The American Journal of Chinese Medicine, Vol. 42, No. 3, 729–742 © 2014 World Scientific Publishing Company Institute for Advanced Research in Asian Science and Medicine DOI: 10.1142/S0192415X14500475
Am. J. Chin. Med. 2014.42:729-742. Downloaded from www.worldscientific.com by VANDERBILT UNIVERSITY on 12/28/14. For personal use only.
Bufalin Induces Cell Death in Human Lung Cancer Cells through Disruption of DNA Damage Response Pathways Shin-Hwar Wu,*,§ Tzu-Yun Wu,† Yung-Ting Hsiao,† Ju-Hwa Lin,† Shu-Chun Hsu,† , Te-Chun Hsia,‡,¶ Su-Tso Yang,|| Wu-Huei Hsu¶ and Jing-Gung Chung† ** *Institute of Clinical Medical Science † Department of Biological Science and Technology ‡ Graduate Institute of Chinese Medical Science China Medical University Taichung, Taiwan, ROC §Division
of Critical Care Medicine, Department of Medicine Changhua Christian Hospital, Taiwan ¶
Department of Internal Medicine ||Department of Radiology China Medical University Hospital Taichung, Taiwan, ROC **Department
of Biotechnology, Asia University Taichung, Taiwan
Abstract: Bufalin is a key component of a Chinese medicine (Chan Su) and has been proved effective in killing various cancer cells. Its role in inducing DNA damage and the inhibition of the DNA damage response (DDR) has been reported, but none have studied such action in lung cancer in detail. In this study, we demonstrated bufalin-induced DNA damage and condensation in NCI-H460 cells through a comet assay and DAPI staining, respectively. Western blotting indicated that bufalin suppressed the protein levels associated with DNA damage and repair, such as a DNA dependent serine/threonine protein kinase (DNA-PK), DNA repair proteins breast cancer 1, early onset (BRCA1), 14-3-3 (an important checkpoint keeper of DDR), mediator of DNA damage checkpoint 1 (MDC1), O6-methylguanineDNA methyltransferase (MGMT) and p53 (tumor suppressor protein). Bufalin could activate phosphorylated p53 in NCI-H460 cells. DNA damage in NCI-H460 cells after treatment with
Correspondence to: Dr. Jing-Gung Chung, Department of Biological Science and Technology, China Medical University, No. 91, Hsueh-Shih Road, Taichung 404, Taiwan. Tel: (þ886) 42-205-3366 (ext. 2161), Fax: (þ886) 42-205-3764, E-mail: [email protected] or Dr. Wu-Huei Hsu, Department of Internal Medicine, China Medical University, Taichung, Taiwan. Tel: (þ886) 42-205-3366 (ext. 3483), Fax: (þ886) 42-203-8883, E-mail: [email protected]
729
730
S.-H. WU et al. bufalin up-regulated its ATM and ATR genes, which encode proteins functioning as sensors in DDR, and also up-regulated the gene expression (mRNA) of BRCA1 and DNA-PK. But bufalin suppressed the gene expression (mRNA) of p53 and 14-3-3 , however, bufalin did not significantly affect the mRNA of MGMT. In conclusion, bufalin induced DNA damage in NCI-H460 cells and also inhibited its DNA repair and checkpoint function. Keywords: Bufalin; Human Lung Cancer NCI-H460 Cells; DNA Damage.
Am. J. Chin. Med. 2014.42:729-742. Downloaded from www.worldscientific.com by VANDERBILT UNIVERSITY on 12/28/14. For personal use only.
