Biochem. J. (2016) 473, 21–30
21
doi:10.1042/BJ20150607
Bisecting GlcNAc modification stabilizes BACE1 protein under oxidative stress conditions Yasuhiko Kizuka*, Miyako Nakano†, Shinobu Kitazume*1 , Takashi Saito‡, Takaomi C. Saido‡ and Naoyuki Taniguchi*1 *Disease Glycomics Team, Systems Glycobiology Research Group, RIKEN–Max Planck Joint Research Centre for Systems Chemical Biology, Global Research Cluster, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan †Graduate School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, Higashihiroshima, Hiroshima 739-8530, Japan ‡Laboratory for Proteolytic Neuroscience, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan
β-Site amyloid precursor protein-cleaving enzyme-1 (BACE1) is a protease essential for amyloid-β (Aβ) production in Alzheimer’s disease (AD). BACE1 protein is known to be up-regulated by oxidative stress-inducing stimuli but the mechanism for this upregulation still needs to be clarified. We have recently found that BACE1 is modified with bisecting N-acetylglucosamine (GlcNAc) by N-acetylglucosaminyltransferase-III (GnT-III, encoded by the Mgat3 gene) and that GnT-III deficiency reduces Aβ-plaque formation in the brain by accelerating lysosomal degradation of BACE1. Therefore, we hypothesized that bisecting GlcNAc would stabilize BACE1 protein on oxidative stress. In the present study, we first show that Aβ deposition in the mouse brain induces oxidative stress, together with an increase in levels of BACE1 and bisecting GlcNAc. Furthermore, prooxidant treatment induces expression of BACE1 protein in wild-type mouse embryonic fibroblasts (MEFs), whereas it reduces BACE1 protein in GnT-III (Mgat3) knock-out MEFs by accelerating
lysosomal degradation of BACE1. We purified BACE1 from Neuro2A cells and performed LC/ESI/MS analysis for BACE1derived glycopeptides and mapped bisecting GlcNAc-modified sites on BACE1. Point mutations at two N-glycosylation sites (Asn153 and Asn223 ) abolish the bisecting GlcNAc modification on BACE1. These mutations almost cancelled the enhanced BACE1 degradation seen in Mgat3 − / − MEFs, indicating that bisecting GlcNAc on BACE1 indeed regulates its degradation. Finally, we show that traumatic brain injury-induced BACE1 up-regulation is significantly suppressed in the Mgat3 − / − brain. These results highlight the role of bisecting GlcNAc in oxidative stress-induced BACE1 expression and offer a novel glycan-targeted strategy for suppressing Aβ generation.
INTRODUCTION
a glycan structure that is highly expressed in the brain [17,18]. We also found that the amount of bisecting GlcNAc on BACE1 is significantly higher in AD patients [19], and that mutant mice lacking the biosynthetic enzyme Nacetylglucosaminyltransferase-III (GnT-III, encoded by the Mgat3 gene) displayed greatly reduced numbers of Aβ plaques in the brain [16]. As an underlying molecular mechanism, we found that loss of bisecting GlcNAc leads to the relocation of BACE1 from early endosomes to late endosomes/lysosomes. This leads to reduced co-localization of BACE1 with APP, and decreased BACE1 protein levels because of its lysosomal degradation. In addition, our analysis of mutant cells lacking another type of glycosylation, core fucosylation, revealed that the lack of core fucose leads to the up-regulation of GnT-III, together with several oxidative stress-responsive genes [20], suggesting a relationship between bisecting GlcNAc and oxidative stress. From these results, we hypothesize that bisecting GlcNAc stabilizes BACE1 protein in oxidative stress conditions, resulting in an increase in Aβ generation. In the present study, we reveal that bisecting GlcNAc indeed plays a critical role in BACE1 induction in response to oxidative stress. Furthermore, by using mutant BACE1 lacking two key Nglycosylation sites, we found that bisecting GlcNAc on BACE1 is directly required for maintaining BACE1 stability under stress conditions. Finally, we show that injury-induced BACE1
Alzheimer’s disease (AD) is a devastating dementia characterized by progressive neurodegeneration [1,2]. One of the hallmarks of this disease is the presence of senile plaques in the brain that consist of accumulated amyloid-β (Aβ) peptide. Aβ is generated from the proteolytic cleavage of amyloid precursor protein (APP) by β-site APP-cleaving enzyme-1 (BACE1) and γ -secretase [3]. As Aβ deposition is considered to be a critical event in the development of AD [4], molecules involved in Aβ generation and clearance are promising drug targets for the treatment of AD. BACE1 is known to be a stress-responsive molecule [5], and BACE1 activity is up-regulated in AD patients [6]. Up-regulation of BACE1 and increased Aβ generation are observed during ageing and traumatic brain injury [7,8]. Furthermore, exposing cells to Aβ also up-regulates BACE1 [9]. These events are known to evoke cellular oxidative stress [10–12], and this stress has been reported to induce BACE1 expression and activity [9,13,14]. Although the molecular mechanism underlying BACE1 upregulation in response to oxidative stress is not well understood, BACE1 activation seems to be regulated at the protein level [15]. This raises the possibility that post-translational modifications could regulate BACE1 induction. We recently found that N-glycans of BACE1 are selectively modified with bisecting N-acetylglucosamine (GlcNAc) [16],
Key words: Alzheimer’s disease, BACE1, bisecting GlcNAc, glycobiology, GnT-III, oxidative stress.
