Accepted Manuscript Bone marrow stromal cells on a 3D bioactive fiber mesh undergo osteogenic differentiation in the absence of osteogenic media supplements: the effect of silanol groups Márcia T. Rodrigues, Isabel B. Leonor, Nathalie Gröen, Carlos A. Viegas, Isabel R. Dias, Sofia G. Caridade, João F. Mano, Manuela E. Gomes, Rui L. Reis PII: DOI: Reference:

S1742-7061(14)00238-4 http://dx.doi.org/10.1016/j.actbio.2014.05.026 ACTBIO 3248

To appear in:

Acta Biomaterialia

Received Date: Revised Date: Accepted Date:

12 December 2013 8 May 2014 23 May 2014

Please cite this article as: Rodrigues, M.T., Leonor, I.B., Gröen, N., Viegas, C.A., Dias, I.R., Caridade, S.G., Mano, J.F., Gomes, M.E., Reis, R.L., Bone marrow stromal cells on a 3D bioactive fiber mesh undergo osteogenic differentiation in the absence of osteogenic media supplements: the effect of silanol groups, Acta Biomaterialia (2014), doi: http://dx.doi.org/10.1016/j.actbio.2014.05.026

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1

Bone marrow stromal cells on a 3D bioactive fiber mesh undergo osteogenic differentiation in the absence of osteogenic media supplements: the effect of silanol groups

Márcia T. Rodrigues1, 2, Isabel B. Leonor1, Isabel R. Dias1,

2(*)

, Nathalie Gröen1,

2, 3

, Carlos A. Viegas1,

2, 4

,

2, 4

, Sofia G. Caridade1, 2, João F. Mano1, 2, Manuela E. Gomes1, 2, Rui L.

Reis1,2

1

3B’s Research Group – Biomaterials, Biodegradables and Biomimetcis, University of Minho,

Headquarters of the European Institute of Excellence on Tissue Engineering and Regenerative Medicine, AvePark, 4806-909 Taipas, Guimarães, Portugal 2

3

ICVS/3B’s - PT Government Associate Laboratory, Braga/Guimarães, Portugal Biomedical Engineering, University of Twente, P.O.box 217, 7500 AE Enschede, The

Netherlands 4

Department of Veterinary Sciences, University of Trás-os-Montes e Alto Douro, Vila Real,

Portugal

(*) Corresponding Author Isabel B. Leonor 3B´s Research Group - Biomaterials, Biodegradables and Biomimetics, University of Minho, Headquarters of the European Institute of Excellence on Tissue Engineering and Regenerative Medicine, AvePark, 4806-909 Taipas, Guimarães, Portugal Tel: +351 253510907 Fax: +351 253510909 E-mail: [email protected]

2

Abstract Osteogenic differentiation is a tightly regulated process dependent on the stimuli provided from the micro-environment. Silicon-substituted materials are known to have an influence on the osteogenic phenotype of undifferentiated and bone-derived cells. In this sense, this study aims to investigate the bioactivity profile as well as the mechanical properties of a blend of starch and poly-caprolactone (SPCL) polymeric fiber mesh scaffolds functionalized with silanol (Si–OH) groups as key features for bone tissue engineering (TE) strategies. The scaffolds were made from SPCL by wet spinning technique. A calcium silicate solution was used as a non-solvent to develop an in situ functionalization with Si–OH groups in a single step approach. Afterwards, we explored the relevance of silicon incorporated in SPCL-Si scaffolds in the in vitro osteogenic process of goat bone marrow stromal cells (gBMSCs) with and without osteogenic supplements in the culture medium. We hypothesized that SPCL-Si scaffolds could act as physical and chemical millieu to induce per se the osteogenic differentiation of gBMSCs. Results show that osteogenic differentiation of gBMSCs, and the production of a mineralized extracellular matrix on bioactive SPCL-Si scaffolds occur for up to 2 weeks, even in the absence of osteogenic supplements in the culture medium. The omission of media supplements to induce osteogenic differentiation is a promising feature towards simplified and cost-effective cell culturing procedures of a potential bioengineered product, and concomitant translation into the clinical field. Thus, the present work demonstrates that SPCL-Si scaffolds and their intrinsic properties sustain gBMSCs osteogenic features in vitro even in the absence of osteogenic supplements to the culture medium showing great potential for bone regeneration strategies.

