependent nickel detoxification in Arabidopsis thaliana roots. J Biol Chem 281: 25532–25540 Schneider T, Schellenberg M, Meyer S, Keller F, Gehrig P, Riedel K, Lee Y, Eberl L, Martinoia E (2009) Quantitative detection of changes in the leaf-mesophyll tonoplast proteome in dependency of a cadmium exposure of barley (Hordeum vulgare L.) plants. Proteomics 9: 2668–2677 Sharma SS, Kaul S, Metwally A, Goyal KC, Finkemeier I, Dietz K-J (2004) Cadmium toxicity to barley (Hordeum vulgare) as affected by varying Fe nutritional status. Plant Sci 166: 1287–1295 Takahashi R, Ishimaru Y, Nakanishi H, Nishizawa NK (2011) Role of the iron transporter OsNramp1 in cadmium uptake and accumulation in rice. Plant Signal Behav 6: 1813–1816 Takahashi M, Yamaguchi H, Nakanishi H, Shioiri T, Nishizawa NK, Mori S (1999) Cloning two genes for nicotianamine aminotransferase, a critical enzyme in iron acquisition (strategy II) in graminaceous plants. Plant Physiol 121: 947–956 Thomine S, Wang R, Ward JM, Crawford NM, Schroeder JI (2000) Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proc Natl Acad Sci USA 97: 4991–4996 Ueno D, Yamaji N, Ma JF (2009) Further characterization of ferric–phytosiderophore transporters ZmYS1 and HvYS1 in maize and barley. J Exp Bot 60: 3513–3520 Uraguchi S, Fujiwara T (2013) Rice breaks ground for cadmium-free cereals. Curr Opin Plant Biol 16: 328–334 Vert G, Grotz N, Dedaldechamp F, Gaymard F, Guerinot ML, Briat JF, Curie C (2002) IRT1, an Arabidopsis transporter essential for iron uptake from the soil and for plant growth. Plant Cell 14: 1223–1233 Vert G, Briat JF, Curie C (2001) Arabidopsis IRT2 gene encodes a root-periphery iron transporter. Plant J 26: 181–189 Wagner GJ (1993) Accumulation of cadmium in crop plants and its consequences to human health. Adv Agr 51: 173–212 Yoshihara T, Hodoshima H, Miyano Y, Shoji K, Shimada H, Goto F (2006) Cadmium inducible Fe deficiency responses observed from macro and molecular views in tobacco plants. Plant Cell Reports 25: 365–373 Zheng L, Ying Y, Wang L, Wang F, Whelan J, Shou H (2010) Identification of a novel iron regulated basic helix-loop-helix protein involved in Fe homeostasis in Oryza sativa. BMC Plant Biol 10:

This article is protected by copyright. All rights reserved

166 Zuchi S, Cesco S, Astolfi S (2012) High S supply improves Fe accumulation in durum wheat plants grown under Fe limitation. Env Exp Bot 77: 25–32

Edited by K.-J. Dietz

This article is protected by copyright. All rights reserved

Table 1. Primer pairs used in RT-PCR analyses. Gene primer

Accession number TM (°C)

HvIDEF1

AB527005 GTGAAACGGTTGACGCTCTTC AGTCCTCTTGGATTGCGAACC AB362161 TCTGGTCTCCCTCCAATGTC GGTCTTCCATGGTTGGGTTC AB206536 CCGCAAGATCAGCCACAA CCTTCTGCGTCAGGGCATT AK365165 CGTCCTGCAAGCACAGTT TGCTCAGCTGCATATATCCAC EU545802 CGTTCAGGTTCTGGAGATGG ATTTGGCCATGACGGACA AK355315 GGGTTGTTAGCGTCTGGACA GCGAGAATACAGCGTGGTG AK364374 TTTCTCAGCACGAGCTTCA ACACGTATACACGGTCGCA AK375649 TGGCTCAATGTGCTTCAATC GAATGAACGCGAAGCTGTT AB683951 GGGAAGTAGAAATGTCTGGTGA GGTTAGCACAAGCCCAATTAC AB214183 TGCTGGCACCTTGGTTAAG CCTACAAGGAATGGAACTGCC AB011264 GTTCCTGTACCCGATTGTCG ACTTCGGCGTTGGCAAAC AB011266 ACAAGGCCAAGGTGATCGC ACTTCCGCGTTGGCAAAC AF136941 GGTTCCTCTACCCGATCGTC CCACACACGTCCACCTTCA AB019525 GGTTCCTCTACCCGATCGT TCTCTCTTCTGGGTCACGTCT D88273 TCGTGGATAGTGCCTGGA CAGAATGATTTGACCCTTTCG AB269907 GCGTCGCCAATTTCTCCT GCTCCTCGAGGGACTTGTAA AY145451 CGGACTCCCTTATGAAGATC AAGTGCTGAGTGAGGCTAGGA AY552749 CAACTGCGAAAGCATTTGC TTAGCAGGCTGAGGTCTCGT