Abbreviations: 8-OHdG, 8-hydroxydeoxyguanosine; AD, Alzheimer’s disease; APP, amyloid precursor protein; BACE1, β-site amyloid precursor proteincleaving enzyme-1; E4-PHA, erythroagglutinating phytohaemagglutinin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; GlcNAc, N -acetylglucosamine; GnT-III, N -acetylglucosaminyltransferase-III; HRP, horseradish peroxidase; MEF, mouse embryonic fibroblast. 1 To whom correspondence should be addressed (email [email protected] or [email protected]/[email protected]) c 2016 Authors; published by Portland Press Limited
22
Y. Kizuka and others
expression is significantly suppressed in the Mgat3 − / − brain. Our data provide a new link between glycan modification on BACE1 and up-regulation of BACE1 by oxidative stress.
transcribed using Superscript III (Life Technologies). For realtime PCR, cDNA was mixed with TaqMan Universal PCR Master Mix (Life Technologies), and amplified using an ABI PRISM 7900HT. The mRNA levels were normalized to the corresponding rRNA levels.
EXPERIMENTAL Materials
The following antibodies were used: anti-histone H3 (4620) and anti-BACE1 (5606) from Cell Signaling Technology, anti-8hydroxydeoxyguanosine (anti-8-OHdG; N45.1) from the Japan Institute for the Control of Ageing, anti-actin (A4700) from Sigma-Aldrich, anti-glyceraldehyde 3-phosphate dehydrogenase (anti-GAPDH; MAB374) from Millipore, anti-Aβ (clone 6E10) from Signet (9320-02), anti-glial fibrillary acidic protein (antiGFAP) from Life Technologies (13-0300), anti-syntaxin 6 (610635) from BD Biosciences and anti-βIII tubulin (TUJ1) from Covance (MMS-435P). Biotinylated and agarose-conjugated erythroagglutinating phytohaemagglutinin (E4-PHA) lectins were purchased from Seikagaku Corp. Primer-probe sets for mRNA quantification were purchased from Life Technologies: control ribosomal RNA, 4308329; Bace1, Mm00478664_m1.
Plasmids
The construction of pCAGGS/human BACE1 (501 amino acid isoform) has been described previously [23]. The pcDNA6-mycHis A/human BACE1 (soluble BACE1-myc-his) was constructed using PCR to amplify the BACE1 cDNA fragment encoding Met1 to Ser453 . The fragment was inserted into pcDNA6/mycHis A with EcoRV and XhoI sites. The pCAGGS/human BACE1 mutants (Asn153 Ser, Asn172 Ser, Asn223 Ser, Asn354 Ser) were constructed using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies). The pCAGGS/human BACE1N153,223S was constructed by PCR using Asn153 Ser cDNA or Asn223 Ser cDNA as a template. The two amplified fragments were digested with EcoRI and StuI, and the smaller fragment derived from Asn153 Ser cDNA and the larger fragment from Asn223 Ser were then simultaneously inserted into pCAGGS, which had been digested with EcoRI. The primers used are listed in Table 1.