Keywords: Apatite; Silanol groups; Wet-spinning; Goat bone marrow mesenchymal cells; Osteogenic differentiation;

Tissue

engineering.

3

1. Introduction Bone formation is a complex process involving sequential orchestrated steps headed to the development of a functional and structurally organized tissue that sustains the full mass of an individual, protect various organs of the body, produce cells and store minerals. Despite its extraordinary healing ability, bone response may be unsuccessful to repair severe damage caused by injuries or aging related problems. Moreover, the injury of the bone tissue also affects nearby tissues and interfaces translating into a decline in the quality of life of thousands of patients worldwide, and represents a medical and socio-economical challenge. Currently, the therapeutic strategies used for bone replacement/regeneration are based on bone grafting (autografts, allografts, demineralized bone matrix and bone substitutes) with all complications and drawbacks associated to them [1, 2]. Due to their chemical similarity to the inorganic phase of bone, the calcium phosphate (CaP) biomaterials are one of sources of bone graft substitutes [3, 4]. One important bone grafting material is Bioglass, which Hench et al. [5] have demonstrated that this glass provides an ideal environment for colonisation, proliferation and differentiation of osteoblasts to form new bone [6, 7]. This response is due to the influence of silicon (Si) in the gene upregulation of osteoblastic cells [6-8]. Also, some clinical studies have evidenced the potential biological role of Si in bone formation [9]. Previously in our group [10, 11] it was demonstrated that a bioactive 3D fiber mesh, made of a blend of starch-polycaprolactone (SPCL), silanol (Si– OH) groups on their surface, with a controlled pore size, shape and orientation was feasible to be produced, in a reliable and economical way, by using one-step wet-spinning technique. This simple process has the advantage that no further coating or chemical modification of the fiber mesh is required to render bioactive behaviour as in classic ceramic materials, such as an organized arrangement of functional groups, Si– OH groups. In this work we hypothesize that this bioactive 3D fiber meshes (SPCL-Si scaffold) could act as physical and chemical milieu to induce per se the process of osteogenic differentiation in goat bone marrow stromal cells (gBMSCs) with and without osteogenic supplements in the

4

culture medium. Culturing cells onto scaffolds should bridge the gap between structural support and in locus cellular and molecular communication towards functional bone tissue regeneration. Over the past few years, bone marrow mesenchymal stromal cells (BMSCs) arose as a potential cell source for tissue engineering (TE) applications, including bone tissue repair and regeneration [10, 12, 13]. BMSCs can be easily guided into multiple cell lineages, such as osteogenic, chondrogenic or adipogenic under specific culture conditions. Physiological mediators, alone or in combination, were also described to participate in bone formation, remodeling, and repair [14]. Among them, ascorbic acid, ß-glycerolphosphate and dexamethasone have been widely used as supplements in standard osteogenic culture media [15]. Ascorbic acid is an essential nutrient for collagen synthesis described to stimulate extracellular matrix (ECM) secretion and mesenchymal stem cells (MSCs) proliferation [16]. Furthermore, ascorbic acid in the presence of a source of phosphate ions [17], such as β-glycerolphosphate results in the formation of an area with hydroxyapatitecontaining mineral within collagen fibrils [18]. Although dexamethasone has been demonstrated to induce osteogenic differentiation of fetal calvaria-derived cells [19] and adult BMSCs [17], this synthetic glucocorticoid presents considerable side effects [20]. Several strategies have shown that MSCs are able to develop the osteogenic phenotype in the absence of osteogenic medium supplements [21]. In this context, we proposed a three-stage study to validate our hypothesis. In the first phase we intend to evaluate the formation of a CaP layer on the surface of the SPCL-Si scaffolds by soaking them in a simulated body fluid solution and their mechanical properties as key features for bone TE. Then, the behavior of gBMSCs will be investigated in SPCL-Si scaffolds with and without a CaP layer. The aim of this stage is to understand the relevance of SPCL-Si scaffolds for cellular strategies in the presence or absence of a CaP layer. Finally and as the ultimate goal of this study, we propose to explore the relevance of the presence of Si on SPCL-Si scaffolds in the process of osteogenic differentiation in the presence and absence of osteogenic supplements in the culture medium. Thus, gBMSCs were cultured in different media conditions: basal medium, complete osteogenic medium, and medium in the

5

absence of one of the osteogenic factors: ascorbic acid, β-glycerolphosphate or dexamethasone, for up to 2 weeks.

