Proc. Nati. Acad. Sci. USA Vol. 89, pp. 11683-11687, December 1992 Biochemistry

The PR264/c-myb connection: Expression of a splicing factor modulated by a nuclear protooncogene (splicing factor SC35/transactivation/differentiation/hematopoiesis)

ALAIN SUREAU*, JOHANN SORET*, MICHEL VELLARD*, JANINE CROCHET*, AND BERNARD PERBAL*tt *Laboratoire d'Oncologie Virale et Molculaire, Batiment 110, Institut Curie, Centre Universitaire, 91405 Orsay Cedex, France; and Diderot), Paris, France

tUniversitd Paris 7 (Denis

Communicated by Bernard Roizman, August 19, 1992

ABSTRACT We have previously reported that expression of the c-myb gene in normal avian thymic cells proceeds through the intermolecular recombination of ET (thymusspecific) and c-myb coding sequences, thereby generating a novel type of c-myb product. Antisense transcripts expressed from the ET locus encode the extremely well-conserved splicing factor PR264/SC35. We now show that the human PR264 promoter sequences contain several myb-recognition elements that efficiently interact in vito with the c-myb DNA-binding domain. Moreover, expression from the PR264 promoter is transactivated, both in vitro and in cultured cells, by different c-myb products. Thus, the PR264 gene is most likely a physiological target for the c-myb family of transcription factors.

The c-myb protooncogene is preferentially expressed in immature hematopoietic cells (1), where it is thought to regulate cellular proliferation and differentiation (2) by controlling transcription of developmentally important genes (3). Thus far, several genes have been identified as targets for the myb transactivating properties, including the promyelocytespecific mim-J gene (4), whose function and role in development are unknown, the CD4 glycoprotein gene (5), the c-myc protooncogene (6, 7), and c-myb itself (8). We have previously reported that c-myb expression in avian thymic cells involves the intermolecular recombination of ET (thymus-specific) and c-myb coding sequences transcribed from genetic loci located on distinct chromosomes, both in chicken and in human (9). In both species, the ET region is bidirectionally transcribed, and the antisense mRNAs code for an extremely well-conserved protein (PR264) representing a member of the arginine/serine-rich splicing factor family (10). We proposed that PR264 could play a role in the trans-splicing of ET and c-myb sequences (10). More recently, the characterization of cDNA clones encoding the mammalian SC35 essential splicing factor, which is required for the first step in the splicing reaction and for spliceosome assembly, established that SC35 is encoded by the PR264 gene (11). In chicken, expression of the different PR264 mRNAs is developmentally regulated, and one of the mRNAs is preferentially detected in hematopoietic cells (10). To determine the molecular basis of these regulatory processes, we have characterized the various PR264 mRNA species and analyzed the promoter sequences responsible for their expression in human cells.§

MATERIALS AND METHODS

quencing and sequence data treatments were performed as described (10). Cell Culture Conditions. HEL-1 (12) and HeLa cells were grown in Dulbecco's modified Eagle's medium (GIBCO/ BRL) supplemented with 10o newborn calf serum and 10%o fetal bovine serum, respectively. HL-60 (ATCC CCL 240) and CCRF-CEM (ATCC CCL 119) cells were grown in RPMI 1640 medium (GIBCO/BRL) supplemented as recommended by the supplier. Differentiation of HL-60 cells was induced by treatment with 1.3% (vol/vol) dimethyl sulfoxide (DMSO) for 60 hr or 6 nM phorbol 12-myristate 13-acetate ("tetradecanoylphorbol acetate," TPA) for 36 hr. RNA Purification and Analysis. Thymic mRNAs were purified from a surgery sample from a 1-week-old girl (10). Polyadenylylated species were selected on mRNA separator columns (Clontech). Northern blotting and hybridization conditions were as described (10, 13). Blot Hybridization. The 650-base-pair (bp) PR264-specific probe obtained by EcoRI-Bgl II digestion of the HPR5 clone contains the PRE1 (PR264 exon 1) coding sequences and the 5'-proximal coding sequences of the PRE2 exon (10). The 700-bp EcoRI-EcoRI c-myb-specific probe was derived from a human c-myb cDNA and corresponds to the coding sequences of the first six c-myb exons. The human glyceraldehyde-3-phosphate dehydrogenase (G3PDH)-specific probe was purchased from Clontech. Autoradiograms were scanned with an Ultroscan XL densitometer (LKB-Pharmacia). RNase Protection Analyses. The 1.4-kilobase (kb) Nco I-HindIlI fragment containing the promoter sequences of the human PR264 gene was inserted into the pBluescript KS(+) vector (Stratagene). After linearization at the Sma I restriction site, in vitro transcription was performed with T7 RNA polymerase (New England Biolabs). Samples of poly(A)+ RNA (3 ,ug) were hybridized overnight at 50°C with 3 ng of [a-32P]UTP-labeled probe. RNARNA hybrids were then digested with RNase A and RNase T1 (14) and analyzed in a 6% polyacrylamide sequencing gel. Transfection and Chloramphenicol Acetyltransferase (CAT) Assays. The pR264cat reporter plasmid was constructed by subcloning the 1097-bp HindIII-Stu I fragment, which contains the PR264 promoter sequences, into the pBL CAT5 vector (28). Transfection of HeLa cells (5 x 104 per 35-mm tissue culture dish), extract preparation, and CAT assays were as described (15, 16). The SVmyb expression vector was obtained by subcloning the Xho I-Xho I fragment of the chicken thymic cDNA (17) into the pSVL vector (Pharma-