Introduction Bufalin is a key component of a traditional Chinese medicine (Chan Su), which is derived from serous fluid of the posterior auricular glands of the toad. Its antitumor effects have been reported in several Chinese antiques. Modern researches have also confirmed bufalin can kill various cancer cells like lung cancer (Zhu et al., 2012), leukemia (Chen et al., 2009), hepatocellular carcinoma (Han et al., 2007) etc. by inducing their apoptosis. DNA damage is an almost inevitable consequence of apoptosis. However, mammalian cells have innate DNA damage response (DDR) pathways that can counteract the damage. The DDR pathway involves the detection of DNA damage and transduction of damage signals to appropriate effectors, which execute functions like DNA repair, cell cycle checkpoints and apoptosis (Liang et al., 2009). Because DDR potentially offsets the cytotoxic effects of anti-neoplastic treatment, DDR must be repressed before a significant killing can be observed. The first evidence came from the inhibition of DNA repair enzyme poly (ADP-ribose) polymerase results in the death of BRCA1 or 2 mutated cells (Bryant et al., 2005; Farmer et al., 2005). This antitumor effect of DDR inhibition was later further confirmed by human clinical trials (Audeh et al., 2010; Tutt et al., 2010). Many researchers now advocate developing new drugs inhibiting DDR and several potential candidates are currently under investigation (Basu et al., 2012). Bufalin has been found to have influence on DDR by modulating topoisomerase II (Pastor and Cortes, 2003). Bufalin also inhibits DNA repair enzyme poly (ADP-ribose) polymerase 1 in multiple myeloma cell and enhances its cytotoxic effect (Huang et al., 2013). However, bufalin’s role in inducing DNA damage and suppressing DDR has never been studied in detail. In this study, we examined the DNA damaging effect of bufalin on human lung cancer NCI-H460 cells. The role of bufalin in manipulating the main functions of DDR, namely DNA repair and checkpoint and apoptosis, has also been studied in detail with an aim to elucidate possible signal transduction pathways underlying these actions.
Materials and Methods Chemicals and Reagents Bufalin, dimethyl sulfoxide (DMSO), ethidium bromide, propidium iodide (PI), Tris-HCl and Triton X-100 were purchased from Sigma-Aldrich. RPMI-1640 medium, fetal bovine
BUFALIN INDUCES DNA DAMAGE IN HUMAN LUNG CANCER H460 CELLS
731
serum (FBS), L-glutamine, penicillin–streptomycin and trypsin-EDTA were purchased from Gibco ® /Invitrogen (Grand Island, NY, USA).
Am. J. Chin. Med. 2014.42:729-742. Downloaded from www.worldscientific.com by VANDERBILT UNIVERSITY on 12/28/14. For personal use only.
Cell Culture and Chemical Treatment Human lung carcinoma NCI-H460 cells were obtained from the Food Industry Research and Development Institute (Hsinchu, Taiwan). They were maintained in a RPMI-1640 minimum essential medium plus 10% fetal bovine serum, 1% L-glutamine, 100 units/ml of penicillin G and 100 g/ml of streptomycin. The cells were kept in a 37 C incubator under 5% CO2 and 95% air. Stocked cells were plated to a culture flask or a six-well plate at a density of 2–5 105 cells per ml prior to subsequent experiment (Ji et al., 2012; Leung et al., 2013). PI Exclusion Method and Flow Cytometric Assay Approximately 2 10 5 cells/well of NCI-H640 cells in 12-well plates were incubated with bufalin at final concentrations of 0 (vehicle, 0.5% DMSO), 1, 2 and 4 M for 24 hours. Cells from each treatment were stained with PI (5 g/ml) and analyzed by flow cytometry (Becton-Dickinson, San Jose, CA, USA) and cell viability was calculated as described previously (Wu et al., 2013). Comet Assay for DNA Damage Cells (2 10 5 cells/well) in 12-well plates were incubated with 1, 2 and 4 M of bufalin for 24 hours. Later the cells were harvested for studying DNA damage as described previously. Comets of cells on slides acquired DNA damage by the CometScoreTM Freeware analysis (TriTek Corporation, Sumerduck, VA, USA) (Chueh et al., 2013). Comet tail lengths were calculated, quantified, and expressed as mean SD. DAPI Staining NCI-H460 Cells (2 10 5 cells/well) were seeded in a 12-well plate. Bufalin was added to the cells with a final concentration of 2 M and incubated for 6, 12 and 24 hours. The cells were later harvested, washed with phosphate buffer saline (PBS), and fixed with 4% paraformaldehyde. The fixed cells were then washed with PBS again and stained with 4, 6diamidino-2-phenylindole (DAPI, 1 g/mL; Invitrogen) for 30 min in the dark. Cells were then examined under a fluorescent microscope, photographed and apoptotic cells identified as described previously (Yu et al., 2012). Effects of Bufalin on DNA-Damage-Response Proteins of NCI-H460 Cells by Western Blotting Total proteins were collected from the NCI-H460 cells (1 10 6 cells/well) after treatment with 2 M of bufalin for 0, 6, 12 and 24 hours. The amounts of proteins were
732
S.-H. WU et al.