Mutant mice
The generation of the Mgat3-deficient mice has been described previously [21]. Mgat3-deficient mice were generously provided by Dr Jamey D. Marth (University of California–Santa Barbara) [21]. The generation of AD model mice (AppNL − G − F/NL − G − F ) has also been described previously [22]. All mice were from a C57BL/6 genetic background. They were housed (three or fewer mice per cage) at 20∼26 ◦ C and 45∼65 % humidity. The light conditions were 14 h:10 h (lights on at 07:00 hours). The Animal Experiment Committee of RIKEN approved all animal experiments. Lectin pull-down
Membrane fractions from mouse brains were prepared as described previously [16]. Proteins were solubilized with a buffer (TBS containing 0.5 % NP-40), followed by ultracentrifugation at 100 000 g for 15 min. The resultant supernatant (input) was incubated with E4-PHA agarose for 1 h with gentle shaking. After washing twice with TBS containing 0.1 % NP-40, bound proteins were eluted by boiling with SDS sample buffer. Cell culture and transfection
Neuro2A cells and immortalized mouse embryonic fibroblasts (MEFs) [16] were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10 % FBS. For plasmid transfection, cells at 80 % confluency on a 10-cm dish were transfected with 4–8 μg of each plasmid using 10–20 μl of Lipofectamine 2000 (for Neuro2A) or 16–32 μl of polyethyleneimine MAX (for MEF, Polysciences, Inc.). Polyethyleneimine MAX solution was prepared at 2 mg/ml, and the pH was adjusted to 7.2 with NaOH. In some experiments, MEFs were treated with 10 or 20 μM hydrogen peroxide, or 100 μM chloroquine, for 6 h. RNA extraction, reverse transcription and real-time PCR
Total RNA from cultured cells was extracted using TRI Reagent (Molecular Research Center, Inc.), according to the manufacturer’s protocol. Total RNA (1 μg) was reverse c 2016 Authors; published by Portland Press Limited
Western and lectin blots
Proteins were separated by SDS/5–20 % PAGE using the Laemmli buffer system, and then transferred to nitrocellulose membranes. After blocking with 5 % non-fat dry milk in TBS containing 0.05 % Tween-20 (or blocking with TBS containing 0.1 % Tween-20 for lectin blot), the membranes were incubated with primary antibodies or biotinylated lectin, followed by horseradish peroxidase (HRP)-conjugated secondary antibodies or HRP-conjugated streptavidin (VECTASTAIN ABC Standard Kit). Proteins were detected with Western Lightning ECL Pro (PerkinElmer) using an ImageQuant LAS-4000mini (GE Healthcare). Glycan analysis of recombinant BACE1
For purification of soluble BACE1-His, Neuro2A cells were transfected with the plasmid pcDNA6-myc-His A/human BACE1, and stable transfectants were established using blasticidin at 7.5 μg/ml. The culture medium was replaced with Opti-MEM I, followed by a further 2 or 3 days in culture in the presence or absence of 10 μM H2 O2 . The collected medium, to which NaCl (final concentration 0.5 M) and imidazole (final concentration 20 mM) were added, was applied to a Ni2 + /Sepharose column which had been equilibrated with buffer A (20 mM sodium phosphate, pH 7.2, 0.5 M NaCl) containing 20 mM imidazole. After washing with buffer A containing 20 mM imidazole, bound proteins were eluted with buffer A containing 0.5 M imidazole. For glycopeptide analysis, to remove NaCl and imidazole, the sample was diluted with 50 mM Tris/HCl and concentrated several times using Amicon ultracentrifugal filter units (Millipore), and then lyophilized. The lyophilized recombinant BACE1 (100 μg), obtained from 60 ml of culture medium, was reduced with DTT (10 mg) and alkylated with iodoacetamide (20 mg) [24]. After the reaction mixture was passed through a Nap-5 column (GE Healthcare) to remove salts from the reducing solution, as well as excess iodoacetamide, the sample was digested with lysylendopeptidase (2 μg, Wako Pure Chemical Industries Ltd) and trypsin (2 μg, Promega) for 16 h at 37 ◦ C, and then digested with endoprotease Glu-C (5 μg, Wako Pure Chemical Industries
Bisecting GlcNAc regulates stress-induced BACE1 expression
23
Table 1 Primers for plasmid construction Plasmid name
Forward primer
Reverse primer
pcDNA6-myc-His A/human BACE1 pCAGGS/human BACE1 Asn153 Ser pCAGGS/human BACE1 Asn172 Ser pCAGGS/human BACE1 Asn223 Ser pCAGGS/human BACE1 Asn354 Ser pCAGGS/human BACE1 Asn153,223 Ser
ATGGCCCAAGCCCTGCCCTG TAAGCATCCCCCATGGCCCCAGCGTCACTGTGCGTGCCAACAT AATCAGACAAGTTCTTCATCAGCGGCTCCAACTGGGAAGGCATC GTGGTGCTGGCTTCCCCCTCAGCCAGTCTGAAGTGCTGGCCTC ACCTAATGGGTGAGGTTACCAGCCAGTCCTTCCGCATCACCAT GGGGAATTCATGGCCCAAGCCCTGCCCTG
CATCTCGAGTGACTCATCTGTCTGTGGAA Complementary Complementary Complementary Complementary TGGGAATTCTCACTTCAGCAGGGAGATGT
Ltd) for 16 h at 37 ◦ C. The digest was divided into two portions. One portion was used as a ‘sialo sample without enrichment’, to detect the presence of bisecting GlcNAc at all glycosylation sites on BACE1. The other portion was treated with Sepharose CL4B to enrich glycopeptides [24], and then incubated with 2 M acetic acid for 2 h at 80 ◦ C to remove sialic acids. The resulting ‘desialo sample-enriched glycopeptides’ were used to show the presence of bisecting GlcNAc by MS/MS analysis. Both samples were analysed by LC/ESI/MS. The glycopeptide mixtures were separated using a Develosil 300ODS-HG-5 column (150×1.0 mm i.d., Nomura Chemical). The mobile phases were: (A) 0.08 % formic acid and (B) 0.15 % formic acid/80 % acetonitrile. The column was eluted with solvent A for 5 min, at which point the concentration of solvent B was increased to 40 % over 55 min at a flow rate of 50 μl/min using an Accela HPLC system (ThermoFisher Scientific). The eluate was continuously introduced into an ESI source (LTQ Orbitrap XL, ThermoFisher Scientific). MS spectra were obtained in the positive ion mode using Orbitrap MS, and MS/MS spectra were obtained using Iontrap MS. Monoisotopic masses were assigned with possible monosaccharide compositions using the GlycoMod tool available on the ExPASy server (http://web.expasy.org/glycomod/; mass tolerance for precursor ions is + −0.01 Da) and the proposed glycan structures were further verified through annotation using a fragmentation mass-matching approach based on the MS/MS data. For analysis of released N-glycan, the eluate from the Ni2 + column was subjected to SDS/PAGE, and proteins were transferred to a PVDF membrane. The dried membrane was washed with ethanol, and then three times with water. To stain proteins, the membrane was incubated for 5 min with Direct Blue 71 [800 μl of solution A (0.1 %, w/v), Direct Blue 71 (Sigma-Aldrich)] in 10 ml of solution B (acetic acid:ethanol:water at 1:4:5, by vol.). After destaining with solution B for 1 min, the membrane was dried overnight. The BACE1 bands were cut out and placed in the separate wells of a 96-well plate, and N-glycans were released by the method of Nakano et al. [25]. After evaporating the solution, the residue was dissolved in 2 M acetic acid (200 μl) and incubated for 2 h at 80 ◦ C to remove sialic acids. The solution was completely evaporated, and the dried desialo N-glycans were reacted with aminoxyTMT reagent (ThermoFisher Scientific) according to the manufacturer’s protocol. To remove excess reagent that had reacted with acetone, the clean-up method for MS analysis was conducted as described previously [24]. The samples were dissolved with 12 μl of 10 mM ammonium bicarbonate, and the 8 μl was used for LC/ESI/MS and MS/MS analysis. N-Glycans labelled with aminoxyTMT were separated on a carbon column (5 μm HyperCarb, 1 mm i.d. ×100 mm, ThermoFisher Scientific) using an Accela HPLC pump (flow rate: 50 μl/min) under the following gradient conditions – a sequence of isocratic and two segmented linear gradients:
0–8 min, 10 mM NH4 HCO3 ; 8–38 min, 9–22.5 % (v/v) acetonitrile in 10 mM NH4 HCO3 ; 38–73 min, 22.5–51.75 % (v/v) acetonitrile in 10 mM NH4 HCO3 ; increasing to 81 % (v/v) acetonitrile in 10 mM NH4 HCO3 for 7 min; and re-equilibrated with 10 mM NH4 HCO3 for 15 min. The eluate was continuously introduced into an ESI source (LTQ Orbitrap XL). MS spectra were obtained in the positive ion mode using Orbitrap (mass range: m/z 800 to m/z 2000; capillary temperature: 300 ◦ C, source voltage: 4.5 kV; capillary voltage: 18 V; tube lens voltage: 110 V). For MS/MS analysis the top three precursor ions were fragmented by higher-energy collisional dissociation (HCD) using stepped collision energy (normalized collision energy: 35.0 %; width: 40.0l %; steps: 3; minimum signal required: 10000 counts; isolation width: 4.00 m/z; activation time: 100 ms) using Orbitrap. Monoisotopic masses were assigned with possible monosaccharide compositions using the GlycoMod software tool (mass tolerance for precursor ions is + −0.01 Da – http://web.expasy.org/glycomod/) and the proposed glycan structures were further verified through annotation using a fragmentation mass-matching approach based on the MS/MS data. Cycloheximide chase
Cycloheximide (Fluka) was added to the culture medium at 100 μg/ml with or without chloroquine at 100 μM and/or H2 O2 at 20 μM. After incubation for 0, 3 and 6 h, the cells were collected and subjected to Western blotting. Immunoprecipitation
The cell pellet (obtained from a 10-cm dish) was lysed with 500 μl of TBS containing 0.5 % NP-40 and protease inhibitor cocktails, and then ultracentrifuged at 100 000 g for 15 min. The supernatant was incubated with antibody (3–5 μg) for 10 min at 4 ◦ C, after which Dynabeads protein G (1 mg, Life Technologies) was added to the mixture, followed by rotation for 2 h at 4 ◦ C. The beads were washed three times with TBS containing 0.1 % NP-40, and bound proteins were eluted with SDS sample buffer. Biotinylation of cell-surface proteins
Cells were washed with PBS and then treated with 1 mg/ml of Sulfo-NHS-LC-Biotin (ThermoFisher Scientific)/PBS for 30 min at 4 ◦ C with gentle shaking. The cells were washed three times with PBS containing 100 mM glycine and then collected. Cells were lysed with TBS containing 1 % Triton X-100. After ultracentrifugation at 100 000 g for 20 min, the cleared lysate was incubated with Streptavidin-Mutein Matrix (Roche) for 90 min with rotation. After washing, bound proteins were eluted by boiling in SDS sample buffer. c 2016 Authors; published by Portland Press Limited
24
Figure 1
Y. Kizuka and others
Increased expression of BACE1 and bisecting GlcNAc in the brain of AD model mice (AppNL − G − F/NL − G − F )
(A) The cerebral cortices of 10-month-old, male, wild-type or AD model mice were immunostained for Aβ (scale bar = 200 μm). (B) The cerebral cortices of 10-month-old, male, wild-type or AD model mice were stained with anti-8-OHdG antibody (scale bar = 100 μm). (C) Brain homogenates of 10-month-old, male, wild-type or AD model mice were Western blotted for BACE1 and GAPDH (loading control). The signal intensity of BACE1 relative to that of GAPDH was quantified. The graph shows means + − S.E.M.s (n = 3, *P < 0.05, Student’s t -test). (D) The cerebral cortices of 10-month-old, wild-type or AD model mice were stained with E4-PHA lectin (scale bar = 100 μm). (E) Proteins were extracted from brain membrane fractions of 3-month-old Mgat3 + / + , AD model mice or Mgat3 − / − mice, and then incubated with E4-PHA–agarose. Membrane extracts (input) or proteins bound to E4-PHA were Western blotted for BACE1 or syntaxin 6. (F) Soluble BACE1 with a C-terminal myc-6xHis tag was stably expressed in Neuro2A cells. Cells were treated with 10 μM H2 O2 for 2 days, and BACE1 was purified from culture medium through a Ni2 + column. The purity of BACE1, and its reactivity with E4-PHA, were confirmed by Coomassie Brilliant Blue (CBB) staining (left) and lectin blotting (right), respectively. The arrow indicates BACE1-His.
Cathepsin D activity assay
Cathepsin D activity was measured for cell lysates (10 μg of proteins) using a cathepsin D activity assay kit (PromoKine) according to the manufacturer’s protocol. After a 1-h reaction, the fluorescence at excitation and emission wavelengths of 320 nm and 460 nm, respectively, was measured using a Wallac 1420 ARVOsx multilabel counter.
(Muromachi Kikai) on the right parietal bone (2 mm lateral to the midline and 4 mm anterior to the lambda), and then a 23-G needle was vertically lowered (3-mm impact depth) and withdrawn immediately. After 24 h, mouse brains were fixed by perfusion and collected as described below for further experiments.
Immunofluorescence staining Brain injury
Male mice (10–16 weeks old) were anaesthetized with isoflurane, and then placed on a heated plate during the procedure. Craniotomy (2 mm) was carried out using a microdrill c 2016 Authors; published by Portland Press Limited
To prepare frozen brain sections, mice were transcardially perfused with PBS followed by 4 % paraformaldehyde in PBS. Brains were sequentially immersed in the same fixative for 16 h and 30 % sucrose in PBS for 3 days (with daily renewal of the buffer) at 4 ◦ C. Brain sections (30-μm thick) were stained using
Bisecting GlcNAc regulates stress-induced BACE1 expression
Figure 2
25
Destabilization of BACE1 protein in Mgat3 − / − cells after oxidative stress
(A) Immunoblot of BACE1 and GAPDH of cell lysates from immortalized MEFs treated with H2 O2 (10 or 20 μM for 6 h). The signal intensity of BACE1 relative to that of GAPDH was quantified (bottom, n = 4). Relative values to that of 0 μM H2 O2 sample are shown. (B) Immortalized MEFs were treated with or without 20 μM H2 O2 for 6 h, and mRNA levels of BACE1 were then quantified (n = 2). (C) Immortalized MEFs were chased in the presence of cycloheximide. The cells were simultaneously treated with or without H2 O2 (20 μM) in the presence or absence of chloroquine (100 μM). Lysates were then immunoblotted for BACE1 and histone H3. The relative intensity of BACE1 to that of histone H3 was quantified [bottom, n = 4 (left), n = 3 (right)]. Values relative to that of chase 0 h sample are shown. The right two graphs show the data from the chloroquine ( + ) samples. (D) Cathepsin D activity was measured in cell lysates of Mgat3 + / + and Mgat3 − / − MEFs (n = 3). All graphs show means + − S.E.M.s (*P < 0.05, Mann–Whitney U-test).
the floating method. Briefly, sections were incubated with PBS containing 50 μg/ml of digitonin and 3 % BSA for 20 min at room temperature, followed by incubation with a primary antibody or biotinylated lectin (overnight at 4 ◦ C) and an Alexa-labelled secondary antibody or rhodamine (or Alexa)-labelled avidin D (30 min at room temperature). Fluorescence was visualized using an Olympus FV-1000 confocal microscope, and the data acquisition and quantification of intensity were carried out using FV10-ASW ver.1.7 software (Olympus).
RESULTS Levels of bisecting GlcNAc and BACE1 are increased together with oxidative stress in an AD mouse model
We previously reported that bisecting GlcNAc modification plays a pathological role in AD development by preventing the targeting of BACE1 to late endosomes/lysosomes [16]. As BACE1 protein is considered to be up-regulated by cellular oxidative stress, which can be caused by Aβ deposition during ageing [9,11,12,26], we hypothesized that the level of bisecting GlcNAc on BACE1 is elevated, together with an increase in the level of oxidative stress in Aβ-deposited AD model mice. We first observed that, in older (10-month-old) AD model mice (AppNL − G − F/NL − G − F ) [22], Aβ is deposited in the brain (Figure 1A) together with the accumulation of oxidative damage (Figure 1B), compared with age-matched wild-type mice. The AppNL − G − F/NL − G − F mutant mouse has knock-in mutations of the endogenous mouse App and was recently established as a next-generation AD model without any artificial effects of APP overexpression [22]. In the older brains from these mutant mice, expression of BACE1 protein was up-regulated (Figure 1C), which is consistent with previous reports of other
AD mouse models [8,27]. We also found that the level of bisecting GlcNAc, as visualized by staining with E4-PHA lectin [16,28], was increased in older mutant mice compared with wild-type mice (Figure 1D). For further examination of whether bisecting GlcNAc on BACE1 is up-regulated, bisecting GlcNAcmodified proteins were pulled down with E4-PHA lectin–agarose (Figure 1E). As expected, the non-glycosylated, tail-anchored, membrane protein syntaxin 6 was not recognized with E4-PHA lectin (Figure 1E, lower panel). Furthermore, BACE1 from GnTIII (Mgat3)-deficient mice did not react with E4-PHA, confirming that the lectin binds specifically to bisecting GlcNAc. In young (3-month-old) AD model mice, the level of bisecting GlcNAc on BACE1 was increased compared with wild-type mice (Figure 1E). To show directly that oxidative stress induces bisecting GlcNAc expression on BACE1, soluble BACE1 protein was purified from Neuro2A cells that had been treated with prooxidant hydrogen peroxide (H2 O2 ), and glycan structures of BACE1 were analysed using lectin blotting and LC/MS analysis. As expected, BACE1 was strongly stained with E4-PHA by oxidant treatment (Figure 1F). LC/MS analysis of N-glycans released from BACE1 shows that overall N-glycan profiles were not drastically changed by H2 O2 treatment (see Supplementary Figure S1A, base peak chromatogram). The levels of three bisected glycans, in which the presence of bisecting GlcNAc was confirmed by MS/MS analysis (see Supplementary Figures S1B–S1D), seem to be increased by H2 O2 treatment, especially for tri- and tetra-antennary glycans, based on their peak intensity (see Supplementary Figure S1A). Collectively, these data indicate that bisecting GlcNAc on BACE1 is elevated under oxidative stress conditions, which is consistent with the increase in oxidative stress and bisecting GlcNAc in AD model mouse brains. Our previous finding showed that bisecting GlcNAc blocks lysosomal degradation of BACE1 [16], and BACE1 was reported to be up-regulated by several oxidative c 2016 Authors; published by Portland Press Limited
26
Figure 3
Y. Kizuka and others
Site-specific analysis of BACE1 N -glycans
(A) Soluble BACE1 with a C-terminal myc-6xHis tag was stably expressed in Neuro2A cells and purified from a culture medium through a Ni2 + column. The purity of BACE1, and its reactivity with E4-PHA, were confirmed by Coomassie Brilliant Blue (CBB) staining (left) and lectin blotting (right), respectively. The arrow indicates BACE1-His. (B) Average MS spectrum of a Neuro2A-derived BACE1 glycopeptide containing Asn153 -glycans. Asterisks indicate the peak of peptide without glycan. Numbers in parentheses indicate the charge state. (C) MS/MS spectrum of the m/z 1200.89 ion represented as [M + 3H]3 + of the Asn153 -asialoglycopeptides with (Hex)5 (HexNAc)5 . N -Glycans were chemically desialylated before LC/MS analysis. A diagnostic ion (m/z 1274.63) for bisecting GlcNAc was observed. Similar MS/MS results are shown (D) for the 980.39 ion from Asn172 -asialoglycopeptides, and (E) for the 893.04 ion from Asn354 -asialoglycopeptides.
stress-inducing conditions [7–9]. In summary, we reasoned that this glycan modification plays a key role in stress-mediated BACE1 up-regulation in AD model mice.