cDNA Library Screening and Nucleotide Sequencing. The human bone marrow cDNA library (Clontech) was screened with the 32P-labeled H230 genomic probe (9). Dideoxy se-

Abbreviations: CAT, chloramphenicol acetyltransferase; DMSO, dimethyl sulfoxide; TPA, "tetradecanoylphorbol acetate" (phorbol 12-myristate 13-acetate); G3PDH, glyceraldehyde-3-phosphate dehydrogenase; ISRE, interferon stimulation response element; MRE,

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

tTo whom reprint requests should be addressed. §The sequence reported in this paper has been deposited in the

myb-recognition element.

GenBank data base (L03693).

11683

11684

Biochemistry: Sureau et al.

Proc. Natl. Acad. Sci. USA 89 (1992)

A J HindIII AAGCTTTTTAGATTCCGGGGACATTTTGGCTCAGCTCTGCCGGAGGCAGCAGCCCAGGGCAGTCAGCTCTCCTCGGGGCGAAGCCACTGACAATCCTGGAGAAAGAAhCAruk24902GM -924

TTCGAAAAATCTAAGGCCCCTGTAAAACCGAGTCGAGACGGCCTCCGTCGTCGGGTCCCGTCAGTCGAGAGGAGCCCCGCTTCGGTGACTGTTAGGACCTCTTTCTTTACTCTAM= C

K

GATCGGAACCCCAGGTTTAGGGCGAAGTTCTCCC ACCTAGCCTTGGGGTCCAAATCCCGCTTCAAGAGGG

AGATGTAGGAGCCAGG

ACCTCTTCCGTCTACATCCTCGGTCCG

CGAT TCGCTA

-804

-684 SmaI CC TCCCAGCCTGACTCAC TGCGGCCAGGCGACCGGGTCACCTGACCGCAGCCGCGGCGCCGGCCGC TCGGCCCGCTGGGAAACGTAG TCCCGGGTGACC TGGCACGCGCAAGCGCTCGGC GGAGGGTCGGACTGAGTGACGCCGGTCCGC TGGCCCAGTGGACTGGCGTCGGCGCCGCGGCCGGCGAGCCGGGCGACCCTTTGCATCAGGGCCCACTGGACCGTGCGCGTTCGCGAGCCG GG GGAG TCCCCACCGCCAGGACGCAGAGCC GACGGAGC TC TCGGGCTCTGGCGAAAGGGGGTTGGGAAGCGGACTCCGGC GAAGAGCAGTCAGGAACGGCTGGACGGGGCCGAGAGACGA CCCC TCAGGGGTGGCGGTCCTGCGTCTCGGCTGCCTCGAGAGCCCGAGACCGCTTTCCCCCAACCCTTCGCCTGAGGCCGCTTCTCGTCAGTCCTTGCCGACCTGCCCCGGCTC TCTGCT

-524

-444

CGCAGCGGAGTCTGAGGGGGCCGGGGTCACAGGGAGAGGCAAATGAGGGCAGAAGCACTCTTCAGACGGAGACGGG

I AAA _ GACMWATTGGC GCGTCGCCTCAGAC TCCCCCGGCCCCAG TGTCCCTCTCCG TTTAC TCCC GTC TTCGTGAGAAGTCTGCCTC TGCCCCGAC TGCCGAC TC =I CmkC2a="CATAACCG

-324

B 11 ATGAAAAAAAGGTGGGGGCCCAGATGGGGAGCACC TCCTC TTCCTCCTGCCCAATCGCGATCGTCCGGCCTCCCAGG GGGOCICCC2h== G~~~~~~ cc AA= TACCCCTCGTGGAGGAGAAGGAGGACGGGTTAGCGCTAGCAGGCCGGAGGGTCC TACTTTTTTTCCACCCCCGGGTC

-204

GGGCGCGGTGGGC GGAGGTCGGCACTGAGGCGCGAAAAACCGGGCGGGCGGCCCGACACGCG TCCGCGAAGCCCAT -----CCCCGCGCCACCCG

GCTCCCCCTCCCTCCAGCCGTGACTCCGCGCTTTTTGGCCCGCCCGCCGGGCTGTGCGCAGGc

.A_ A TATA Box-- _. CAAT Box ISRE GCGC TAGCC TGCGGAGCCCG lC CAATCAGAAGGTCA2 =GGGTGGCGCGGGCGCCATTTTGTGAG ~:XCGGCTGCCC GTTAGTCTTCC-:A CCACCGCGCCCGCGGTAAAACACTCClGTTI~ZCCTCTCCGGCCGACGOCOgQAAlWCCACGCGATCGGACGCCTCGGGC

-84

-

+37

+1

D B StuI u GCGGCGTCGCACCGCCCAGAGCTGAGGAAGGCCCATC=O=GGGCTCCGG TCCGTGCTGTTCTGCGGCAAGGCCTTTCCCAGTGTCCCCACGCG AGGCACGACAAGACGCCGTTCCGGAAAGGG TCACAGGGGTGCGCCTSGTGCGCACTCCGCGCCGCAGCGTGGCGGGTCTCGACTCCTT T=CCCWAACCCCCGAGGCC

+157

GCCGCCACTCAGAGCTA!ISAGCTACGGCCGCCCCCCTCCCGATGTGGAGGGTATGACCTCCCTCAAGGTGGACAACCTGACCTACCGCACCTCGCCCGACACGC TGAGGCGCGTCTTCGA +277 CGGCGGTGAGTCTCGATACTCGATGCCGGCGGGGGGAGGGCTACACCTCCCATACTGGAGGGAGTTCCACCTGTTGGACTGGATGGCGTGGAGCGGGCTGTGCGACTCCGCGCAGAAGCT

i J-1

13

'.

- - - - - -I

:, ...

r

I

I \=

FIG. 1. (A) Nucleotide sequence of the human PR264 promoter region. The PR264 translation initiation codon is indicated by stars. The general transcription signals (TATA and CAAT) and the interferon stimulation response element (ISRE) are indicated in bold. For each of the 11 myb-recognition elements (MREs A-K), the consensus myb-binding site is underlined and the regions protected in footprint experiments are shown in bold on both strands. The potential transcription start sites mapped with RNase protection are overlined with a dashed line. The arrowhead indicates the transcription start site identified by primer extension analysis and defines the + 1 position of nucleotide numbering. (B) RNase mapping of PR264 potential transcription start sites. The origin of the RNAs analyzed by RNase protection is indicated. The "RP" and "RD" protected fragments are represented under the schematic drawing of the PR264 promoter. Hinfl-digested pBR322 DNA was end-labeled with T4 polynucleotide kinase and used as "molecular weight" markers (MW). Nt, nucleotides.

cia). The Bmyb clone was derived from SVmyb by deletion of the 5'-proximal coding sequences located upstream to the Eag I site. Bandshift Assays and DNase I Footprinting. Bandshift assays were performed by incubating the c-myb R2R3 polypeptide (18) and end-labeled double-stranded oligonucleo-

tides for 10 min at 0°C in 25 ,ul of 20% (vol/vol) glycerol/50 mM KCI/20 mM Hepes, pH 7.9/5 mM MgCl2/0.1 mM EDTA/1 mM dithiothreitol with poly(dI-dC) at 40 jg/ml. Complexes were resolved in a 7% polyacrylamide gel run in 0.5x TBE (45 mM Tris/45 mM boric acid/1 mM EDTA) and revealed by autoradiography. DNase I footprinting was per-

Proc. NatL Acad. Sci. USA 89 (1992)

Biochemistry: Sureau et al.

11685

A o

_^ini~

.ow

-! j.T^1iI

R2R3

abei'ed

_

U

MO

FIG. 2. (A) Bandshift analysis of PR264 MREs. Double-stranded oligonucleotides containing the A, B, or C MRE were tested in direct bandshift experiments (Right) and in competition assays with the strong mim MRE (4) (Left). Foreach experiment, 0.2 ng of labeled oligonucleotide was incubated with 0.3 pmol of myb R2R3 polypeptide. The molar excess of unlabeled oligonucleotide used in competition assays is indicated. MRE mut, which contained a mutated myb consensus binding site, was used as a negative control. In the following oligonucleotide sequences, only the positive strand is shown, and wild-type or mutated myb consensus binding sequences are in uppercase letters. MRE-A, tcgagctgcccgccCAGTTGttacttag; MRE-B, tcgctttcCAAC-

i--.

-

MR

cam b ean

13 i

) X

--v,15a*a&?

_w.wmm

a .-

U

I..^ I

I 4 *0

f

aw

IA .

or

I:.: eSac

In

ba

A a

aA

I

I I0 is

..,

Iu

:jiI

li

II 3

I

..... ... a x

8'"a.

.A.

t

A

IGi

K

W.

a

1.

14

TGcccgctaatt; MRE-C, tcgatccccaccggCAGTTAggatactc; MRE-mim, cacattaTAACOCttttttagc; MRE-mut, cacattaTATGCCacttttttag. (B) Foot-

pt analysis of the PR264 promoter region. Asymmetrically labeled probes containing the PR264 promoter sequences were incubated without (lanes 0) or with 1.6 nM, 16 nM, 160 nM, 1.6 gM, or 3.2 FM R2R3 polypeptide and then subjected to DNase I degradation. Sequence ladders of the DNA probes (A/G, C/T) were prepared (7). Of the two strands analyzed for each DNA probe, only one is presented here. Position and length of the protected regions are indicated by vertical lines on the right l)} of each autoradiogram. Nucleotide numbering is as in Fig. 1A. (C) Schematic drawing of the PR264 promoter and summary of bandshift and footprint analyses. CAAT and TATA transcription signals are indicated by (; boxes. Hatched boxes correstippled -fl--- spond to MREs, and the orientation of the myb consensus binding site is Ef D N by arrows. The relative affin(; shown ity of each MRE is indicated by +/++/+++ (nt, not tested). e -

\-1

~-

-

--4241-Ei----

J K C

)(l(ll 1 i i

;o

l

I ,t ;

HB at

formed essentially as described (7) except that binding reactions were performed with 15-25 ng of the end-labeled DNA fragment (1-3 x 105 cpm) and variable amounts of R2R3 protein in 50 1.l of 10%6 glycerol/50 mM NaCl/20 mM Tris HCI, pH 8.0/5 mM MgCl2/0.1 mM EDTA/1 mM dithiothreitol with poly(dI-dC) at 2.5 ,ug/ml. Reaction mixtures were incubated for 30 min at 0C and digested with 25 ng of DNase I for 1 min at 20TC.

RESULTS n of PR264 Promoter Sequences. SequencCh ing of the human genomic region located upstream of the translation initiation codon identified in PREl sequences

G

FA

LiTit 1-11

allowed us to recognize potential transcription signals (Fig. 1). Interestingly, an ISRE, located between the CAAT and TATA motifs in human sequences, was found to be conserved in the corresponding chicken region (data not shown). ISREs have been identified in the promoter regions of several genes whose expression is regulated by interferons in response to inducers such as viral infection or double-stranded RNA (19). Aside from these transcription signals, several MREs were also identified, suggesting that PR264 expression might be regulated by c-myb proteins. RNase protection assays performed with mRNAs purified from various human cells allowed us to identify two major potential transcription start sites within a 30-bp region located downstream of the TATA

11686

Biochemistry: Sureau et al.