2. Materials and Methods 2.1. Wet-spun fiber mesh scaffold processing A biodegradable thermoplastic blend of corn starch with polycaprolactone (30/70 wt.%, SPCL) was obtained from Novamont, Italy. Chloroform (CHCl 3), methanol (CH3OH), tetraethoxysilane (TEOS: Si(OC2H5)4) and calcium chloride (CaCl 2) were obtained from Sigma-Aldrich. Ethyl alcohol (C2H5OH) was obtained from Panreac. This polymer has been selected to produce SPCL scaffolds with and without silanol (Si-OH) groups by a wet-spinning technique as previously described by our group [10, 11, 22]. Briefly, the polymer was dissolved in chloroform at a concentration of 30 % (w/v) and then, the polymeric solution was loaded into a 5 mL plastic syringe with a needle (0.8 mm internal diameter) attached to it. The syringe was connected to a programmable syringe pump (KR analytical, precision syringe pump, Fusion 200; Chemics Inc., USA) to inject the polymeric solution at a controlled pump rate of 4.5 mL.h-1. The fiber mesh structure was formed during the process by the random movement of the coagulation bath. Control fiber mesh scaffolds (designated as SPCL scaffolds) obtained in a methanol coagulation bath were dried at room temperature overnight in order to remove any remaining solvent. In the case of using the calcium silicate solution (Si(OC2H5)4/H2O/C2H5OH/HCl/CaCl2 of 1.0/4.0/4.0/0.014/0.20) [10, 23] the fiber meshes were dried in an oven at 60 °C for 24 h, and designated as SPCL–Si. Afterwards, scaffolds were cut into Ø 5 mm discs with a thickness ≈ 0.45 ± 0.04 mm. Prior to any cell culture experiments, the scaffolds were sterilized by ethylene oxide, with a cycle time of 14 h at a working temperature of 45 °C in a chamber under a pressure of 50 kPa.

2.2. Evaluation of in vitro bioactivity of wet-spun fiber mesh scaffolds

6

The SPCL and SPCL-Si scaffolds were soaked in 10 mL of simulated body fluid (SBF) solution at 36.5 ºC for up to 7 days to evaluate the formation of an CaP layer on their surface. The SBF presents ion concentrations (Na+ 142.0, K+ 5.0, Ca2+ 2.5, Mg2+ 1.5, Cl− 147.8, HCO3− 4.2, HPO42− 1.0, and SO42− 0.5 mM) nearly equal to those of the human blood plasma [24, 25]. After each period of immersion time, the samples were removed from SBF, washed with distilled water and dried at room temperature. SPCL scaffolds were used as experimental controls. A minimum of four samples was used per time point.

2.2.1. Morphological and mechanical characterization of wet-spun fiber mesh scaffolds and SBF analysis Scanning electron microscopy (SEM: Hitachi S-2600N, Hitachi Science Systems, Ltd) was used to observe the morphology of the wet-spun fiber mesh scaffolds before and after soaking in SBF for the different experimental conditions and controls. Previously to SEM analysis, sample surfaces were gold sputtered (Fisons Instruments, Sputter Coater SC502, UK). Thin film X-ray diffraction (TF-XRD: RINT2500, Rigaku Co., Japan) was used to identify crystalline phases present on the polymeric wet-spun fiber mesh (SPCL-Si and SPCL controls) before and after immersion in SBF, and to characterize the crystalline/amorphous nature of the CaP films. The data collection was performed by the 2θ scan method, with 1° as the incident beam angle using a Cu Kα X-ray line and a scan speed of 0.05° min-1 in 2θ. To assess the morphometric parameters of the scaffolds it was used a high-resolution MicroCT system (Skyscan 1072, Skyscan, Kontich, Belgium). X-ray scans of both scaffolds were performed in triplicate, using a resolution of pixel size of 5.86 µm at 40 keV energy and 248 µA current, as previously described [10]. Data sets were reconstructed using NRecon v1.4.3, SkyScan software. Representative datasets of 200 slices were segmented into binary images with a dynamic threshold of 50–255 (grey values) to identify the organic and inorganic phase. These data sets were used for morphometric analysis (CT Analyser

7

v1.5.1.5, SkyScan) and to build the 3D virtual models (ANT 3D creator v2.4, SkyScan). The 3D virtual models of representative regions in the bulk of the scaffolds were created, visualized and registered using both images processing software (CT Analyser and ANT 3-D creator). Elemental concentrations of the SBF before and after soaking of the scaffolds were measured using induced-coupled plasma emission spectroscopy (ICP: JY2000-2, Jobin Yvon, Horiba, Japan). Solutions were collected at the end of each time point, filtered with a 0.22 µm filter and kept at -80 ºC until usage. A minimum of three samples was used per condition and time point analyzed. For the viscoelastic measurements of the scaffolds it was used a dynamic mechanical analysis (DMA: TRITEC8000B DMA from Triton Technology, UK), equipped with the tensile mode. The distance between the clamps was 5 mm and the membrane samples were cut with about 5 mm width (measured accurately for each sample). The membranes were always analyzed immersed in a liquid bath placed in a Teflon® reservoir. Samples were previously immersed in a PBS solution until equilibrium was reached (overnight). The geometry of the samples was then measured and the samples were clamped in the DMA apparatus and immersed in the PBS solution. After equilibration at 37 ºC, the DMA spectra were obtained during a frequency scan between 0.1 and 25 Hz. The experiments were performed under constant strain amplitude (30 µm). A static pre-load of 0.7 N was applied during the tests to keep the sample tight. Five samples were used for each condition.

2.3. In vitro assessment of the wet-spun fiber mesh scaffolds 2.3.1. gBMSCs harvesting and isolation Goat bone marrow stromal cells (gBMSCs) were isolated and expanded as previously described [10]. BMSCs harvesting procedure was conducted in agreement to the international standards on animal welfare as defined by the National Ethical Committee for Laboratory Animals and conducted in accordance with Portuguese legislation (Portaria nº1005/92) and international

8

standards on animal welfare as defined by the European Communities Council Directive (86/609/EEC). During the entire procedure adequate measures were taken to minimize any pain or discomfort to the animals. Briefly, gBMSCs were harvested from the iliac crests of adult goats and cultured in DMEM (Dulbecco Modified Eagle Medium, Sigma) supplemented with 10 % fetal bovine serum (Gibco) and 1 % antibiotic/antimicotic solution (Gibco). Cells were expanded and cryopreserved. Then, cells were thawed, expanded and sub-cultured twice (passage 2) until achieving a sufficient cell number to run our experiment.

2.3.2. Assessment of gBMSCs behavior on wet-spun fiber mesh scaffolds coated with and without a calcium phosphate coating In this study it is envisaged to understand the relevance of SPCL-Si scaffolds for cellular strategies in the presence or absence of a CaP coating. For that the gBMSCs were seeded onto SPCL-Si scaffolds after 7 day of immersion in SBF (SPCL-Si-7SBF) at a concentration of 1x105 cell/scaffold and compared with uncoated SPCL-Si scaffolds (without immersion in a SBF solution). After seeding gBMSCs onto the SPCL-Si scaffolds, coated and uncoated, the constructs were cultured in alpha-MEM (Sigma) in the presence of osteogenic supplements, namely ascorbic acid (50 µg.ml -1, Sigma), β-glycerolphosphate (10 mM, Sigma) and dexamethasone (10-8 M, Sigma) for 7 and 14 days.

2.3.3. Assessment of gBMSCs behavior on wet-spun fiber mesh scaffolds in different culture media A major goal of this study was to evaluate the influence of SPCL-Si scaffolds in stimulating the osteogenic process of gBMSCs in the presence or absence of biochemical factors supplemented to the osteogenic medium. For this purpose, gBMSCs were seeded onto SPCL-Si scaffolds at a density of 1x105 cells per scaffold (3P) and kept in basal medium (DMEM, Dulbecco Modified Eagle Medium, Sigma) supplemented with 10 % FBS and 1 % A/A solution for 2 days. Subsequently the gBMSC-SPCL-Si constructs were divided into 5

9

culture conditions for 7 or 14 days, namely i) basal medium, ii) complete osteogenic medium, iii) osteogenic medium without ascorbic acid, iv) osteogenic medium without ßglycerolphosphate, and v) osteogenic medium without dexamethasone, as represented in Table 1. Goat BMSCs seeded onto SPCL scaffolds cultured in the same experimental conditions were used as controls. Samples were prepared in triplicates.