measured by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting as described previously (Chou et al., 2013; Chang et al., 2013; Liu et al., 2013).
Am. J. Chin. Med. 2014.42:729-742. Downloaded from www.worldscientific.com by VANDERBILT UNIVERSITY on 12/28/14. For personal use only.
Real-Time PCR Assay for Examining the Expression of DNA Repair Genes Approximately 1 10 6 cells/well of NCI-H460 cells in 6-well plates were incubated with or without 0, 50, 100, and 200 nM of bufalin for a 24-hour treatment in RPMI-1640 medium grown at 37 C in 5% CO2 and 95% air. Total RNA from each treatment was extracted using the Qiagen RNeasy Mini Kit (Qiagen, Inc., Valencia, CA, USA). Briefly, RNA samples were reverse-transcribed for 30 min at 42 C with High Capacity cDNA Reverse Transcription Kit according to the standard protocol of the supplier (Applied Biosystems, Carlsbad, CA, USA). For quantitative PCR from each sample that was performed in the conditions: 2 min at 50 C, 10 min at 95 C, and 40 cycles of 15 sec at 95 C, 1 min at 60 C using 1 l of the cDNA reverse-transcribed as described above, 2X SYBRGreen PCR Master Mix (Applied Biosystems) and 200 nM of forward and reverse primers as shown in Table 1. Finally, each assay was run on an Applied Biosystems 7300 real-time PCR system in triplicate and the expression fold-change was derived from the comparative CT method (Chen et al., 2010). Table 1. Primers used in the real-time PCR. Primer Name homo ATM-F homo ATM-R homo ATR-F homo ATR-R homo-14-3-3 –F homo-14-3-3 –R homo DNA-PK-F homo DNA-PK-R homo BRCA1-F homo BRCA1-R homo MGMT-F homo MGMT-R homo p53-F homo p53-R homo GAPDH-F homo GAPDH-R
Primer Sequence CAGGGTAGTTTAGTTGAGGTTGACAG CTATACTGGTGGTCAGTGCCAAAGT ATGGCTGTGTGGCGGCCTG TCAGAGTCCCTCAGAC GTGTGTCCCCAGAGCCATGG ACCTTCTCCCGGTACTCACG CCAGCTCTCACGCTCTGATATG CAAACGCATGCCCAAAGTC CCAGGGAGTTGGTCTGAGTGA ACTTCCGTAAGGCATCGTAACAC CCTGGCTGAATGCCTATTTCC TGTCTGGTGAACGACTCTTGCT GGGTTAGTTTACAATCAGCCACATT GGGCCTTGAAGTTAGAGAAAATTCA ACACCCACTCCTCCACCTTT TAGCCAAATTCGTTGTCATACC
Each assay was conducted at least trice to ensure reproducibility. ATM, ataxia telangiectasia mutated; ATR, ATM-Rad3-related; DNAPK, DNA-dependent serine/threonine protein kinase; BRCA1, Breast cancer 1, early onset; MGMT, O6-methylguanine-DNA methyltransferase; GAPDH, glyceraldehydes-3-phosphate dehydrogenase.
BUFALIN INDUCES DNA DAMAGE IN HUMAN LUNG CANCER H460 CELLS
733
Statistical Analysis All data were expressed as mean SD. We used the Student’s t-test to compare the data of different groups. A p value of
Am. J. Chin. Med. 2014.42:729-742. Downloaded from www.worldscientific.com by VANDERBILT UNIVERSITY on 12/28/14. For personal use only.
Bufalin Induces Cell Death in Human Lung Cancer Cells through Disruption of DNA Damage Response Pathways Shin-Hwar Wu,*,§ Tzu-Yun Wu,† Yung-Ting Hsiao,† Ju-Hwa Lin,† Shu-Chun Hsu,† , Te-Chun Hsia,‡,¶ Su-Tso Yang,|| Wu-Huei Hsu¶ and Jing-Gung Chung† ** *Institute of Clinical Medical Science † Department of Biological Science and Technology ‡ Graduate Institute of Chinese Medical Science China Medical University Taichung, Taiwan, ROC §Division
of Critical Care Medicine, Department of Medicine Changhua Christian Hospital, Taiwan ¶
Department of Internal Medicine ||Department of Radiology China Medical University Hospital Taichung, Taiwan, ROC **Department
of Biotechnology, Asia University Taichung, Taiwan
Abstract: Bufalin is a key component of a Chinese medicine (Chan Su) and has been proved effective in killing various cancer cells. Its role in inducing DNA damage and the inhibition of the DNA damage response (DDR) has been reported, but none have studied such action in lung cancer in detail. In this study, we demonstrated bufalin-induced DNA damage and condensation in NCI-H460 cells through a comet assay and DAPI staining, respectively. Western blotting indicated that bufalin suppressed the protein levels associated with DNA damage and repair, such as a DNA dependent serine/threonine protein kinase (DNA-PK), DNA repair proteins breast cancer 1, early onset (BRCA1), 14-3-3 (an important checkpoint keeper of DDR), mediator of DNA damage checkpoint 1 (MDC1), O6-methylguanineDNA methyltransferase (MGMT) and p53 (tumor suppressor protein). Bufalin could activate phosphorylated p53 in NCI-H460 cells. DNA damage in NCI-H460 cells after treatment with
Correspondence to: Dr. Jing-Gung Chung, Department of Biological Science and Technology, China Medical University, No. 91, Hsueh-Shih Road, Taichung 404, Taiwan. Tel: (þ886) 42-205-3366 (ext. 2161), Fax: (þ886) 42-205-3764, E-mail: [email protected] or Dr. Wu-Huei Hsu, Department of Internal Medicine, China Medical University, Taichung, Taiwan. Tel: (þ886) 42-205-3366 (ext. 3483), Fax: (þ886) 42-203-8883, E-mail: [email protected]
729
730
S.-H. WU et al. bufalin up-regulated its ATM and ATR genes, which encode proteins functioning as sensors in DDR, and also up-regulated the gene expression (mRNA) of BRCA1 and DNA-PK. But bufalin suppressed the gene expression (mRNA) of p53 and 14-3-3 , however, bufalin did not significantly affect the mRNA of MGMT. In conclusion, bufalin induced DNA damage in NCI-H460 cells and also inhibited its DNA repair and checkpoint function. Keywords: Bufalin; Human Lung Cancer NCI-H460 Cells; DNA Damage.
Am. J. Chin. Med. 2014.42:729-742. Downloaded from www.worldscientific.com by VANDERBILT UNIVERSITY on 12/28/14. For personal use only.
Introduction Bufalin is a key component of a traditional Chinese medicine (Chan Su), which is derived from serous fluid of the posterior auricular glands of the toad. Its antitumor effects have been reported in several Chinese antiques. Modern researches have also confirmed bufalin can kill various cancer cells like lung cancer (Zhu et al., 2012), leukemia (Chen et al., 2009), hepatocellular carcinoma (Han et al., 2007) etc. by inducing their apoptosis. DNA damage is an almost inevitable consequence of apoptosis. However, mammalian cells have innate DNA damage response (DDR) pathways that can counteract the damage. The DDR pathway involves the detection of DNA damage and transduction of damage signals to appropriate effectors, which execute functions like DNA repair, cell cycle checkpoints and apoptosis (Liang et al., 2009). Because DDR potentially offsets the cytotoxic effects of anti-neoplastic treatment, DDR must be repressed before a significant killing can be observed. The first evidence came from the inhibition of DNA repair enzyme poly (ADP-ribose) polymerase results in the death of BRCA1 or 2 mutated cells (Bryant et al., 2005; Farmer et al., 2005). This antitumor effect of DDR inhibition was later further confirmed by human clinical trials (Audeh et al., 2010; Tutt et al., 2010). Many researchers now advocate developing new drugs inhibiting DDR and several potential candidates are currently under investigation (Basu et al., 2012). Bufalin has been found to have influence on DDR by modulating topoisomerase II (Pastor and Cortes, 2003). Bufalin also inhibits DNA repair enzyme poly (ADP-ribose) polymerase 1 in multiple myeloma cell and enhances its cytotoxic effect (Huang et al., 2013). However, bufalin’s role in inducing DNA damage and suppressing DDR has never been studied in detail. In this study, we examined the DNA damaging effect of bufalin on human lung cancer NCI-H460 cells. The role of bufalin in manipulating the main functions of DDR, namely DNA repair and checkpoint and apoptosis, has also been studied in detail with an aim to elucidate possible signal transduction pathways underlying these actions.
Materials and Methods Chemicals and Reagents Bufalin, dimethyl sulfoxide (DMSO), ethidium bromide, propidium iodide (PI), Tris-HCl and Triton X-100 were purchased from Sigma-Aldrich. RPMI-1640 medium, fetal bovine
BUFALIN INDUCES DNA DAMAGE IN HUMAN LUNG CANCER H460 CELLS
731
serum (FBS), L-glutamine, penicillin–streptomycin and trypsin-EDTA were purchased from Gibco ® /Invitrogen (Grand Island, NY, USA).
Am. J. Chin. Med. 2014.42:729-742. Downloaded from www.worldscientific.com by VANDERBILT UNIVERSITY on 12/28/14. For personal use only.
Cell Culture and Chemical Treatment Human lung carcinoma NCI-H460 cells were obtained from the Food Industry Research and Development Institute (Hsinchu, Taiwan). They were maintained in a RPMI-1640 minimum essential medium plus 10% fetal bovine serum, 1% L-glutamine, 100 units/ml of penicillin G and 100 g/ml of streptomycin. The cells were kept in a 37 C incubator under 5% CO2 and 95% air. Stocked cells were plated to a culture flask or a six-well plate at a density of 2–5 105 cells per ml prior to subsequent experiment (Ji et al., 2012; Leung et al., 2013). PI Exclusion Method and Flow Cytometric Assay Approximately 2 10 5 cells/well of NCI-H640 cells in 12-well plates were incubated with bufalin at final concentrations of 0 (vehicle, 0.5% DMSO), 1, 2 and 4 M for 24 hours. Cells from each treatment were stained with PI (5 g/ml) and analyzed by flow cytometry (Becton-Dickinson, San Jose, CA, USA) and cell viability was calculated as described previously (Wu et al., 2013). Comet Assay for DNA Damage Cells (2 10 5 cells/well) in 12-well plates were incubated with 1, 2 and 4 M of bufalin for 24 hours. Later the cells were harvested for studying DNA damage as described previously. Comets of cells on slides acquired DNA damage by the CometScoreTM Freeware analysis (TriTek Corporation, Sumerduck, VA, USA) (Chueh et al., 2013). Comet tail lengths were calculated, quantified, and expressed as mean SD. DAPI Staining NCI-H460 Cells (2 10 5 cells/well) were seeded in a 12-well plate. Bufalin was added to the cells with a final concentration of 2 M and incubated for 6, 12 and 24 hours. The cells were later harvested, washed with phosphate buffer saline (PBS), and fixed with 4% paraformaldehyde. The fixed cells were then washed with PBS again and stained with 4, 6diamidino-2-phenylindole (DAPI, 1 g/mL; Invitrogen) for 30 min in the dark. Cells were then examined under a fluorescent microscope, photographed and apoptotic cells identified as described previously (Yu et al., 2012). Effects of Bufalin on DNA-Damage-Response Proteins of NCI-H460 Cells by Western Blotting Total proteins were collected from the NCI-H460 cells (1 10 6 cells/well) after treatment with 2 M of bufalin for 0, 6, 12 and 24 hours. The amounts of proteins were
732
S.-H. WU et al.
measured by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting as described previously (Chou et al., 2013; Chang et al., 2013; Liu et al., 2013).
Am. J. Chin. Med. 2014.42:729-742. Downloaded from www.worldscientific.com by VANDERBILT UNIVERSITY on 12/28/14. For personal use only.
Real-Time PCR Assay for Examining the Expression of DNA Repair Genes Approximately 1 10 6 cells/well of NCI-H460 cells in 6-well plates were incubated with or without 0, 50, 100, and 200 nM of bufalin for a 24-hour treatment in RPMI-1640 medium grown at 37 C in 5% CO2 and 95% air. Total RNA from each treatment was extracted using the Qiagen RNeasy Mini Kit (Qiagen, Inc., Valencia, CA, USA). Briefly, RNA samples were reverse-transcribed for 30 min at 42 C with High Capacity cDNA Reverse Transcription Kit according to the standard protocol of the supplier (Applied Biosystems, Carlsbad, CA, USA). For quantitative PCR from each sample that was performed in the conditions: 2 min at 50 C, 10 min at 95 C, and 40 cycles of 15 sec at 95 C, 1 min at 60 C using 1 l of the cDNA reverse-transcribed as described above, 2X SYBRGreen PCR Master Mix (Applied Biosystems) and 200 nM of forward and reverse primers as shown in Table 1. Finally, each assay was run on an Applied Biosystems 7300 real-time PCR system in triplicate and the expression fold-change was derived from the comparative CT method (Chen et al., 2010). Table 1. Primers used in the real-time PCR. Primer Name homo ATM-F homo ATM-R homo ATR-F homo ATR-R homo-14-3-3 –F homo-14-3-3 –R homo DNA-PK-F homo DNA-PK-R homo BRCA1-F homo BRCA1-R homo MGMT-F homo MGMT-R homo p53-F homo p53-R homo GAPDH-F homo GAPDH-R
Primer Sequence CAGGGTAGTTTAGTTGAGGTTGACAG CTATACTGGTGGTCAGTGCCAAAGT ATGGCTGTGTGGCGGCCTG TCAGAGTCCCTCAGAC GTGTGTCCCCAGAGCCATGG ACCTTCTCCCGGTACTCACG CCAGCTCTCACGCTCTGATATG CAAACGCATGCCCAAAGTC CCAGGGAGTTGGTCTGAGTGA ACTTCCGTAAGGCATCGTAACAC CCTGGCTGAATGCCTATTTCC TGTCTGGTGAACGACTCTTGCT GGGTTAGTTTACAATCAGCCACATT GGGCCTTGAAGTTAGAGAAAATTCA ACACCCACTCCTCCACCTTT TAGCCAAATTCGTTGTCATACC
Each assay was conducted at least trice to ensure reproducibility. ATM, ataxia telangiectasia mutated; ATR, ATM-Rad3-related; DNAPK, DNA-dependent serine/threonine protein kinase; BRCA1, Breast cancer 1, early onset; MGMT, O6-methylguanine-DNA methyltransferase; GAPDH, glyceraldehydes-3-phosphate dehydrogenase.
BUFALIN INDUCES DNA DAMAGE IN HUMAN LUNG CANCER H460 CELLS
733
Statistical Analysis All data were expressed as mean SD. We used the Student’s t-test to compare the data of different groups. A p value of