Proc. Nati. Acad Sci. USA 89 (1992)

the PR264 transcription principally occurred at the potential upstream start site (5-10 bp downstream of the TATA box). The use of a shorter probe (Nhe I-Nco I) confirmed that protected mRNAs differed at their 5' ends (data not shown). In CCRF-CEM cells, PR264 transcripts containing both types of 5'-proximal sequences were identified. Preliminary primer extension experiments (data not shown) have confirmed that the distal initiation region mapped with the PR264 mRNAs expressed in hematopoietic cells contains an accurate transcription start site (Fig. 1A). PR264 MREs Efficiently Interact with the c-myb DNABinding Domain. Among the several potential MREs identified in the human PR264 promoter, three of them (MREs A, B, and C in Fig. 1A) were tested for their ability to form complexes with the c-myb R2R3 polypeptide, which has been shown to interact specifically with myb-binding sites (18). Results from either direct bandshift or competition assays indicate that these MREs specifically interact, albeit with different affinities, with the c-myb DNA-binding domain (Fig. 2A). DNase I footprinting analysis of a 1200-bp genomic region located upstream of the PR264 translation start codon allowed us to identify eight additional MREs (D-K) located on both sides of the TATA box (Fig. 1A and Fig. 2 B and C). Interestingly, the binding affinity of the different MREs was correlated neither with the length of the protected region nor with the extent of homology with the previously published myb binding consensus (7, 20-22). In addition, the colocalization of the TATA box and MRE F might be of significance for the regulation of PR264 expression. c-myb Proteins Tractivate the PR264 Promoter. Binding of the c-myb R2R3 polypeptide to the PR264 promoter sequences prompted us to determine whether myb products might play a role in the expression of the PR264 gene. To test this possibility, HeLa cells were cotransfected with the PR264-CAT recombinant plasmid and with either the SVmyb -or the Bmyb clone, which express the c-myb protein con-

I,

a

4D

.AP

40

0

FIG. 3. Transactivation analysis of the PR264 promoter. Cotransfection and CAT assays were performed with the reporter plasmid pR264cat and with the effector vectors SVmyb and Bmyb, expressing the ET-containing and the ET-lacking c-myb product respectively. In each case, 3 Ug of the indicated plasmid DNA was transfected in the presence of 10 .tg of carrier DNA and 2 MLg of plasmid pRSV-,B-Gal (8-galactosidase vector, used as an internal control to normalize for variations in transfection efficiency). pCATO and pRSV-CAT were used as negative and positive control, respectively. Radioactivity was determined by liquid scintillation counting and chloramphenicol conversion is given as fold stimulation.

box (Fig. 1). PR264 mRNAs expressed in HL-60 and normal thymic hematopoietic cells predominantly protected the RD fragment, suggesting that they were initiated at the distal transcription start site (25-30 bp downstream of the TATA box). The opposite situation was observed with PR264 transcripts expressed in HEL embryonic lung cells. In that case, only the proximal, RP fragment was detected, indicating that PR264

C-NTYB

13

I

t \. ,

I)

.X

Ii

)1

S

\0 \~

.-

1-

\

10

-

8

.0

q

,1 . @'..1 _

o

8)) I(l.ti1 .

) m

zo

2,0 kb -10

,

G3PDH

s

_

_

C-MYB

'

1.3 kb

3,0 kb

PR 264

FIG. 4. (A) Northern blot analysis of PR264 and c-myb expression in HL-60 cells upon chemically induced differentiation. Poly(A)+ mRNA samples (3 MLg) purified from untreated and chemically (DMSO or TPA) treated HL-60 cells were hybridized to the indicated probe. (B) c-myb and PR264 mRNA levels before and after induction of differentiation. Variations of the PR264 1.7-kb and 2.0-kb mRNA levels have been included in the same bars because the corresponding bands were too close to be integrated separately. G3PDH was used as an internal control to normalize for variations in RNA amounts.

Biochemistry: Sureau et aL taining or deprived of the ET domain, respectively. Much higher transactivation ofCAT expression was observed when HeLa cells were cotransfected with the Bmyb expression vector (Fig. 3). This suggested that, under the experimental conditions that we used, and as previously reported in yeast (23), the ET-containing c-myb protein is a weaker transactivator than its truncated counterpart. To assess the biological significance of these observations, we took advantage of the fact that c-myb expression is considerably reduced in the promyelocytic HL-60 cells upon DMSO- or TPA-induced differentiation (24). Northern blot analysis of PR264 and c-myb mRNAs before and after chemical treatment of HL-60 cells revealed that three major PR264 transcripts (2.0, 1.7, and 1.3 kb) decreased concomitantly with the c-myb mRNA (Fig. 4). Interestingly, the relative amount of the 3.0-kb PR264-specific mRNA increased upon differentiation, suggesting that expression of this messenger is not under the control of the promoter sequences identified in this work. Since our preliminary observations suggest that the level of PR264 mRNA is not directly affected by TPA treatment (data not shown), the observed decrease in PR264 expression is most certainly related to the reduced expression of c-myb at

the onset of differentiation.

DISCUSSION

Analysis of the PR264 promoter region allowed us to identify several MREs that specifically interact with the c-myb R2R3 binding domain. Using in vitro and cell culture experiments, we have studied the biological significance of these interactions and shown that c-myb products might regulate PR264 expression. In promyelocytic HL-60 cells induced to differentiate, a 3- to 5-fold reduction in the expression of three PR264 mRNAs (2.0, 1.7, and 1.3 kb) occurs concomitantly with either the reduction or the extinction of c-myb expression. Moreover, a 2-fold reduction or extinction of c-myb expression results in the same quantitative decrease of PR264 expression, therefore suggesting that a c-myb threshold expression level is required to transactivate PR264 transcription. Surprisingly, expression of the other major PR264 mRNA (3.0 kb) was unaffected or even increased following DMSO or TPA treatment, respectively. These observations suggest the existence of an additional promoter region which would control the expression of the 3.0-kb transcript in HL-60 and hematopoietic cells. This promoter, being regulated in a myb-independent way, could also control PR264 transcription in HEL cells, which contain fairly high levels of PR264 transcripts (3.0, 2.0, and 1.3 kb) but no detectable c-myb mRNA (data not shown). This possibility is supported by RNase protection experiments which indicate that most of the PR264 transcripts are initiated at different sites in HL-60 and HEL cells (Fig. 1). The combined use of alternative promoters, 3'-proximal noncoding exons, and polyadenylylation sites could be essential for the fine tuning of PR264 synthesis at specific stages of the cellular proliferation and differentiation processes. The covariant relationship between PR264 and c-myb expression suggests that the activity of the PR264 promoter is modulated by myb proteins. We speculate that PR264 expression may be differentially modulated by the different c-myb products that are expressed throughout hematopoiesis. The existence within the PR264 promoter of at least 11 MREs differing in their relative affinity would then provide a greater flexibility in response to c-myb proteins exhibiting different transactivating properties. Our data indicate that the expression of an essential splicing factor can be transactivated by the products of a nuclear protooncogene. The differential regulation of the PR264 promoter by c-myb proteins containing distinct amino termini fit into our model suggesting that the PR264/SC35

Proc. Natl. Acad. Sci. USA 89 (1992)

11687

splicing factor is directly or indirectly involved in the transsplicing of ET and c-myb sequences (25, 26). We speculate that the trans-splicing of ET, which modulates the biological activity of the c-myb product, is mediated by PR264/SC35, whose relative amount is itself controlled by c-myb products in hematopoietic cells. As the tra and tra-2 factors governing sexual determination in Drosophila (27), the PR264 splicing regulator could turn out to be a key element ofthe mechanism by which the c-myb protooncogene controls hematopoietic differentiation. Thanks are due to Drs. A. Pierani, 0. Gabrielsen and R. Bosselut for helpful advice and gifts of material. We thank Dr. A. Sentenac for critical reading of the manuscript and Dr. C. White for grammar corrections. M.V. and A.S. were recipients of a fellowship from the Ligue Nationale Contre le Cancer and from the French Ministere de la Recherche et de la Technologie, respectively. This work was supported by grants from Association pour la Recherche contre le Cancer, Fondation pour la Recherche M6dicale, and Ligue Nationale Contre le Cancer.

1. Westin, E. H., Gallo, R. C., Arya, S. K., Eva, A., Souza, L. M., Baluda, M. A., Aaronson, S. A. & Wong-Staal, F. (1982) Proc. Natl. Acad. Sci. USA 79, 2194-2198. 2. Shen-Ong, G. L. C. (1990) Biochim. Biophys. Acta 1032, 3952. 3. Weston, K. & Bishop, J. M. (1989) Cell 58, 85-93. 4. Ness, S. A., Marknell, A. & Graf, T. (1987) Cell 59, 1115-1125. 5. Siu, G., Wurster, A. L., Lipsick, J. S. & Hedrick, S. M. (1992) Mol. Cell. Biol. 12, 1592-1604. 6. Evans, J. L., Morre, T. L., Kuehl, W. M., Bender, T. & Pan-Yun Ting, J. (1990) Mol. Cell. Biol. 10, 5747-5752. 7. Zobel, A., Kalkbrenner, F., Guehmann, S., Nawarath, M., Vorbrueggen, G. & Moelling, K. (1991) Oncogene 6, 13971407. 8. Nicolaides, N. C., Gualdi, R., Casadevall, C., Manzella, L. & Calabretta, B. (1991) Mol. Cell. Biol. 11, 6166-6176. 9. Vellard, M., Soret, J., Viegas-Pequignot, E., Galibert, F., Nguyen, V. C., Dutrillaux, B. & Perbal, B. (1991) Oncogene 6, 505-514. 10. Vellard, M., Sureau, A., Soret, J., Martinerie, C. & Perbal, B. (1992) Proc. Nad. Acad. Sci. USA 89, 2511-2515. 11. Fu, X. D. & Maniatis, T. (1992) Science 256, 535-538. 12. Azzarone, B., Malpiece, Y., Zaech, P., Moretta, L., Fauci, A. & Suirez, H. (1985) Exp. Cell Res. 159, 451-462. 13. Perbal, B. (1988) A Practical Guide to Molecular Cloning (Wiley, New York), 2nd Ed. 14. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning:A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY), 2nd Ed. 15. Bosselut, R., Duvall, J. F., G6gonne, A., Bailly, M., Hemar, A., Brady, J. & Ghysdael, J. (1990) EMBO J. 9, 3137-3144. 16. Gorman, C. M., Moffat, L. F. & Howard, B. M. (1982) Mol. Cell. Biol. 2, 1044-1051. 17. Rosson, D. & Reddy, E. P. (1986) Nature (London) 319, 604-606. 18. Gabrielsen, 0. C., Sentenac, A. & Fromageot, P. (1991) Science 253, 1140-1143. 19. Hug, H., Costas, M., Staeheli, P., Aebi, M. & Weissmann, C. (1988) Mol. Cell. Biol. 8, 3065-3079. 20. Biedenkapp, H., Borgmeyer, U., Sippel, A. E. & Klempnauer, K. N. (1988) Nature (London) 335, 835-837. 21. Nakagoshi, H., Nagase, T., Ueno, Y. & Ishii, S. (1989) Nucleic Acids Res. 17, 7315-7324. 22. Howe, K. M. & Watson, R. J. (1991) Nucleic Acids Res. 19, 3913-3919. 23. Punyammalee, B., Crabeel, D., de Lannoy, C., Perbal, B. & Glansdorff, N. (1991) Oncogene 6, 11-16. 24. Craig, R. W. & Bloch, A. (1984) Cancer Res. 44, 442-446. 25. Perbal, B. & Vellard, M. (1990) C.R. Acad. Sci. (Paris) 311, 467-472. 26. Perbal, B. (1992) Med. Sci. 8, 548-561. 27. Maniatis, T. (1991) Science 251, 33-34. 28. Stein, B., Rahmsdorf, H. J., Steffen, A., Litfin, M. & Herrlich, P. (1989) Mol. Cell. Biol. 9, 5169-5181.