HvIDEF2 HvIRO2 HvIRO3 HvIRT1 HvNramp2 HvNramp5 HvNramp7 HvTOM1 HvYS1 HvNAS3 HvNAS4 HvNAS6 HvNAS7 HvNAAT-A HvDMAS1 HvActin Hv18S

Forward primer Amplicon length (bp)

This article is protected by copyright. All rights reserved

TM (°C) 62.1 62.8 60.0 61.5 62.0 62.6 58.5 58.9 60.6 60.9 61.1 60.4 58.4 58.6 59.8 59.0 58.2 59.5 58.2 59.8 60.4 62.0 62.5 62.2 60.9 61.7 59.0 59.0 58.7 59.6 61.3 59.4 60.3 59.8 60.5 60.2

Reverse

491 493 509 418 454 483 393 520 582 345 283 343 308 241 479 459 498 415

Figure legends Fig 1. Shoot (A) and root (B) fresh weight and values of SPAD index (C) of barley seedlings grown for 11 days under low (5 µM FeIII-EDTA) or sufficient (100 µM FeIII-EDTA) Fe supply, with or without 20 µM Cd addition. Data are means ± SD of four independent replications. Significant differences between samples are indicated by different letters (P < 0.01) (n = 4) Fig 2. Cadmium concentration in shoots (A) and roots (B) and thiols production in shoots (C) and roots (D) of barley seedlings grown for 11 days under low (5 µM FeIII-EDTA) or sufficient (100 µM FeIII-EDTA) Fe supply, with or without 20 µM Cd addition. Statistics as in Fig. 1. Fig 3. MDA levels in roots of barley seedlings grown for 11 days under low (5 µM FeIII-EDTA) or sufficient (100 µM FeIII-EDTA) Fe supply, with or without 20 µM Cd addition. Statistics as in Fig. 1. Fig 4. Iron concentration in shoots (A) and roots (B) and PS release (C) from roots of barley seedlings grown for 11 days under low (5 µM FeIII-EDTA) or sufficient (100 µM FeIII-EDTA) Fe supply, with or without 20 µM Cd addition. Statistics as in Fig. 1. Fig 5. Zn, Mn and Cu concentrations in shoots (A, C, E) and roots (B, D, F) of barley seedlings grown for 11 days under low (5 µM FeIII-EDTA) or sufficient (100 µM FeIII-EDTA) Fe supply, with or without 20 µM Cd addition. Statistics as in Fig. 1. Fig 6. Expression analysis by RT-PCR of the transcription factor genes HvIDEF1, HvIDEF2, HvIRO2 and HvIRO3 in roots of barley seedlings grown for 11 days under low (5 μM FeIII-EDTA) and sufficient (100 μM FeIII-EDTA) Fe supply with or without 20 μM Cd. 18S and Actin cDNAs were also amplified as internal controls. M: part of the DNA molecular weight marker XIV 100 bp ladder (Roche); the most intense band is 500 bp in length. Fig 7. Expression analysis by RT-PCR of genes coding for metal transporters (HvIRT1, HvNramp2, HvNramp5 and HvNramp7) in roots of barley seedlings grown for 11 days under low (5 μM FeIIIEDTA) and sufficient (100 μM FeIII-EDTA) Fe supply with or without 20 μM Cd. 18S, Actin and M as in Fig.6. Fig. 8. Expression analysis by RT-PCR of genes coding for nicotianamine synthase (HvNAS3, HvNAS4, HvNAS6 and HvNAS7), nicotianamine aminotransferase (NAAT-A) and 2’deoxymugineic

This article is protected by copyright. All rights reserved

acid synthase (DMAS1) in roots of barley seedlings grown for 11 days under low (5 μM FeIII-EDTA) and sufficient (100 μM FeIII-EDTA) Fe supply with or without 20 μM Cd. 18S, Actin and M as in Fig.6. Fig. 9. Expression analysis by RT-PCR of genes coding for phytosiderophore efflux (HvTOM1) and ferric-phytosiderophore influx (HvYS1) transporters in roots of barley seedlings grown for 11 days under low (5 μM FeIII-EDTA) and sufficient (100 μM FeIII-EDTA) Fe supply with or without 20 μM Cd. 18S, Actin and M as in Fig.6. Fig. 10. Model of the regulatory mechanism involved in the response to Fe deficiency and Cd toxicity in barley roots. Both Fe limitation and Cd exposure initiate a secondary response triggered by HvIRO3 most likely to repress the up-regulation of genes involved in PS synthesis and secretion. The expression level of HvIDEF1 was not affected by the Fe nutritional status of the plants, whereas the same gene is down-regulated by Cd exposure. Dotted line indicate unknown regulatory pathway induced by Cd exposure; ovals indicate transcription factors.

This article is protected by copyright. All rights reserved

c

a

0,4

0,2

b

b

0

0,6

c a

0,4

0,2

C

Root FW

0,8

b

b

0 5 100 Fe supply [µM]

5 100 Fe supply [µM]

This article is protected by copyright. All rights reserved.

SPAD units

-1

Shoot plant-1) g (g plant

0,6

B

control +Cd

Shoot FW

-1 -1 Root plant ) g (g plant

A 0,8

50 40 30 20 10 0

SPAD readings

a b

c b

5 100 Fe supply [µM]

A a

B

control Cd-treated

Cd

b

80 60 40 20

ppm RootµCd (mg kg-1) mol g -1FW

g -1FW µ mol ppm Shoot Cd (mg kg-1)

100

0

Thiols

600

a

a

200 0 5

100

control Cd-treated

Cd

b

5

c

b 400

a

100

Fe supply

nmol (nmol g -1 FWg-1 FW) Root thiols

C 800

-1

nmol (nmol g FWg-1 FW) Shoot thiols

5

3500 3000 2500 2000 1500 1000 500 0

D

100

Fe supply Thiols

800 600

b

400 200

a

a

a

0

Fe supply [ µ M]

Fig. 2

This article is protected by copyright. All rights reserved.

5

100 Fe supply [ µ M]

levels Root MDA (mg g-1 FW) mg g-1 FW

control +Cd

Root MDA content

0.03

0.02

b c

0.01

a

a 0 5 Fe supply [µ M]

Fig. 3

This article is protected by copyright. All rights reserved.

100

b

100 80 60

a

control Cd-treated

a a

40 20 0 5

Fe supply (µM)

100

B

Fe

800

b

control Cd-treated

600

c

400 200

a

a

0 5

Fe supply (µM)

Fig. 4

This article is protected by copyright. All rights reserved.

100

g -1FW µ mol PS release (µmol g-1 FW)

Fe

ppm mol g -1FW ShootµFe (mg kg-1)

ppm ShootµFe (mg kg-1) mol g -1FW

A 120

C 0.5

PS release

0.4

b

control Cd-treated

0.3 0.2

a c

0.1

a

0 5

Fe supply (µM)

100

a c

300 200 150

a

a b

b

50

control Cd-treated

Mn

a

c

200 150 100 50

b

b

control Cd-treated

Cu

80 60

a

a b

b

0

5 100 Fe supply ( µ M)

F Root Cuppm (mg kg-1)

ppm Shoot Cu (mg kg-1)

5 100 Fe supply ( µ M)

0

100

20

c

c

250

5 100 Fe supply ( µ M)

E

40

a

300

0

control Cd-treated

b Zn

D

control Cd-treated

Mn

250

100

350 300 250 200 150 100 50 0

5 100 Fe supply ( µ M)

C Shoot Mnppm (mg kg-1)

b

b

ppm Root Zn (mg kg-1)

B control Cd-treated

Zn

Root Mnppm (mg kg-1)

ppm Shoot Zn (mg kg-1)

A 350 300 250 200 150 100 50 0

800 700 600 500 400 300 200 100 0

5 100 Fe supply ( µ M)

Fig. 5

This article is protected by copyright. All rights reserved.

a

control Cd-treated

Cu

a b

b

5 100 Fe supply ( µ M)

5

100

C +Cd

C +Cd

[µM Fe]

HvIDEF1 HvIDEF2 HvIRO2 HvIRO3 18S Actin

Fig. 6

This article is protected by copyright. All rights reserved.

M

5

100

C +Cd

C +Cd

HvIRT1 HvNramp2 HvNramp5 HvNramp7 18S Actin

Fig. 7

This article is protected by copyright. All rights reserved.

[µM Fe]

M

5

100

C +Cd

C +Cd

[µM Fe]

HvNAS3 HvNAS4 HvNAS6 HvNAS7 HvNAAT-A HvDMAS1 18S

Actin

Fig. 8

This article is protected by copyright. All rights reserved.

M

5

100

C +Cd

C +Cd

[µM Fe]

HvTOM1 HvYS1 18S

Actin

Fig. 9

This article is protected by copyright. All rights reserved.

M

-Fe

HvNramp2 HvNramp7

+Cd

HvNramp5 ?

HvIDEF1

HvIDEF1

HvIRO2 HvIRT1

HvIRT1 HvNAS3, HvNAS4, HvNAS6, HvNAS7, HvNAAT-A, HvDMAS1, HvTOM1, HVYS1

Fig. 10

This article is protected by copyright. All rights reserved.