2.3.4. Characterization of cell–scaffold constructs Cell-scaffold constructs with and without CaP coating were assessed for cell morphology, viability, proliferation and osteogenic differentiation through the quantification of alkaline phosphatase (ALP) activity. The histological analysis, immunolocation of collagen I, mineralized ECM formation, and quantitative PCR analysis were only performed for studying the influence of SPCL-Si scaffolds in the osteogenic behavior of gBMSCs in different culture media. Two samples were used per condition and time point, and the experiments were repeated three times. Cell viability assay: The MTS test (Promega) was used to assess cell viability in SPCL-Si scaffolds seeded with gBMSCs after 7 and 14 days of culture. After each culturing time, cells were rinsed in PBS and then incubated in a MTS solution for 3 hours at 37 ºC in a 5 % CO2 environment, according to manufacturer’s instructions. Absorbance was read at 490 nm in a microplate ELISA reader equipment (BioTek). DNA content: gBMSCs content seeded onto SPCL-Si constructs was analyzed by double strand DNA (dsDNA) quantification assay using a fluorimetric dsDNA quantification kit (PicoGreen, Molecular Probes), according to manufacturer’s instructions. The fluorescence of dsDNA assay was read in a microplate ELISA reader (BioTek) at an excitation of 485/20 nm and emission of 528/20 nm. Alkaline phosphatase (ALP) activity: A substrate solution was added to each sample consisting of 0.2 % (wt/v) p-nytrophenyl phosphate (Sigma) in a substrate buffer with 1 M diethanolamine HCl (Merck) at pH 9.8. Samples were then incubated in the dark for 45

10

minutes at 37 ºC. After the incubation period, a stop solution (2 M NaOH (Panreac) plus 0.2 mM EDTA (Sigma)) was added to samples. Absorbance was read at 405 nm in a microplate ELISA reader equipment (BioTek). Standard solutions were prepared with p-nytrophenol (10 µmol.ml -1) (Sigma). Cell morphology: The morphology of SPCL and SPCL-Si scaffolds cultured with gBMSCs was analyzed by SEM. Cell-laden constructs were rinsed in PBS, fixed in 4 % buffered formalin overnight, and then dehydrated in a series of ethanol concentrations (up to 100 % ethanol). Afterwards, the samples were left to dry overnight. Micro-CT analysis: The characterization of cell–scaffold constructs and the synthesis of a mineralized matrix was assessed. The X-ray scans of the samples were performed in triplicate and acquired similarly to cell-free scaffolds, described in the section 2.2.1, but with a resolution of pixel size of 6.69 µm. Representative datasets of 100 slices were segmented into binary images with a dynamic threshold of 30–255 (grey values) to identify an organic and inorganic phase on the constructs. These data was used to build the 3D virtual models. Histological analysis: After 7 and 14 days of culture in the different culture media, gBMSCs seeded scaffolds were fixed in a 10 % neutral buffered formalin solution (Bio-Optica) overnight at 4 ºC and rinsed in PBS. Then, constructs were kept at 4 ºC in PBS until performing the histological immunolocation of collagen I. Immunofluorescent staining: The expression of collagen I naturally present in bone related ECM matrices was assessed by immunofluorescence. Cellular permeabilization was performed using a 0.025 % Triton/100 (Sigma-Aldrich) in PBS followed by normal serum 2.5 % (S-2012, Vector Labs) incubation. Rabbit polyclonal antibody anti-collagen type I was purchased from Abcam (ab292, 1:500). Anti-rabbit AlexaFluor 488 (Molecular Probes, Invitrogen; 1:200) was selected as secondary antibody. Antibodies were diluted in an antibody diluent with background reducing components from Dako. DAPI staining (Molecular Probes, Invitrogen) served as a nuclear marker for cell localization and distribution. The presence/absence of collagen I in the constructs was observed under a fluorescence microscope (Imager Z1M, Zeiss, Germany) equipped with a digital camera (AxioCa MRc5).

11

Gene expression analysis using real-time PCR: The mRNA expression of the genes of interest, namely OsteoPontin (OP) and OsteoNectin (ON) was measured in gBMSC-SPCL-Si constructs exposed to different culture conditions for 7 or 14 days by reverse-transcription polymerase chain reaction (RT-PCR). Total RNA was extracted using TRI reagent (T9424, Sigma) following manufacturer instructions. First-strand complementary DNA (cDNA) was synthesized from 1 µg RNA using the cSCript cDNA synthesis kit (733-1175, VWR) in a 20 µl reaction. The primer sequences with specificity for goat were obtained from Primer 3 software

(v

0.4.0)

for

glyceraldehyde

5’_GGGTCATCATCTCTGCACCT_3’ osteopontin

(OP,

F-

5’_GATGGCCGAGGTGATAG_3’)

3-phosphate

and

R-

dehydrogenase

F-

5’_GGTCATAAGTCCCTCCACGA_3’),

5´_TGGAAAGCTCGTCACTGT_3’ and

(GAPDH,

osteonectin

and

(ON,

F

R–

5’_CGAGGAAGAGGTGGTAG_3’ and R- 5’ TGCTGCACACCTTCTCA 3’) prior its synthesis by MWG Biotech Germany. Gene expression analysis was performed using a nanodrop 1000

spectophotometer

(ThermoScientific)

and

a

RT-PCR mastercycler

(Realplex,

Eppendorf).

2.7. Statistical analysis Statistical analysis was carried out by average ± standard deviation. Two-way ANOVA followed by Bonferroni’s Multiple Comparison test was also applied to check the existence of statistical differences in the results between sample groups. The data analyses were performed with GraphPath Prism software (version 5) and differences were considered significant at p < 0.05.

3. Results 3.1.

Production and characterization of wet-spun fiber mesh scaffolds

The bioactivity of artificial materials is commonly evaluated by examining the formation of apatite on the surface of the scaffold after immersion in a simulated body fluid (SBF) solution. The SBF is a protein-free solution with an ionic composition (Na+ 142.0, K+ 5.0, Ca2+ 2.5,

12 Mg2+ 1.5, Cl- 147.8, HCO3- 4.2, HPO42- 1.0, SO42- 0.5 mM; pH 7.40) proposed by Kokubo et al. [24] to understand the mechanism of apatite formation on bioactive materials. Figure 1A exhibits the TF-XRD patterns obtained for the SPCL-Si fiber mesh scaffolds and SPCL controls (SPCL) produced by wet-spinning after soaking in SBF for 7 days. The TFXRD patterns of the surface of the SPCL-Si scaffold exhibit several broad diffraction peaks, whose position and intensities can be assigned to an apatite-like phase (ASTM JCPDS 90432). The peaks in 2Θ and their correspondence to the diffraction planes of apatite are: 10.82 º (1 0 0), 25.87 º (0 0 2), and 31.7 5º (2 2 1). The formed apatite film presents low crystallinity, as the apatite peaks were comparatively broader than the crystalline apatite. An apatite layer is formed in SPCL-Si scaffolds after 1 day of immersion in a SBF solution, while SPCL scaffolds could not induce the formation of an apatite layer even after 7 days in SBF (Figure 1B). Micro-CT analysis allowed following up the formation and growth of an apatite layer (blue color) as function of time (Figure 1B). The scaffold porosity was found to be about 56.84 % and 49.77 %, before and after soaking the scaffolds in SBF, respectively. As the immersion time in SBF increases, the apatite layer becomes denser and compact but still homogeneously

distributed

without

compromising

the

overall

morphology

and

interconnectivity of the 3D-fiber mesh scaffolds. The concentrations of calcium (Ca), phosphorus (P) and silicon (Si) in the SBF solution, before and after immersion of SPCL-Si and SPCL scaffolds were measured by ICP analysis as function of time (Figure 1C). A decrease in the Ca concentration was observed after 24 hours for SPCL-Si scaffolds, but for P concentration was abruptly decreased, and then, there was no further practical decrease. The release of Si ion from SPCL-Si scaffolds into the SBF quickly occurred at the beginning of soaking and then slowed down up to 7 days. The decrease in Ca and P concentrations is more evident in SPCL-Si scaffolds (p0.05) along consecutive soaking periods, and no traces of Si element were detected in SPCL control scaffolds.

13

The dynamic mechanical behavior of SPCL-Si scaffolds with the variation of the frequency was assessed under simulated physiological condition, that is, in a hydrated environment at 37 ºC (Figure 1D) [26]. Overall, the storage modulus (E’) of the scaffolds tends to increase with increasing frequency. In the SPCL-Si scaffolds E’ increases from 11.38 MPa to 14.81 MPa (p