Loss of bisecting GlcNAc destabilizes BACE1 protein during oxidative stress
For direct proof that bisecting GlcNAc regulates oxidative stress-mediated BACE1 expression, we used Mgat3 + / + (wildtype) and Mgat3 − / − MEFs. MEFs have been reported to be highly susceptible to oxidative stress under standard culture conditions [29], and the marked reduction in BACE1 protein has been observed at steady state in Mgat3 − / − MEFs compared with Mgat3 + / + MEFs [16]. Treatment with H2 O2 up-regulated c 2016 Authors; published by Portland Press Limited
BACE1 protein in wild-type cells (Figure 2A), consistent with previous reports [9]. In sharp contrast, H2 O2 treatment caused a significant reduction in BACE1 protein, but not its mRNA (consistent with a previous report [14]), in Mgat3 − / − cells (Figures 2A and 2B). This indicates that BACE1 is downregulated in Mgat3 − / − cells at the protein level on oxidative stress. As degradation of BACE1 protein occurs mainly in lysosomes but not in the proteasome [16,30], we expected that loss of bisecting GlcNAc would enhance lysosomal BACE1 degradation on oxidative stress. A cycloheximide chase experiment revealed that BACE1 was rapidly degraded in Mgat3 − / − cells after H2 O2 treatment (Figure 2C, left), whereas inhibition of lysosomal hydrolases by chloroquine abolished BACE1 degradation in both types of cells (Figure 2C, right). These results confirmed that the reduction in BACE1 protein in Mgat3 − / − cells under
Bisecting GlcNAc regulates stress-induced BACE1 expression
Figure 4
27
Degradation of a BACE1 N -glycosylation mutant is less affected by Mgat3 deficiency than wild-type BACE1
(A) Neuro2A cells were transfected with plasmids encoding wild-type (WT) BACE1 or mutant BACE1 with a mutation at one or two N -glycosylation sites (asparagine was replaced by serine) or with an empty plasmid (mock). Cells were lysed, and BACE1 was immunoprecipitated and then blotted with either anti-BACE1 antibody or E4-PHA lectin. The E4-PHA signal relative to that of BACE1 was quantified (n = 3–4, right). IP, immunoprecipitation. (B) Neuro2A cells were transfected with WT BACE1 or BACE1N153,223S -encoding plasmid or with an empty plasmid (mock), and then cell surface proteins were labelled with biotin. Cells were lysed and biotinylated proteins were purified with streptavidin beads. The cell lysates (total) and precipitated proteins (surface) were immunoblotted for BACE1. (C) Immortalized MEFs were transfected with WT BACE1 or BACE1N153,223S -encoding plasmid, and then chased in the presence of cycloheximide (100 μg/ml) and H2 O2 (20 μM). Lysates were immunoblotted for BACE1 and histone H3. The relative intensity of BACE1 to that of histone H3 was quantified (n = 3, *P < 0.05, Student’s t -test).
oxidative stress conditions was caused by accelerated lysosomal degradation. The possibility of abnormal up-regulation of global lysosomal enzyme activity in Mgat3 − / − cells was excluded, because comparable cathepsin D activity was observed in both cell types, regardless of oxidative stress (Figure 2D). These results indicate that bisecting GlcNAc modification protects BACE1 from lysosomal degradation during oxidative stress and that loss of this glycan releases BACE1 from this protection system, leading to degradation in lysosomes.
from a glycopeptide carrying bisecting GlcNAc-containing Nglycan was unambiguously detected at three N-glycosylation sites of Neuro2A-derived BACE1 (Asn153 , Asn172 and Asn354 ) (shown as ‘diagnostic ion’ in Figures 3C–3E). This clearly demonstrates the presence of bisecting GlcNAc on BACE1 Nglycans. Unfortunately, however, fragment ions derived from Asn223 glycopeptides were barely detected because of the large size of the peptide portion. Bisecting GlcNAc on BACE1 directly regulates BACE1 degradation
Site-specific analysis of BACE1 N -glycans
We next investigated whether modification of bisecting GlcNAc on BACE1 itself could protect BACE1 from lysosomal degradation. We first analysed N-glycan structures at each Nglycosylation site of BACE1, of which there are four potential sites. BACE1 was purified from overexpressing Neuro2A cells (Figure 3A) and BACE1-derived glycopeptides were analysed by LC/ESI/MS (Figure 3B and see Supplementary Figure S2). Sialic acid was chemically removed, because it would hamper further MS/MS analysis of glycopeptides. The MS spectra of glycopeptides exhibit the structural diversity of Nglycans, with a different number of branches and sialic acids. Notably, fucosylation of BACE1 N-glycans, found in BACE1 from mouse brains [16], was not detected in this analysis (Figure 3B), indicating cell-type-specific fucosylation of BACE1. Although such a partial difference in glycosylation between recombinant and native BACE1 was found, in the MS/MS spectra of desialo-glycopeptides a unique fragment ion derived
We next examined whether BACE1 instability found in Mgat3 − / − cells is caused by the loss of bisecting GlcNAc on either BACE1 or other glycoproteins. