Leukemia Research 39 (2015) 544–552
Contents lists available at ScienceDirect
Leukemia Research journal homepage: www.elsevier.com/locate/leukres
Heme oxygenase-1 suppresses the apoptosis of acute myeloid leukemia cells via the JNK/c-JUN signaling pathway Xiaojing Lin a,b,c , Qin Fang d , Shuya Chen a,b,c , Nana Zhe a,b,c , Qixiang Chai a,b,c , Meisheng Yu a,b,c , Yaming Zhang b,c , Ziming Wang b,c , Jishi Wang a,b,c,∗ a
Guiyang Medical College, Guiyang 550004, China Department of Hematology, the Affiliated Hospital of Guiyang Medical College, Guiyang 550004, China c Guizhou Provincial Laboratory of Hematopoietic Stem Cell Transplantation Center, Guiyang 550004, China d Department of Pharmacy, the Affiliated Baiyun Hospital of Guiyang Medical College, Guiyang 550004, China b
a r t i c l e
i n f o
Article history: Received 19 September 2014 Received in revised form 26 January 2015 Accepted 21 February 2015 Available online 20 March 2015 Keywords: Acute myeloid leukemia Heme oxygenase-1 JNK/c-JUN Apoptosis Signaling pathway
a b s t r a c t There are few studies on the correlation between heme oxygenase-1 (HO-1) and acute myeloid leukemia (AML). We found that HO-1 was aberrantly overexpressed in the majority of AML patients, especially in patients with acute monocytic leukemia (M5) and leukocytosis, and inhibited the apoptosis of HL-60 and U937 cells. Moreover, silencing HO-1 prolonged the survival of xenograft mouse models. Further studies demonstrated that HO-1 suppressed the apoptosis of AML cells through activating the JNK/c-JUN signaling pathway. These data indicate a molecular role of HO-1 in inhibiting cell apoptosis, allowing it to be a potential target for treating AML. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction AML, genetically heterogeneous malignant neoplasm, has a low survival rate [1]. Despite of the improvement in treating younger patients during the last 4 decades, the cured people only accounted for approximately 35% of patients who entered clinical trials [2]. The prognosis of AML is dependent on its cytogenetic and molecular profiles [3], but the existence of their diversities has made the development of a universal or broad AML-targeted therapy very difficult [4]. Therefore, it is now of global interest to find eligible markers for AML. HO-1, as the rate-limiting enzyme in protoheme catabolism, is one of the most important regulatory enzymes for oxidation. Under physiological conditions, HO-1 is mainly involved in iron recycle and maintenance of intracellular homeostasis. However, HO-1 resists apoptosis, promotes cell proliferation and mitigates inflammation when it is in pathological or stress conditions [5,6]. When highly expressed, HO-1 inhibits the apoptosis and promotes the proliferation of tumor cells, being associated with tumorigenesis and drug resistance [6]. Since this enzyme exerts
anti-apoptotic effect by providing beneficial conditions on the survival and growth of malignant tumors, it could be a potential target for treatment [6,7]. Primary chronic myeloid leukemia (CML) cells and k562 cell line express HO-1 in a constitutive manner, and HO1 is considered to play an important role as a survival molecule in CML cells [8]. Besides, regulating HO-1 expression affects the survival of myeloid leukemia cells [9–11]. The above studies suggest that HO-1 is closely associated with the onset and progression of tumor. It is hitherto unclear whether HO-1 can inhibit the apoptosis of AML or not. If it can, which relevant signaling pathways are involved in? In order to answer this question, we conducted experiments both in vitro and in vivo. Based on previous knowledge, the expression products of HO-1 gene participate in cell proliferation and differentiation by activating one or several downstream pathways of mitogen-activated protein kinase (MAPK) [12,13]. Therefore, we hypothesize that HO-1 probably inhibit the apoptosis of AML cells via such pathways. 2. Materials and methods 2.1. Cell lines and cell culture
∗ Corresponding author at: Department of Hematology, the Affiliated Hospital of Guiyang Medical College, Guiyang 550004, China. Tel.: +86 0851 6774276. E-mail address: [email protected] (J. Wang). http://dx.doi.org/10.1016/j.leukres.2015.02.009 0145-2126/© 2015 Elsevier Ltd. All rights reserved.
Human AML cell lines HL-60 (M2, exhibiting loss and several rearrangements involving chromosome 5) and U937 (M5, t[10;11][p13;q14]) were purchased from the American Type Culture Collection (Manassas, VA). They were cultured in RPMI 1640 media with 10% fetal bovine serum (Gibco, USA) plus 100 U/ml penicillin and
X. Lin et al. / Leukemia Research 39 (2015) 544–552
545
100 mg/ml streptomycin in a 37 ◦ C humidified atmosphere containing 5% CO2 /95% air.
level. -Actin was used as the internal control. The primer sequences are listed in Table 2.
2.2. Patient samples
2.9. Western blotting
Bone marrow (BM) samples were obtained from AML patients (blasts >60%) at diagnosis or at relapse. Patients’ characteristics are shown in Table 1. CD34+ cells originating from healthy donors’ peripheral blood (PB) served as controls. They were sublimated by using immunomagnetic cell sorting system (MACS) (Miltenyi Biotech, Auburn CA). According to immunophenotypes, leukemic cells from patients were sorted by distinguished combinations of antibodies via performing on a FACS Aria instrument (BD Biosciences). After sorting, cell viability (>95%) was measured by the Trypan-blue dye exclusion assay, the purity of the cells (85–95%) were detected by flow cytometry. This study was approved by the Ethics Committee of Guiyang Medical College in accordance with the Declaration of Helsinki, and all subjects signed consent forms.
Western blotting was performed as described [23]. Primary antibodies used in this study including anti-HO-1, anti-caspase 3, anti-caspase 8, anti-caspase 9, anti-p38, anti-phosphorylated-p38, anti-phosphorylated-ERK1/2 (pERK1/2), anti-ERK1/2, anti-phosphorylated-JNK (threonine 183/tyrosine 185), anti-JNK, antic-JUN and anti-phosphorylated-c-JUN (serine 63). Their optical densities were analyzed with Quantity One software. The expressions of target genes were normalized to that of -actin.
2.3. Drugs and chemicals Cytarabine was purchased from Pfizer, Inc. (New York City, NY, USA). JNK inhibitor (SP600125) was bought from Beyotime Institute of Biotechnology Co., Ltd. (Shanghai, China). Reagents were formulated in dimethyl sulfoxide (DMSO) and stored at −20 ◦ C. Prior to use, stock solutions were diluted with serum-free RPMI medium to ensure the concentration of DMSO less than 0.02%. All antibodies were purchased from Sigma (St. Louis, MO, USA). 2.4. Construction of recombinant lentiviral vectors and transfection Sequences containing human HO-1 (HO-1, 5 -GCGTTTACCCGCCATCCGCACCCTAGGAGATCTCAGCCACAG-3 ) and small interfering RNA targeting human HO1 (siRNA-HO-1, 5 -TGGTAGGGCTTTATGCCATGTTTCAAGAGAACATGGCATAAAGCCCTACTTTTTTC-3 ) were selected with Invitrogen designer software. Retroviruses were generated by transfecting empty plasmia vectors containing enhanced green fluoresence protein (EGFP) or vectors containing human HO-1-EGFP/siRNA-HO-1EGFP using Fugene HD6 into 293FT packaging cells [14,15]. Lentiviral stocks were concentrated using Lenti-XTM concentrator and titers were determined with LentiXTM qRT-PCR titration kit (Shanghai Innovation Biotechnology Co., Ltd., China). Finally, 4 recombinant lentiviral vectors, lentivirus-V5-D-TOPO-HO-1-EGFP (L-HO1), lentivirus-V5-D-TOPO-EGFP (TOPO-EGFP), lentivirus-pRNAi-U6.2-EGFP-siHO-1 (siHO-1), lentivirus-pRNAi-U6.2-EGFP (RNAi-EGFP), were constructed. For infection, cells were plated onto 12 well plates at 2.5 × 105 cells/well and infected with lentiviral stocks at an multiplicity of infection (MOI) of 10 in the presence of polybrene (10 g/ml), then analyzed by fluorescence microscopy (Olympus, Tokyo, Japan) and western blotting 48 h post infection. HL-60 cells were transfected with L-HO-1 and TOPO-EGFP, and U937 cells with siHO-1 and RNAi-EGFP, respectively. 2.5. Animal experiments All animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animal, and were approved by the Biomedical Ethics Committee of the Affiliated Hospital of Guiyang Medical College. Six- to eight-week-old SCID mice [16] were provided by the Animal Center of Guiyang Medical College (Guiyang, China). They were exposed to total body irradiation (TBI) for 24 h, then were subcutaneously injected in the right armpits with U937 cells (5 × 106 –1 × 107 cells per mouse) [16–18] which were in the logarithmic growth phase. Animals were randomly divided into five groups (n = 10). The blank group was injected with normal saline, while the experimental groups were injected with unmodified U937 cells, U937 cells with silenced HO-1, U937 cells carrying control vector as well as U937 cells treated by both HO-1 silencer and JNK inhibitor, respectively. The AML mouse models were validated by the application of flow cytometry to detect the expression of PE-CY-CD45/PE-CD13 in BM cells [19]. Tumors’ sizes were measured by vernier caliper once or twice per week and calculated as /6 length × width2 [17]. 2.6. Cell growth analysis by MTT assay MTT assay was used to analyze cell growth and viability as described [20]. 2.7. Assessment of apoptosis Apoptosis was evaluated by annexin V/propidium iodide (PI) (7sea biotech, Shanghai, China) staining and flow cytometry as described [21]. 2.8. Quantitative real-time PCR Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). Reverse transcription was performed using M-MLV reverse transcriptase cDNA synthesis kit (Takara, Japan). Quantitative real-time PCR was performed as described [22]. A comparative CT method (CT) was used to analyze the gene expression
2.10. Histology Livers, spleens, and tumor tissues of mouse were collected from the blank and experimental groups. These organs and tissues were fixed in 10% neutral formalin for 24 h. They were embedded in paraffin followed by cutting into sections. In order to record the invasion of leukemic cells, prepared sections were subsequently stained by hematoxylin–eosin and observed under a microscope. 2.11. Statistical analysis All data were analyzed by SPSS ver.19.0 software package (SPSS, Chicago, USA). Statistical significance among groups was determined by Student’s t-test. The correlation between the expression of HO-1 and white blood cell (WBC) count of AML was built up by the application of Spearmant. P values less than 0.05 were considered statistically significant. Each experiment was performed in triplicate, data were presented as mean ± standard deviation (SD). Kaplan–Meier survival curves were plotted and analyzed with the log-rank test.
3. Results 3.1. HO-1 is overexpressed in most AML patient samples A total of 32 AML patients were sampled. The majority of them (70%) had a overexpression of HO-1 at messenger RNA (mRNA) level and protein level, especially 9 patients with M5. Contrarily, the normal CD 34+ cells only showed a minimal level of HO-1 (Fig. 1A and B). In addition, there was a positive correlation between the expression of HO-1 and WBC count that 18 AML patients with leukocytosis at diagnosis showed overexpression of HO-1 (Fig. 1C). These data confirm that HO-1 is overexpressed in AML at both the mRNA and protein levels, and it is closely associated with leukocytosis at diagnosis. Although the number of samples is limited, patients with M5 tend to have a higher level of HO-1 compared to that of other AML subtypes. 3.2. High expression of HO-1 can inhibit the apoptosis of HL-60 and U937 cells We did compare the expression of HO-1 among cell lines, and the results showed that cell lines U937, THP-1 and Kasumi-1 were in a high expression, while HL-60 and NB4 were low (Fig. 2A). Furthermore, we regulated the expression of HO-1 in cell lines so as to investigate its effects on apoptosis. The expressions of HO-1 in U937, THP-1 and Kasumi-1 were downregulated by transfecting with siHO-1, and the other cell lines were upregulated by transfecting with L-HO-1. However, only U937 and HL-60 were successfully transfected and the positivity of transfections were more than 95% (Fig. 2B). The results of western blotting showed that HO-1 was highly expressed in HL-60-Lentivirus-V5-D-TOPO-HO-1-EGFP (HL-60-L-HO-1) cells but lowly in U937-lentivirus-pRNAi-U6.2EGFP-siHO-1 (U937-siHO-1) cells, which suggested successful transfections (Fig. 2B). Further, we examined the viability of AML cell lines in response to varying concentrations of cytarabine which is one of the firstline chemotherapeutic agents [22]. The drug concentrations were adopted based on previous studies [24,25]. HL-60, HL-60-L-HO1, HL-60-TOPO-EGFP, U937, U937-siHO-1, U937-RNAi-EGFP cells were treated with cytarabine at different concentrations (0.5 M,
546
X. Lin et al. / Leukemia Research 39 (2015) 544–552
Table 1 Summary of clinical features of AML patients. Sample
Age (years)
Sex
FAB
BM/PB
Disease status
WBC (109 /L)
%Blasts (BM)
Cytogenetics
AML1 AML2 AML3 AML4 AML5 AML6 AML7 AML8 AML9 AML10 AML11 AML12 AML13 AML14 AML15 AML16 AML17 AML18 AML19 AML20 AML21 AML22 AML23 AML24 AML25 AML26 AML27 AML28 AML29 AML30 AML31 AML32
69 41 38 77 26 39 19 17 20 45 19 21 39 46 24 43 35 24 24 61 32 22 58 68 39 56 72 27 74 48 52 82
M M F F M M F F M M F F F M F M F M M M M F M F F F M F F M F M
M2 M2 M2 M2 M2 M2 M2 M2 M3 M3 M3 M3 M3 M3 M3 M4 M4 M4 M4 M4 M4 M4 M4 M5 M5 M5 M5 M5 M5 M5 M5 M5
BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM
Untreated Relapsed Untreated Untreated Relapsed Untreated Relapsed Untreated Untreated Untreated Untreated Untreated Relapsed Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Relapsed Relapsed Relapsed Relapsed Untreated
0.88 2.61 7.5 12.75 22.06 59.93 72.25 109.43 0.44 0.83 1.17 2.9 28.74 30.69 70.1 2 3.06 4.68 14.81 17.17 76.36 81.25 151.4 1.2 3.65 6.48 24.6 34.91 36.88 74.81 129.8 183.9
68 75 62 82 67 80 88 83 81 77 66 83 90 82 83 71 61 68 67 89 69 75 81 64 67 87 71 85 63 83 74 78
Normal Normal Normal t(8;21) Normal Normal t(8;21) der(3) t(8;21) t(15;17) t(15;17) t(15;17) t(15;17) t(15;17) t(15;17) t(15;17) inv(16) Normal Normal Normal Normal inv(16) inv(16) Not available Normal Normal Normal Not available Complex Not available Normal Complex Not available
Abbreviation: F = female; M = male; BM = bone marrow; PB = peripheral blood; WBC = white blood cell; M2 = acute myeloid leukemia with maturation; M3 = acute promyelocytic leukemia; M5 = acute monocytic leukemia.
Table 2 The primer sequences used in quantitative real-time PCR. Gene name
Sequences
HO-1 -actin
Length (bp)
F (5 –3 )
R (5 –3 )
ACCCATGACACCAAGGACCAGA TCACCCACACTGTGCCCATCTACGA
GTGTAAGGACCCATCGGAGAAGC CAGCGGAACCGCTCATTGCCAATGG
1 M, 2 M, 4 M, 8 M, 12 M, 16 M and 20 M). With the increasing concentration of the cytarabine, the viability of cells was decreased gradually. At the same concentration of cytarabine, cells with a high HO-1 expression had significantly higher viability rates than their counterparts (Fig. 2C). The apoptosis of high HO1 expression groups was the lowest, and it was further validated by Annexin V/PI assay after inducting with 1 M and 2 M cytarabine for 24 h (Fig. 2D). Interestingly, the expression of HO-1 was negatively correlated with apoptotic proteins-including caspase 3, caspase 8 and caspase 9, when cells were treated with 0.5 M cytarabine for 24 h (Fig. 2E). And HO-1 was further increased in response to cytarabine (Fig. 2F). This phenomenon was consistent with that of Heasman SA [22]. Hence, these data demonstrate that up-regulating expression of HO-1 can inhibit the apoptosis of AML cell lines, indicating that HO-1 has anti-apoptotic effect.
3.3. Overexpression of HO-1 accelerates leukemia’s progression in vivo We established xenograft mouse models of AML using un/modified U937 cells to further verify HO-1’s role in vivo. The expression of CD45, the marker of human white cells, proved that the xenograft mouse models were successfully established by transplanting with U937 cells (XM/U937), U937-siHO-1 cells
157 195
(XM/U937-siHO-1), U937-RNAi-EGFP cells (XM/U937-RNAi-EGFP) (Fig. 3A). Compared with the HO-1 downregulated groups, the xenograft mouse models with high HO-1 level developed tumors more rapidly (Fig. 3B). There was a significant increase in disease latency in the HO-1 downregulated groups (lumps of XM/U937 and XM/U937-RNAi-EGFP formed averagely on the 15th day and the 18th day, respectivelys, whereas it took 33 days for the HO-1 downregulted group). In high HO-1 expression group, the spleens of xenograft mouse models enlarged evidently (Fig. 3C), while the HO-1 downregulted group survived significantly longer than the other two groups (Fig. 3D). Specifically, the livers and spleens of XM/U937 and XM/U937-RNAi-EGFP groups were significantly infiltrated by leukemic cells (39–43 leukemic cells/high power field (HP)), and tumor tissues grew rapidly and invaded surrounding striated muscles considerably to subject to necrosis. Contrarily, the organs and tissues of XM/U937-siHO-1 mouse were slightly affected by leukemic cells (15–21 leukemic cells/HP) (Fig. 3E). Therefore, we confirm that HO-1 promotes the proliferation and inhibits the apoptosis of AML cells in vivo.
3.4. HO-1 results in activated JNK/c-JUN signaling pathway MAPK pathway mainly includes three branches, extracelluar signal-regulated kinases 1 and 2 (ERK1/2), p38, and c-Jun
X. Lin et al. / Leukemia Research 39 (2015) 544–552
547
Fig. 1. HO-1 is overexpressed in most AML patient samples. (A) Differential expression of HO-1 mRNA in AML patients and normal CD34+ cells were determined by qRT-PCR. Data are presented as CT of HO-1 expression in patient samples, with higher CTs indicating lower expression. **P-value < 0.01,***P-value < 0.001. (B) Western blotting analysis of HO-1 protein expression levels in AML patients and normal CD34+ cells. (C) Scatterplot representation of the correlation between the expression of HO-1 and WBC count in AML patient samples. Spearman correlation coefficient r (C, left) for CTs v WBC = −0.823, P < 0.001, Spearman correlation coefficient r (C, right) for protein levels of HO-1 v WBC = 0.743, P < 0.001.
NH2 -terminal kinase (JNK) [26]. In order to explore the correlation between MAPK pathway and HO-1, we quantified the expressions of JNK, phosphorylation of threonine 183/tyrosine 185(pJNKThr183/Tyr185 ), p38, phosphorylation of p38 (p-p38), ERK1/2 and phosphorylation of ERK1/2 (pERK1/2) by Western blotting with the variation of HO-1. Results showed that HO-1 basically had no correlation with p38, p-p38, ERK1/2 and pERK1/2, but was positively correlated with pJNKThr183/Tyr185 . Moreover, upregulating HO-1 elevated the level of phosphorylated-c-JUN at serine63 (pc-JUNSer63 ) and total c-JUN (Fig. 4A.) Similar results were found in the tumor tissues of our xenograft mouse models (Fig. 4B).
This positive correlation was validated by analyzing BM aspirates from 3 patients with M5 who suffered a relapse in a short period of time. The higher expression of HO-1 was accompanied with the increased expressions of pJNKThr183/Tyr185 , pc-JUNSer63 , and total cJUN at relapse than those at diagnosis (Fig. 4C). Next, U937 cells were cultured for 24, 48 and 72 h following with the treatment of the pan-JNK inhibitor (SP600125) at a concentration of 10uM [4] and the expression of pJNKThr183/Tyr185 was measured by Western blot. Since the inhibitory effects were at optimum after 72-hour incubation (Fig. 4D), HL-60 and U937 cells were incubated with SP600125 for 72 h. Although HO-1 expression of HL-60 and U937
548
X. Lin et al. / Leukemia Research 39 (2015) 544–552
Fig. 2. High expression of HO-1 can inhibit the apoptosis of HL-60 and U937 cells. (A) Western blotting analysis of protein levels of HO-1 in AML cell lines. (B) Positivity of lentivirus-mediated HO-1 and siHO-1 transfections (>95%) observed by fluorescence microscopy. Expression of HO-1 after transfections was detected by Western blotting. (C) Cells were treated with different doses of cytarabine for 24 h. Viability was evaluated by MTT assay. *P < 0.05. (D) Apoptotic rates were detected by flow cytometry with Annexin V/PI assay, *P < 0.05. (E) Total protein was extracted from different cell groups after the treatment of 0.5 M cytarabine for 24 h, then detecting the expression of HO-1, caspase 3, caspase 8 and caspase 9. (F) The treatment of cytarabine (0.5uM) increased HO-1 expression, *P < 0.05.
cells changed slightly, the expressions of pJNKThr183/Tyr185 were plummeted (Fig. 4E), indicating that JNK/C-JUN was in the downstream of HO-1. Therefore, it is believed that JNK/c-JUN signaling pathway can be activated by it upstream enzyme, HO-1, to inhibit cell apoptosis.
3.5. The inhibition of both JNK and HO-1 can enhance AML cell apoptosis We then tested whether JNK/c-JUN signaling pathway had a functional impact on cellular events induced by HO-1. In addition to silencing HO-1, we treated U937-siHO-1 with SP600125 (U937-siHO-1/SP600125) to further evaluate the functional effects, exerted by HO-1, on growth and survival of AML cells. The apoptotic rate was measured by Annexin V/PI assay after treating U937-siHO1/SP600125 with 1 M and 2 M cytarabine for 24 h. The apoptosis of U937-siHO-1/SP600125 group was significantly increased in comparison with U937-siHO-1 group (Figs. 2D and 5A). Similarly, we established AML mouse model with U937-siHO-1/SP600125 cells (XM/U937-siHO-1/SP600125). XM/U937-siHO-1/SP600125 mouse survived longer than the XM/U937-siHO-1 group (Fig. 5B), with less leukemic cells infiltrating in the livers and spleens (6–8 leukemic cells/HP) (Fig. 5C). Our findings suggest that JNK/c-JUN pathway enhance the inhibitory effects of HO-1 on the apoptosis of AML cells.
4. Discussion Previous studies have shown that expression of HO-1 is usually increased in human cancer cells [27]. It plays an anti-apoptotic role in cancer chemotherapy and induces tumor-progression, such as in melanoma [7], breast carcinoma [28], non-small cell lung cancer [29], hepatocarcinoma [30], pancreatic cancer [31]. However, little has been known in hematological malignancies. The present study demonstrates the expression of HO-1and its role in AML. To our surprise, AML patients showed significantly higher expression of HO-1 than normal CD34+ cells. Furthermore, HO-1 was considerably prone to overexpressing in patients with M5 subtype (9cases, either at diagnosis or at relapse). The level of HO-1 expression was also higher in 18 first-visit leukocytic patients than the left apart from M5. These findings have never been reported before. Furthermore, the overexpression and knockdown of HO-1 had effects on the apoptosis of AML cell lines. After incubation with cytarabine, the cells with HO-1 overexpression had the higher viability rate and the lower apoptotic rate. Correspondingly, the xenogaft mouse models of AML with such cells had a significantly shorter survival time, and a higher extent of organ invasion, such as livers and spleens. Therefore, HO-1 can suppress the apoptosis of AML cells in vitro. Despite of the existence of cytokines and growth factors in vivo, it is also conceivable that HO-1 can exert this strong inhibitory effect in vivo like our observations in vitro.
X. Lin et al. / Leukemia Research 39 (2015) 544–552
549
Fig. 3. Overexpression of HO-1 accelerates leukemia’s progression in vivo. (A) Expressions of PE-CY-CD45/PE-CD13 on BM cells detected with flow cytometry. (B) The xenograft mouse models of AML were killed on the 15th day after tumor formation. Tumor volume was measured and calculated as /6 length × width2 . (C) Sizes and weights of spleens from xenograft mouse models and control groups. (D) Survival time of control group, XM/U937 group (n = 9), XM/U937-siHO-1 group (n = 8) and XM/U937 group (n = 8), (P < 0.05). (E) Invasion of leukemic cells into the organs of xenograft mouse models (arrow: invasion of U937 cells).
550
X. Lin et al. / Leukemia Research 39 (2015) 544–552
Fig. 4. HO-1 results in activated JNK/c-JUN signaling pathway. (A) Expressions of HO-1, c-JUN, pJNKThr183/Tyr185, pc-JUNSer63, total c-JUN, ERK1/2, pERK1/2, p38 and p-p38 in different cell groups detected by Western blot. (B) Expression of the abovementioned proteins in the tumor tissues of xenograft mouse models of AML. (C) Western blotting analyzing the expressions of HO-1, c-JUN, pJNKThr183/Tyr185, pc-JUNSer63 in M5 patients. (D) Cells were treated with 10 M SP600125 and cultured for 24, 48 and 72 h, and analyzed by Western blot. (E) Expressions of HO-1 and pJNKThr183/Tyr185 were changed after 72-hour of treatment with 10 M SP600125.
X. Lin et al. / Leukemia Research 39 (2015) 544–552
551
Fig. 5. The inhibition of both JNK and HO-1 can enhance AML cell apoptosis. (A) The apoptotic rate was detected by Annexin V/PI assay, *P < 0.05. (B) Survival time of XM/U937-siHO-1 group (n = 9) and XM/U937-siHO-1/SP600125 group (n = 7), P < 0.05. (C) Invasion of leukemic cells into the organs of XM/U937-siHO-1/SP600125 group (arrow: invasion of U937 cells).
Up to now, most studies concerning the role of HO-1 in the signaling pathways of AML apoptosis have focused on the correlation between HO-1 and NF-B or Nrf2 [32–34]. In contrast, HO-1 has seldom been correlated with the MAPK pathway, mainly including ERK, p38 and JNK ones, to participate in cell proliferation, apoptosis and differentiation [35]. The c-JUN oncogene is a member of the activator protein-1 (AP-1) family of transcription factors that is phosphorylated and activated by the JNK [36]. In this study, up-regulating HO-1 increased the expression of pJNKThr183/Tyr185 , pc-JUNSer63 and total c-JUN. The expression of HO-1 showing no response to JNK inhibitor verified that JNK/c-JUN is in the downstream. Nevertheless, JNK/c-JUN can both facilitate and suppress cell apoptosis [37]. Sykes SM observed that inhibition of FOXO3 resulted in activated JNK/c-JUN pathway, which suppressed AML cell apoptosis [4]. Combining JNK inhibition with silencing HO-1 significantly increased the apoptosis of U937 cells. And SCID mouse injected with U937 cells which were both JNK inhibited and HO1 silenced survived longer after tumor formation. According to references and our results, the high level of HO-1 exerts an antiapoptic effects on AML cells by JNK/c-JUN signaling pathway which probably suppresses P53 or releases reactive oxygen species (ROS) [26,37], but this postulation still needs in-depth study.
A bigger sample pool of AML patients is required for further investigations on the verification of HO-1 expression in primary leukemic cells. It is better to elucidate the underlying signal pathway, because the mechanism of HO-1 resisting cell apoptosis by JNK/c-JUN pathway remains unclearly. In summary, HO-1 is not only highly expressed in most AML cases, but also inhibited cell apoptosis. Silencing HO-1 promoted cell apoptosis. These findings herein provide a valuably experimental basis for targeted therapy of AML. Conflict of interest statement The authors declare no conflict of interest. Acknowledgments This study was partly supported by the National Natural Science Foundation of China (No. 81070444, No. 81270636, No. 81360501 and No. 81470006), International Cooperation Project of Guizhou Province (No. 2011-7010), Social Project of Guizhou Province (No. 2011-3012) and Provincial Government Special Fund of Guizhou
552
X. Lin et al. / Leukemia Research 39 (2015) 544–552
Province (No. 2010-84). We are grateful for all doctors’ help for collecting clinical samples in the Department of Hematology, the Affiliated Hospital of Guiyang Medical College and for Dr. Yiguo Long’s guidance in the histological examination of transplanted mice in the Department of Pharmacy, the Affiliated Hospital of Guiyang Medical College. Contributors: J.W., X.L. and Z.W. contributed to the design and analysis of this study. X.L., Q.F., S.C., N.Z., Q.C., M.Y., Y.Z. and Z.W. performed laboratory-based experiments. X.L. and Z.W. wrote manuscript, and all authors contributed to and agreed on final version. References [1] Fröhling S, Scholl C, Gilliland DG, Levine RL. Genetics of myeloid malignancies: pathogenetic and clinical implications. J Clin Oncol 2005;23(26):6285–95. [2] Rowe JM, Tallman MS. How I treat acute myeloid leukemia. Blood 2010;116(17):3147–56. [3] Döhner H, Estey EH, Amadori S, Appelbaum FR, Büchner T, Burnett AK, et al. Diagnosis and management of acute myeloid leukemia in adults: recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood 2010;115(3):453–74. [4] Sykes SM, Lane SW, Bullinger L, Kalaitzidis D, Yusuf R, Saez B, et al. Akt/FOXO signaling enforces reversible differentiation blockade in myeloid leukemias. Cell 2011;146(5):697–708. [5] Miyazaki T, Kirino Y, Takeno M, Samukawa S, Hama M, Tanaka M, et al. Expression of heme oxygenase-1 in human leukemic cells and its regulation by transcriptional Bach 1. Cancer Sci 2010;101(6):1409–16. [6] Jozkowicz A, Was H, Dulak J. Heme oxygenase-1 in tumors: is it a false friend? Antioxid Redox Signal 2007;9(12):2099–117. [7] Was H, Cichon T, Smolarczyk R, Rudnicka D, Stopa M, Chevalier C, et al. Overexpression of heme oxygenase-1 in murine melanoma: increased proliferation and viability of tumor cells, decreased survival of mice. Am J Pathol 2006;169(6):2181–98. [8] Mayerhofer M, Florian S, Krauth MT, Aichberger KJ, Bilban M, Marculescu R, et al. Identification of heme oxygenase-1 as a novel BCR/ABL-dependent survival factor in chronic myeloid leukemia. Cancer Res 2004;64(9): 3148–54. [9] Mayerhofer M, Gleixner KV, Mayerhofer J, Hoermann G, Jaeger E, Aichberger KJ, et al. Targeting of heat shock protein 32 (Hsp32)/heme oxygenase-1 (HO-1) in leukemic cells in chronic myeloid leukemia: a novel approach to overcome resistance against imatinib. Blood 2008;111(4):2200–10. [10] Rushworth SA, MacEwan DJ. HO-1 underlies resistance of AML cells to TNFinduced apoptosis. Blood 2008;111(7):3793–801. [11] Nagai T, Kikuchi S, Ohmine K, Miyoshi T, Nakamura M, Kondo T, et al. Hemin reduces cellular sensitivity to imatinib and anthracyclins via Nrf2. J Cell Biochem 2008;104(2):680–91. [12] Elbirt KK, Whitmarsh AJ, Davis RJ, Bonkovsky HL. Mechanism of sodium arsenite-mediated induction of heme oxygenase-1 in hepatoma cells: role of mitogen-activated protein kinases. J Biol Chem 1998;(15):8922–31. [13] Alam J, Wicks C, Stewart D, Gong P, Touchard C, Otterbein S, et al. Mechanism of heme oxygenase-1 gene activation by cadmium in MCF-7 mammary epithelial cells. Role of p38 kinase and Nrf2 transcription factor. J Biol Chem 2000;275(36):27694–702. [14] Wang JS, Singh H, Zhang F, Ishizuka T, Deng H, Kemp R, et al. Endothelial dysfunction and hypertension in rats transduced with CYP4A2 adenovirus. Circ Res 2006;(7):962–9. [15] Ma D, Fang Q, Li Y, Wang JS, Sun J, Zhang Y, et al. Crucial role of heme oxygenase1 in the sensitivity of acute myeloid leukemia cell line Kasumi-1 to ursolic acid. Anticancer Drugs 2014;25(4):406–14. [16] Shan WL, Ma XL. How to establish acute myeloid leukemia xenograft models using immunodeficient mice. Asian Pac J Cancer Prev 2013;14(12):7057–63.
[17] Rosato R, Hock S, Dent P, Dai Y, Grant S. LBH-589 (panobinostat) potentiates fludarabine anti-leukemic activity through a JNK- and XIAP-dependent mechanism. Leuk Res 2012;36(4):491–8. [18] Tajima N, Fukui K, Uesato N, Maruhashi J, Yoshida T, Watanabe Y, et al. JTE-607, a multiple cytokine production inhibitor, induces apoptosis accompanied by an increase in p21waf1/cip1 in acute myelogenous leukemia cells. Cancer Sci 2010;101(3):774–81. [19] Shang Z, Wang J, Wang D, Xiao M, Li TJ, Wang N, et al. Establishment of xenotransplantation model of human CN-AML with FLT3-ITD (mut)/NPM1 (−) in NOD/SCID mice. J Huazhong Univ Sci Technolog Med Sci 2013;33(3):329–34. [20] Papa V, Tazzari PL, Chiarini F, Cappellini A, Ricci F, Billi AM, et al. Proapoptotic activity and chemosensitizing effect of the novel Akt inhibitor perifosine in acute myelogenous leukemia cells. Leukemia 2008;22(1):147–60. [21] Wang JS, Ma D, Li Y, Yang Y, Hu XY, Zhang W, et al. Targeted delivery of CYP2E1 recombinant adenovirus to malignant melanoma by bone marrow-derived mesenchymal stem cells as vehicles. Anticancer Drugs 2014;25(3):303–14. [22] Heasman SA, Zaitseva L, Bowles KM, Rushworth SA, Macewan DJ. Protection of acute myeloid leukemia cells from apoptosis induced by front-line chemotherapeutics is mediated by haem oxyenase-1. Oncotarget 2011;2(9):658–68. [23] Chen SY, Wang JS, Fang Q, Gao R, Shi QY, Zhang H, et al. Upregulated heme oxygenase-1 expression of mouse mesenchymal stem cells resists to chemotherapy-induced bone marrow suppression. Chin Med J (Engl) 2014;127(7):1310–6. [24] Kanno S, Higurashi A, Watanabe Y, Shouji A, Asou K, Ishikawa M. Susceptibility to cytosine arabinoside (Ara-C)-induced cytotoxicity in human leukemia cell lines. Toxicol Lett 2004;152(2):149–58. [25] Mitsuhashi M, Endo K, Obara K, Izutsu H, Ishida T, Chikatsu N, et al. Ex vivo simulation of the action of antileukemia drugs by measuring apoptosis-related mRNA in blood. Clin Chem 2008;54(4):673–81. [26] Taylor CA, Zheng Q, Liu Z, Thompson JE. Role of p38 and JNK MAPK signaling pathways and tumor suppressor p53 on induction of apoptosis in response to Ad-eIF5A1 in A549 lung cancer cells. Mol Cancer 2013;12:35. [27] Rushworth SA, Bowles KM, Raninga P, MacEwan DJ. NF-kappaB-inhibited acute myeloid leukemia cells are rescued from apoptosis by heme oxygenase-1 induction. Cancer Res 2010;70(7):2973–83. [28] Noh SJ, Bae JS, Jamiyandorj U, Park HS, Kwon KS, Jung SH, et al. Expression of nerve growth factor and heme oxygenase-1 predict poor survival of breast carcinoma patients. BMC Cancer 2013;13:516. [29] Tsai JR, Wang HM, Liu PL, Chen YH, Yang MC, Chou SH, et al. High expression of heme oxygenase-1 is associated with tumor invasiveness and poor clinical outcome in non-small cell lung cancer patients. Cell Oncol (Dordr) 2012;35(6):461–71. [30] Liu YS, Li HS, Qi DF, Zhang J, Jiang XC, Shi K, et al. Zinc protoporphyrin IX enhances chemotherapeutic response of hepatoma cells to cisplatin. World J Gastroenterol 2014;20(26):8572–82. [31] Berberat PO, Dambrauskas Z, Gulbinas A, Giese T, Giese N, Künzli B, et al. Inhibition of heme oxygenase-1 increases responsiveness of pancreatic cancer cells to anticancer treatment. Clin Cancer Res 2005;11(10):3790–8. [32] Helbig G, Christopherson 2nd KW, Bhat-Nakshatri P, Kumar S, Kishimoto H, Miller KD, et al. NF-kappaB promotes breast cancer cell migration and metastasis by inducing the expression of the chemokine receptor CXCR4. J Biol Chem 2003;278(24):21631–8. [33] Rushworth SA, Zaitseva L, Langa S, Bowles KM, MacEwan DJ. FLIP regulation of HO-1 and TNF signalling in human acute myeloid leukemia provides a unique secondary anti-apoptotic mechanism. Oncotarget 2010;1(5):359–66. [34] Rushworth SA, Macewan DJ. The role of nrf2 and cytoprotection in regulating chemotherapy resistance of human leukemia cells. Cancers (Basel) 2011;3(2):1605–21. [35] Zgheel F, Alhosin M, Rashid S, Burban M, Auger C, Schini-Kerth VB. Redoxsensitive induction of Src/PI3-kinase/Akt and MAPKs pathways activate eNOS in response to EPA:DHA 6:1. PLoS One 2014;9(8):e105102. [36] Dérijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, et al. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 1994;76(6):1025–37. [37] Tournier C. The 2 faces of JNK signaling in cancer. Genes Cancer 2013;4(9–10):397–400.
Contents lists available at ScienceDirect
Leukemia Research journal homepage: www.elsevier.com/locate/leukres
Heme oxygenase-1 suppresses the apoptosis of acute myeloid leukemia cells via the JNK/c-JUN signaling pathway Xiaojing Lin a,b,c , Qin Fang d , Shuya Chen a,b,c , Nana Zhe a,b,c , Qixiang Chai a,b,c , Meisheng Yu a,b,c , Yaming Zhang b,c , Ziming Wang b,c , Jishi Wang a,b,c,∗ a
Guiyang Medical College, Guiyang 550004, China Department of Hematology, the Affiliated Hospital of Guiyang Medical College, Guiyang 550004, China c Guizhou Provincial Laboratory of Hematopoietic Stem Cell Transplantation Center, Guiyang 550004, China d Department of Pharmacy, the Affiliated Baiyun Hospital of Guiyang Medical College, Guiyang 550004, China b
a r t i c l e
i n f o
Article history: Received 19 September 2014 Received in revised form 26 January 2015 Accepted 21 February 2015 Available online 20 March 2015 Keywords: Acute myeloid leukemia Heme oxygenase-1 JNK/c-JUN Apoptosis Signaling pathway
a b s t r a c t There are few studies on the correlation between heme oxygenase-1 (HO-1) and acute myeloid leukemia (AML). We found that HO-1 was aberrantly overexpressed in the majority of AML patients, especially in patients with acute monocytic leukemia (M5) and leukocytosis, and inhibited the apoptosis of HL-60 and U937 cells. Moreover, silencing HO-1 prolonged the survival of xenograft mouse models. Further studies demonstrated that HO-1 suppressed the apoptosis of AML cells through activating the JNK/c-JUN signaling pathway. These data indicate a molecular role of HO-1 in inhibiting cell apoptosis, allowing it to be a potential target for treating AML. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction AML, genetically heterogeneous malignant neoplasm, has a low survival rate [1]. Despite of the improvement in treating younger patients during the last 4 decades, the cured people only accounted for approximately 35% of patients who entered clinical trials [2]. The prognosis of AML is dependent on its cytogenetic and molecular profiles [3], but the existence of their diversities has made the development of a universal or broad AML-targeted therapy very difficult [4]. Therefore, it is now of global interest to find eligible markers for AML. HO-1, as the rate-limiting enzyme in protoheme catabolism, is one of the most important regulatory enzymes for oxidation. Under physiological conditions, HO-1 is mainly involved in iron recycle and maintenance of intracellular homeostasis. However, HO-1 resists apoptosis, promotes cell proliferation and mitigates inflammation when it is in pathological or stress conditions [5,6]. When highly expressed, HO-1 inhibits the apoptosis and promotes the proliferation of tumor cells, being associated with tumorigenesis and drug resistance [6]. Since this enzyme exerts
anti-apoptotic effect by providing beneficial conditions on the survival and growth of malignant tumors, it could be a potential target for treatment [6,7]. Primary chronic myeloid leukemia (CML) cells and k562 cell line express HO-1 in a constitutive manner, and HO1 is considered to play an important role as a survival molecule in CML cells [8]. Besides, regulating HO-1 expression affects the survival of myeloid leukemia cells [9–11]. The above studies suggest that HO-1 is closely associated with the onset and progression of tumor. It is hitherto unclear whether HO-1 can inhibit the apoptosis of AML or not. If it can, which relevant signaling pathways are involved in? In order to answer this question, we conducted experiments both in vitro and in vivo. Based on previous knowledge, the expression products of HO-1 gene participate in cell proliferation and differentiation by activating one or several downstream pathways of mitogen-activated protein kinase (MAPK) [12,13]. Therefore, we hypothesize that HO-1 probably inhibit the apoptosis of AML cells via such pathways. 2. Materials and methods 2.1. Cell lines and cell culture
∗ Corresponding author at: Department of Hematology, the Affiliated Hospital of Guiyang Medical College, Guiyang 550004, China. Tel.: +86 0851 6774276. E-mail address: [email protected] (J. Wang). http://dx.doi.org/10.1016/j.leukres.2015.02.009 0145-2126/© 2015 Elsevier Ltd. All rights reserved.
Human AML cell lines HL-60 (M2, exhibiting loss and several rearrangements involving chromosome 5) and U937 (M5, t[10;11][p13;q14]) were purchased from the American Type Culture Collection (Manassas, VA). They were cultured in RPMI 1640 media with 10% fetal bovine serum (Gibco, USA) plus 100 U/ml penicillin and
X. Lin et al. / Leukemia Research 39 (2015) 544–552
545
100 mg/ml streptomycin in a 37 ◦ C humidified atmosphere containing 5% CO2 /95% air.
level. -Actin was used as the internal control. The primer sequences are listed in Table 2.
2.2. Patient samples
2.9. Western blotting
Bone marrow (BM) samples were obtained from AML patients (blasts >60%) at diagnosis or at relapse. Patients’ characteristics are shown in Table 1. CD34+ cells originating from healthy donors’ peripheral blood (PB) served as controls. They were sublimated by using immunomagnetic cell sorting system (MACS) (Miltenyi Biotech, Auburn CA). According to immunophenotypes, leukemic cells from patients were sorted by distinguished combinations of antibodies via performing on a FACS Aria instrument (BD Biosciences). After sorting, cell viability (>95%) was measured by the Trypan-blue dye exclusion assay, the purity of the cells (85–95%) were detected by flow cytometry. This study was approved by the Ethics Committee of Guiyang Medical College in accordance with the Declaration of Helsinki, and all subjects signed consent forms.
Western blotting was performed as described [23]. Primary antibodies used in this study including anti-HO-1, anti-caspase 3, anti-caspase 8, anti-caspase 9, anti-p38, anti-phosphorylated-p38, anti-phosphorylated-ERK1/2 (pERK1/2), anti-ERK1/2, anti-phosphorylated-JNK (threonine 183/tyrosine 185), anti-JNK, antic-JUN and anti-phosphorylated-c-JUN (serine 63). Their optical densities were analyzed with Quantity One software. The expressions of target genes were normalized to that of -actin.
2.3. Drugs and chemicals Cytarabine was purchased from Pfizer, Inc. (New York City, NY, USA). JNK inhibitor (SP600125) was bought from Beyotime Institute of Biotechnology Co., Ltd. (Shanghai, China). Reagents were formulated in dimethyl sulfoxide (DMSO) and stored at −20 ◦ C. Prior to use, stock solutions were diluted with serum-free RPMI medium to ensure the concentration of DMSO less than 0.02%. All antibodies were purchased from Sigma (St. Louis, MO, USA). 2.4. Construction of recombinant lentiviral vectors and transfection Sequences containing human HO-1 (HO-1, 5 -GCGTTTACCCGCCATCCGCACCCTAGGAGATCTCAGCCACAG-3 ) and small interfering RNA targeting human HO1 (siRNA-HO-1, 5 -TGGTAGGGCTTTATGCCATGTTTCAAGAGAACATGGCATAAAGCCCTACTTTTTTC-3 ) were selected with Invitrogen designer software. Retroviruses were generated by transfecting empty plasmia vectors containing enhanced green fluoresence protein (EGFP) or vectors containing human HO-1-EGFP/siRNA-HO-1EGFP using Fugene HD6 into 293FT packaging cells [14,15]. Lentiviral stocks were concentrated using Lenti-XTM concentrator and titers were determined with LentiXTM qRT-PCR titration kit (Shanghai Innovation Biotechnology Co., Ltd., China). Finally, 4 recombinant lentiviral vectors, lentivirus-V5-D-TOPO-HO-1-EGFP (L-HO1), lentivirus-V5-D-TOPO-EGFP (TOPO-EGFP), lentivirus-pRNAi-U6.2-EGFP-siHO-1 (siHO-1), lentivirus-pRNAi-U6.2-EGFP (RNAi-EGFP), were constructed. For infection, cells were plated onto 12 well plates at 2.5 × 105 cells/well and infected with lentiviral stocks at an multiplicity of infection (MOI) of 10 in the presence of polybrene (10 g/ml), then analyzed by fluorescence microscopy (Olympus, Tokyo, Japan) and western blotting 48 h post infection. HL-60 cells were transfected with L-HO-1 and TOPO-EGFP, and U937 cells with siHO-1 and RNAi-EGFP, respectively. 2.5. Animal experiments All animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animal, and were approved by the Biomedical Ethics Committee of the Affiliated Hospital of Guiyang Medical College. Six- to eight-week-old SCID mice [16] were provided by the Animal Center of Guiyang Medical College (Guiyang, China). They were exposed to total body irradiation (TBI) for 24 h, then were subcutaneously injected in the right armpits with U937 cells (5 × 106 –1 × 107 cells per mouse) [16–18] which were in the logarithmic growth phase. Animals were randomly divided into five groups (n = 10). The blank group was injected with normal saline, while the experimental groups were injected with unmodified U937 cells, U937 cells with silenced HO-1, U937 cells carrying control vector as well as U937 cells treated by both HO-1 silencer and JNK inhibitor, respectively. The AML mouse models were validated by the application of flow cytometry to detect the expression of PE-CY-CD45/PE-CD13 in BM cells [19]. Tumors’ sizes were measured by vernier caliper once or twice per week and calculated as /6 length × width2 [17]. 2.6. Cell growth analysis by MTT assay MTT assay was used to analyze cell growth and viability as described [20]. 2.7. Assessment of apoptosis Apoptosis was evaluated by annexin V/propidium iodide (PI) (7sea biotech, Shanghai, China) staining and flow cytometry as described [21]. 2.8. Quantitative real-time PCR Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). Reverse transcription was performed using M-MLV reverse transcriptase cDNA synthesis kit (Takara, Japan). Quantitative real-time PCR was performed as described [22]. A comparative CT method (CT) was used to analyze the gene expression
2.10. Histology Livers, spleens, and tumor tissues of mouse were collected from the blank and experimental groups. These organs and tissues were fixed in 10% neutral formalin for 24 h. They were embedded in paraffin followed by cutting into sections. In order to record the invasion of leukemic cells, prepared sections were subsequently stained by hematoxylin–eosin and observed under a microscope. 2.11. Statistical analysis All data were analyzed by SPSS ver.19.0 software package (SPSS, Chicago, USA). Statistical significance among groups was determined by Student’s t-test. The correlation between the expression of HO-1 and white blood cell (WBC) count of AML was built up by the application of Spearmant. P values less than 0.05 were considered statistically significant. Each experiment was performed in triplicate, data were presented as mean ± standard deviation (SD). Kaplan–Meier survival curves were plotted and analyzed with the log-rank test.
3. Results 3.1. HO-1 is overexpressed in most AML patient samples A total of 32 AML patients were sampled. The majority of them (70%) had a overexpression of HO-1 at messenger RNA (mRNA) level and protein level, especially 9 patients with M5. Contrarily, the normal CD 34+ cells only showed a minimal level of HO-1 (Fig. 1A and B). In addition, there was a positive correlation between the expression of HO-1 and WBC count that 18 AML patients with leukocytosis at diagnosis showed overexpression of HO-1 (Fig. 1C). These data confirm that HO-1 is overexpressed in AML at both the mRNA and protein levels, and it is closely associated with leukocytosis at diagnosis. Although the number of samples is limited, patients with M5 tend to have a higher level of HO-1 compared to that of other AML subtypes. 3.2. High expression of HO-1 can inhibit the apoptosis of HL-60 and U937 cells We did compare the expression of HO-1 among cell lines, and the results showed that cell lines U937, THP-1 and Kasumi-1 were in a high expression, while HL-60 and NB4 were low (Fig. 2A). Furthermore, we regulated the expression of HO-1 in cell lines so as to investigate its effects on apoptosis. The expressions of HO-1 in U937, THP-1 and Kasumi-1 were downregulated by transfecting with siHO-1, and the other cell lines were upregulated by transfecting with L-HO-1. However, only U937 and HL-60 were successfully transfected and the positivity of transfections were more than 95% (Fig. 2B). The results of western blotting showed that HO-1 was highly expressed in HL-60-Lentivirus-V5-D-TOPO-HO-1-EGFP (HL-60-L-HO-1) cells but lowly in U937-lentivirus-pRNAi-U6.2EGFP-siHO-1 (U937-siHO-1) cells, which suggested successful transfections (Fig. 2B). Further, we examined the viability of AML cell lines in response to varying concentrations of cytarabine which is one of the firstline chemotherapeutic agents [22]. The drug concentrations were adopted based on previous studies [24,25]. HL-60, HL-60-L-HO1, HL-60-TOPO-EGFP, U937, U937-siHO-1, U937-RNAi-EGFP cells were treated with cytarabine at different concentrations (0.5 M,
546
X. Lin et al. / Leukemia Research 39 (2015) 544–552
Table 1 Summary of clinical features of AML patients. Sample
Age (years)
Sex
FAB
BM/PB
Disease status
WBC (109 /L)
%Blasts (BM)
Cytogenetics
AML1 AML2 AML3 AML4 AML5 AML6 AML7 AML8 AML9 AML10 AML11 AML12 AML13 AML14 AML15 AML16 AML17 AML18 AML19 AML20 AML21 AML22 AML23 AML24 AML25 AML26 AML27 AML28 AML29 AML30 AML31 AML32
69 41 38 77 26 39 19 17 20 45 19 21 39 46 24 43 35 24 24 61 32 22 58 68 39 56 72 27 74 48 52 82
M M F F M M F F M M F F F M F M F M M M M F M F F F M F F M F M
M2 M2 M2 M2 M2 M2 M2 M2 M3 M3 M3 M3 M3 M3 M3 M4 M4 M4 M4 M4 M4 M4 M4 M5 M5 M5 M5 M5 M5 M5 M5 M5
BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM BM
Untreated Relapsed Untreated Untreated Relapsed Untreated Relapsed Untreated Untreated Untreated Untreated Untreated Relapsed Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Untreated Relapsed Relapsed Relapsed Relapsed Untreated
0.88 2.61 7.5 12.75 22.06 59.93 72.25 109.43 0.44 0.83 1.17 2.9 28.74 30.69 70.1 2 3.06 4.68 14.81 17.17 76.36 81.25 151.4 1.2 3.65 6.48 24.6 34.91 36.88 74.81 129.8 183.9
68 75 62 82 67 80 88 83 81 77 66 83 90 82 83 71 61 68 67 89 69 75 81 64 67 87 71 85 63 83 74 78
Normal Normal Normal t(8;21) Normal Normal t(8;21) der(3) t(8;21) t(15;17) t(15;17) t(15;17) t(15;17) t(15;17) t(15;17) t(15;17) inv(16) Normal Normal Normal Normal inv(16) inv(16) Not available Normal Normal Normal Not available Complex Not available Normal Complex Not available
Abbreviation: F = female; M = male; BM = bone marrow; PB = peripheral blood; WBC = white blood cell; M2 = acute myeloid leukemia with maturation; M3 = acute promyelocytic leukemia; M5 = acute monocytic leukemia.
Table 2 The primer sequences used in quantitative real-time PCR. Gene name
Sequences
HO-1 -actin
Length (bp)
F (5 –3 )
R (5 –3 )
ACCCATGACACCAAGGACCAGA TCACCCACACTGTGCCCATCTACGA
GTGTAAGGACCCATCGGAGAAGC CAGCGGAACCGCTCATTGCCAATGG
1 M, 2 M, 4 M, 8 M, 12 M, 16 M and 20 M). With the increasing concentration of the cytarabine, the viability of cells was decreased gradually. At the same concentration of cytarabine, cells with a high HO-1 expression had significantly higher viability rates than their counterparts (Fig. 2C). The apoptosis of high HO1 expression groups was the lowest, and it was further validated by Annexin V/PI assay after inducting with 1 M and 2 M cytarabine for 24 h (Fig. 2D). Interestingly, the expression of HO-1 was negatively correlated with apoptotic proteins-including caspase 3, caspase 8 and caspase 9, when cells were treated with 0.5 M cytarabine for 24 h (Fig. 2E). And HO-1 was further increased in response to cytarabine (Fig. 2F). This phenomenon was consistent with that of Heasman SA [22]. Hence, these data demonstrate that up-regulating expression of HO-1 can inhibit the apoptosis of AML cell lines, indicating that HO-1 has anti-apoptotic effect.
3.3. Overexpression of HO-1 accelerates leukemia’s progression in vivo We established xenograft mouse models of AML using un/modified U937 cells to further verify HO-1’s role in vivo. The expression of CD45, the marker of human white cells, proved that the xenograft mouse models were successfully established by transplanting with U937 cells (XM/U937), U937-siHO-1 cells
157 195
(XM/U937-siHO-1), U937-RNAi-EGFP cells (XM/U937-RNAi-EGFP) (Fig. 3A). Compared with the HO-1 downregulated groups, the xenograft mouse models with high HO-1 level developed tumors more rapidly (Fig. 3B). There was a significant increase in disease latency in the HO-1 downregulated groups (lumps of XM/U937 and XM/U937-RNAi-EGFP formed averagely on the 15th day and the 18th day, respectivelys, whereas it took 33 days for the HO-1 downregulted group). In high HO-1 expression group, the spleens of xenograft mouse models enlarged evidently (Fig. 3C), while the HO-1 downregulted group survived significantly longer than the other two groups (Fig. 3D). Specifically, the livers and spleens of XM/U937 and XM/U937-RNAi-EGFP groups were significantly infiltrated by leukemic cells (39–43 leukemic cells/high power field (HP)), and tumor tissues grew rapidly and invaded surrounding striated muscles considerably to subject to necrosis. Contrarily, the organs and tissues of XM/U937-siHO-1 mouse were slightly affected by leukemic cells (15–21 leukemic cells/HP) (Fig. 3E). Therefore, we confirm that HO-1 promotes the proliferation and inhibits the apoptosis of AML cells in vivo.
3.4. HO-1 results in activated JNK/c-JUN signaling pathway MAPK pathway mainly includes three branches, extracelluar signal-regulated kinases 1 and 2 (ERK1/2), p38, and c-Jun
X. Lin et al. / Leukemia Research 39 (2015) 544–552
547
Fig. 1. HO-1 is overexpressed in most AML patient samples. (A) Differential expression of HO-1 mRNA in AML patients and normal CD34+ cells were determined by qRT-PCR. Data are presented as CT of HO-1 expression in patient samples, with higher CTs indicating lower expression. **P-value < 0.01,***P-value < 0.001. (B) Western blotting analysis of HO-1 protein expression levels in AML patients and normal CD34+ cells. (C) Scatterplot representation of the correlation between the expression of HO-1 and WBC count in AML patient samples. Spearman correlation coefficient r (C, left) for CTs v WBC = −0.823, P < 0.001, Spearman correlation coefficient r (C, right) for protein levels of HO-1 v WBC = 0.743, P < 0.001.
NH2 -terminal kinase (JNK) [26]. In order to explore the correlation between MAPK pathway and HO-1, we quantified the expressions of JNK, phosphorylation of threonine 183/tyrosine 185(pJNKThr183/Tyr185 ), p38, phosphorylation of p38 (p-p38), ERK1/2 and phosphorylation of ERK1/2 (pERK1/2) by Western blotting with the variation of HO-1. Results showed that HO-1 basically had no correlation with p38, p-p38, ERK1/2 and pERK1/2, but was positively correlated with pJNKThr183/Tyr185 . Moreover, upregulating HO-1 elevated the level of phosphorylated-c-JUN at serine63 (pc-JUNSer63 ) and total c-JUN (Fig. 4A.) Similar results were found in the tumor tissues of our xenograft mouse models (Fig. 4B).
This positive correlation was validated by analyzing BM aspirates from 3 patients with M5 who suffered a relapse in a short period of time. The higher expression of HO-1 was accompanied with the increased expressions of pJNKThr183/Tyr185 , pc-JUNSer63 , and total cJUN at relapse than those at diagnosis (Fig. 4C). Next, U937 cells were cultured for 24, 48 and 72 h following with the treatment of the pan-JNK inhibitor (SP600125) at a concentration of 10uM [4] and the expression of pJNKThr183/Tyr185 was measured by Western blot. Since the inhibitory effects were at optimum after 72-hour incubation (Fig. 4D), HL-60 and U937 cells were incubated with SP600125 for 72 h. Although HO-1 expression of HL-60 and U937
548
X. Lin et al. / Leukemia Research 39 (2015) 544–552
Fig. 2. High expression of HO-1 can inhibit the apoptosis of HL-60 and U937 cells. (A) Western blotting analysis of protein levels of HO-1 in AML cell lines. (B) Positivity of lentivirus-mediated HO-1 and siHO-1 transfections (>95%) observed by fluorescence microscopy. Expression of HO-1 after transfections was detected by Western blotting. (C) Cells were treated with different doses of cytarabine for 24 h. Viability was evaluated by MTT assay. *P < 0.05. (D) Apoptotic rates were detected by flow cytometry with Annexin V/PI assay, *P < 0.05. (E) Total protein was extracted from different cell groups after the treatment of 0.5 M cytarabine for 24 h, then detecting the expression of HO-1, caspase 3, caspase 8 and caspase 9. (F) The treatment of cytarabine (0.5uM) increased HO-1 expression, *P < 0.05.
cells changed slightly, the expressions of pJNKThr183/Tyr185 were plummeted (Fig. 4E), indicating that JNK/C-JUN was in the downstream of HO-1. Therefore, it is believed that JNK/c-JUN signaling pathway can be activated by it upstream enzyme, HO-1, to inhibit cell apoptosis.
3.5. The inhibition of both JNK and HO-1 can enhance AML cell apoptosis We then tested whether JNK/c-JUN signaling pathway had a functional impact on cellular events induced by HO-1. In addition to silencing HO-1, we treated U937-siHO-1 with SP600125 (U937-siHO-1/SP600125) to further evaluate the functional effects, exerted by HO-1, on growth and survival of AML cells. The apoptotic rate was measured by Annexin V/PI assay after treating U937-siHO1/SP600125 with 1 M and 2 M cytarabine for 24 h. The apoptosis of U937-siHO-1/SP600125 group was significantly increased in comparison with U937-siHO-1 group (Figs. 2D and 5A). Similarly, we established AML mouse model with U937-siHO-1/SP600125 cells (XM/U937-siHO-1/SP600125). XM/U937-siHO-1/SP600125 mouse survived longer than the XM/U937-siHO-1 group (Fig. 5B), with less leukemic cells infiltrating in the livers and spleens (6–8 leukemic cells/HP) (Fig. 5C). Our findings suggest that JNK/c-JUN pathway enhance the inhibitory effects of HO-1 on the apoptosis of AML cells.
4. Discussion Previous studies have shown that expression of HO-1 is usually increased in human cancer cells [27]. It plays an anti-apoptotic role in cancer chemotherapy and induces tumor-progression, such as in melanoma [7], breast carcinoma [28], non-small cell lung cancer [29], hepatocarcinoma [30], pancreatic cancer [31]. However, little has been known in hematological malignancies. The present study demonstrates the expression of HO-1and its role in AML. To our surprise, AML patients showed significantly higher expression of HO-1 than normal CD34+ cells. Furthermore, HO-1 was considerably prone to overexpressing in patients with M5 subtype (9cases, either at diagnosis or at relapse). The level of HO-1 expression was also higher in 18 first-visit leukocytic patients than the left apart from M5. These findings have never been reported before. Furthermore, the overexpression and knockdown of HO-1 had effects on the apoptosis of AML cell lines. After incubation with cytarabine, the cells with HO-1 overexpression had the higher viability rate and the lower apoptotic rate. Correspondingly, the xenogaft mouse models of AML with such cells had a significantly shorter survival time, and a higher extent of organ invasion, such as livers and spleens. Therefore, HO-1 can suppress the apoptosis of AML cells in vitro. Despite of the existence of cytokines and growth factors in vivo, it is also conceivable that HO-1 can exert this strong inhibitory effect in vivo like our observations in vitro.
X. Lin et al. / Leukemia Research 39 (2015) 544–552
549
Fig. 3. Overexpression of HO-1 accelerates leukemia’s progression in vivo. (A) Expressions of PE-CY-CD45/PE-CD13 on BM cells detected with flow cytometry. (B) The xenograft mouse models of AML were killed on the 15th day after tumor formation. Tumor volume was measured and calculated as /6 length × width2 . (C) Sizes and weights of spleens from xenograft mouse models and control groups. (D) Survival time of control group, XM/U937 group (n = 9), XM/U937-siHO-1 group (n = 8) and XM/U937 group (n = 8), (P < 0.05). (E) Invasion of leukemic cells into the organs of xenograft mouse models (arrow: invasion of U937 cells).
550
X. Lin et al. / Leukemia Research 39 (2015) 544–552
Fig. 4. HO-1 results in activated JNK/c-JUN signaling pathway. (A) Expressions of HO-1, c-JUN, pJNKThr183/Tyr185, pc-JUNSer63, total c-JUN, ERK1/2, pERK1/2, p38 and p-p38 in different cell groups detected by Western blot. (B) Expression of the abovementioned proteins in the tumor tissues of xenograft mouse models of AML. (C) Western blotting analyzing the expressions of HO-1, c-JUN, pJNKThr183/Tyr185, pc-JUNSer63 in M5 patients. (D) Cells were treated with 10 M SP600125 and cultured for 24, 48 and 72 h, and analyzed by Western blot. (E) Expressions of HO-1 and pJNKThr183/Tyr185 were changed after 72-hour of treatment with 10 M SP600125.
X. Lin et al. / Leukemia Research 39 (2015) 544–552
551
Fig. 5. The inhibition of both JNK and HO-1 can enhance AML cell apoptosis. (A) The apoptotic rate was detected by Annexin V/PI assay, *P < 0.05. (B) Survival time of XM/U937-siHO-1 group (n = 9) and XM/U937-siHO-1/SP600125 group (n = 7), P < 0.05. (C) Invasion of leukemic cells into the organs of XM/U937-siHO-1/SP600125 group (arrow: invasion of U937 cells).
Up to now, most studies concerning the role of HO-1 in the signaling pathways of AML apoptosis have focused on the correlation between HO-1 and NF-B or Nrf2 [32–34]. In contrast, HO-1 has seldom been correlated with the MAPK pathway, mainly including ERK, p38 and JNK ones, to participate in cell proliferation, apoptosis and differentiation [35]. The c-JUN oncogene is a member of the activator protein-1 (AP-1) family of transcription factors that is phosphorylated and activated by the JNK [36]. In this study, up-regulating HO-1 increased the expression of pJNKThr183/Tyr185 , pc-JUNSer63 and total c-JUN. The expression of HO-1 showing no response to JNK inhibitor verified that JNK/c-JUN is in the downstream. Nevertheless, JNK/c-JUN can both facilitate and suppress cell apoptosis [37]. Sykes SM observed that inhibition of FOXO3 resulted in activated JNK/c-JUN pathway, which suppressed AML cell apoptosis [4]. Combining JNK inhibition with silencing HO-1 significantly increased the apoptosis of U937 cells. And SCID mouse injected with U937 cells which were both JNK inhibited and HO1 silenced survived longer after tumor formation. According to references and our results, the high level of HO-1 exerts an antiapoptic effects on AML cells by JNK/c-JUN signaling pathway which probably suppresses P53 or releases reactive oxygen species (ROS) [26,37], but this postulation still needs in-depth study.
A bigger sample pool of AML patients is required for further investigations on the verification of HO-1 expression in primary leukemic cells. It is better to elucidate the underlying signal pathway, because the mechanism of HO-1 resisting cell apoptosis by JNK/c-JUN pathway remains unclearly. In summary, HO-1 is not only highly expressed in most AML cases, but also inhibited cell apoptosis. Silencing HO-1 promoted cell apoptosis. These findings herein provide a valuably experimental basis for targeted therapy of AML. Conflict of interest statement The authors declare no conflict of interest. Acknowledgments This study was partly supported by the National Natural Science Foundation of China (No. 81070444, No. 81270636, No. 81360501 and No. 81470006), International Cooperation Project of Guizhou Province (No. 2011-7010), Social Project of Guizhou Province (No. 2011-3012) and Provincial Government Special Fund of Guizhou
552
X. Lin et al. / Leukemia Research 39 (2015) 544–552
Province (No. 2010-84). We are grateful for all doctors’ help for collecting clinical samples in the Department of Hematology, the Affiliated Hospital of Guiyang Medical College and for Dr. Yiguo Long’s guidance in the histological examination of transplanted mice in the Department of Pharmacy, the Affiliated Hospital of Guiyang Medical College. Contributors: J.W., X.L. and Z.W. contributed to the design and analysis of this study. X.L., Q.F., S.C., N.Z., Q.C., M.Y., Y.Z. and Z.W. performed laboratory-based experiments. X.L. and Z.W. wrote manuscript, and all authors contributed to and agreed on final version. References [1] Fröhling S, Scholl C, Gilliland DG, Levine RL. Genetics of myeloid malignancies: pathogenetic and clinical implications. J Clin Oncol 2005;23(26):6285–95. [2] Rowe JM, Tallman MS. How I treat acute myeloid leukemia. Blood 2010;116(17):3147–56. [3] Döhner H, Estey EH, Amadori S, Appelbaum FR, Büchner T, Burnett AK, et al. Diagnosis and management of acute myeloid leukemia in adults: recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood 2010;115(3):453–74. [4] Sykes SM, Lane SW, Bullinger L, Kalaitzidis D, Yusuf R, Saez B, et al. Akt/FOXO signaling enforces reversible differentiation blockade in myeloid leukemias. Cell 2011;146(5):697–708. [5] Miyazaki T, Kirino Y, Takeno M, Samukawa S, Hama M, Tanaka M, et al. Expression of heme oxygenase-1 in human leukemic cells and its regulation by transcriptional Bach 1. Cancer Sci 2010;101(6):1409–16. [6] Jozkowicz A, Was H, Dulak J. Heme oxygenase-1 in tumors: is it a false friend? Antioxid Redox Signal 2007;9(12):2099–117. [7] Was H, Cichon T, Smolarczyk R, Rudnicka D, Stopa M, Chevalier C, et al. Overexpression of heme oxygenase-1 in murine melanoma: increased proliferation and viability of tumor cells, decreased survival of mice. Am J Pathol 2006;169(6):2181–98. [8] Mayerhofer M, Florian S, Krauth MT, Aichberger KJ, Bilban M, Marculescu R, et al. Identification of heme oxygenase-1 as a novel BCR/ABL-dependent survival factor in chronic myeloid leukemia. Cancer Res 2004;64(9): 3148–54. [9] Mayerhofer M, Gleixner KV, Mayerhofer J, Hoermann G, Jaeger E, Aichberger KJ, et al. Targeting of heat shock protein 32 (Hsp32)/heme oxygenase-1 (HO-1) in leukemic cells in chronic myeloid leukemia: a novel approach to overcome resistance against imatinib. Blood 2008;111(4):2200–10. [10] Rushworth SA, MacEwan DJ. HO-1 underlies resistance of AML cells to TNFinduced apoptosis. Blood 2008;111(7):3793–801. [11] Nagai T, Kikuchi S, Ohmine K, Miyoshi T, Nakamura M, Kondo T, et al. Hemin reduces cellular sensitivity to imatinib and anthracyclins via Nrf2. J Cell Biochem 2008;104(2):680–91. [12] Elbirt KK, Whitmarsh AJ, Davis RJ, Bonkovsky HL. Mechanism of sodium arsenite-mediated induction of heme oxygenase-1 in hepatoma cells: role of mitogen-activated protein kinases. J Biol Chem 1998;(15):8922–31. [13] Alam J, Wicks C, Stewart D, Gong P, Touchard C, Otterbein S, et al. Mechanism of heme oxygenase-1 gene activation by cadmium in MCF-7 mammary epithelial cells. Role of p38 kinase and Nrf2 transcription factor. J Biol Chem 2000;275(36):27694–702. [14] Wang JS, Singh H, Zhang F, Ishizuka T, Deng H, Kemp R, et al. Endothelial dysfunction and hypertension in rats transduced with CYP4A2 adenovirus. Circ Res 2006;(7):962–9. [15] Ma D, Fang Q, Li Y, Wang JS, Sun J, Zhang Y, et al. Crucial role of heme oxygenase1 in the sensitivity of acute myeloid leukemia cell line Kasumi-1 to ursolic acid. Anticancer Drugs 2014;25(4):406–14. [16] Shan WL, Ma XL. How to establish acute myeloid leukemia xenograft models using immunodeficient mice. Asian Pac J Cancer Prev 2013;14(12):7057–63.
[17] Rosato R, Hock S, Dent P, Dai Y, Grant S. LBH-589 (panobinostat) potentiates fludarabine anti-leukemic activity through a JNK- and XIAP-dependent mechanism. Leuk Res 2012;36(4):491–8. [18] Tajima N, Fukui K, Uesato N, Maruhashi J, Yoshida T, Watanabe Y, et al. JTE-607, a multiple cytokine production inhibitor, induces apoptosis accompanied by an increase in p21waf1/cip1 in acute myelogenous leukemia cells. Cancer Sci 2010;101(3):774–81. [19] Shang Z, Wang J, Wang D, Xiao M, Li TJ, Wang N, et al. Establishment of xenotransplantation model of human CN-AML with FLT3-ITD (mut)/NPM1 (−) in NOD/SCID mice. J Huazhong Univ Sci Technolog Med Sci 2013;33(3):329–34. [20] Papa V, Tazzari PL, Chiarini F, Cappellini A, Ricci F, Billi AM, et al. Proapoptotic activity and chemosensitizing effect of the novel Akt inhibitor perifosine in acute myelogenous leukemia cells. Leukemia 2008;22(1):147–60. [21] Wang JS, Ma D, Li Y, Yang Y, Hu XY, Zhang W, et al. Targeted delivery of CYP2E1 recombinant adenovirus to malignant melanoma by bone marrow-derived mesenchymal stem cells as vehicles. Anticancer Drugs 2014;25(3):303–14. [22] Heasman SA, Zaitseva L, Bowles KM, Rushworth SA, Macewan DJ. Protection of acute myeloid leukemia cells from apoptosis induced by front-line chemotherapeutics is mediated by haem oxyenase-1. Oncotarget 2011;2(9):658–68. [23] Chen SY, Wang JS, Fang Q, Gao R, Shi QY, Zhang H, et al. Upregulated heme oxygenase-1 expression of mouse mesenchymal stem cells resists to chemotherapy-induced bone marrow suppression. Chin Med J (Engl) 2014;127(7):1310–6. [24] Kanno S, Higurashi A, Watanabe Y, Shouji A, Asou K, Ishikawa M. Susceptibility to cytosine arabinoside (Ara-C)-induced cytotoxicity in human leukemia cell lines. Toxicol Lett 2004;152(2):149–58. [25] Mitsuhashi M, Endo K, Obara K, Izutsu H, Ishida T, Chikatsu N, et al. Ex vivo simulation of the action of antileukemia drugs by measuring apoptosis-related mRNA in blood. Clin Chem 2008;54(4):673–81. [26] Taylor CA, Zheng Q, Liu Z, Thompson JE. Role of p38 and JNK MAPK signaling pathways and tumor suppressor p53 on induction of apoptosis in response to Ad-eIF5A1 in A549 lung cancer cells. Mol Cancer 2013;12:35. [27] Rushworth SA, Bowles KM, Raninga P, MacEwan DJ. NF-kappaB-inhibited acute myeloid leukemia cells are rescued from apoptosis by heme oxygenase-1 induction. Cancer Res 2010;70(7):2973–83. [28] Noh SJ, Bae JS, Jamiyandorj U, Park HS, Kwon KS, Jung SH, et al. Expression of nerve growth factor and heme oxygenase-1 predict poor survival of breast carcinoma patients. BMC Cancer 2013;13:516. [29] Tsai JR, Wang HM, Liu PL, Chen YH, Yang MC, Chou SH, et al. High expression of heme oxygenase-1 is associated with tumor invasiveness and poor clinical outcome in non-small cell lung cancer patients. Cell Oncol (Dordr) 2012;35(6):461–71. [30] Liu YS, Li HS, Qi DF, Zhang J, Jiang XC, Shi K, et al. Zinc protoporphyrin IX enhances chemotherapeutic response of hepatoma cells to cisplatin. World J Gastroenterol 2014;20(26):8572–82. [31] Berberat PO, Dambrauskas Z, Gulbinas A, Giese T, Giese N, Künzli B, et al. Inhibition of heme oxygenase-1 increases responsiveness of pancreatic cancer cells to anticancer treatment. Clin Cancer Res 2005;11(10):3790–8. [32] Helbig G, Christopherson 2nd KW, Bhat-Nakshatri P, Kumar S, Kishimoto H, Miller KD, et al. NF-kappaB promotes breast cancer cell migration and metastasis by inducing the expression of the chemokine receptor CXCR4. J Biol Chem 2003;278(24):21631–8. [33] Rushworth SA, Zaitseva L, Langa S, Bowles KM, MacEwan DJ. FLIP regulation of HO-1 and TNF signalling in human acute myeloid leukemia provides a unique secondary anti-apoptotic mechanism. Oncotarget 2010;1(5):359–66. [34] Rushworth SA, Macewan DJ. The role of nrf2 and cytoprotection in regulating chemotherapy resistance of human leukemia cells. Cancers (Basel) 2011;3(2):1605–21. [35] Zgheel F, Alhosin M, Rashid S, Burban M, Auger C, Schini-Kerth VB. Redoxsensitive induction of Src/PI3-kinase/Akt and MAPKs pathways activate eNOS in response to EPA:DHA 6:1. PLoS One 2014;9(8):e105102. [36] Dérijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, et al. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 1994;76(6):1025–37. [37] Tournier C. The 2 faces of JNK signaling in cancer. Genes Cancer 2013;4(9–10):397–400.
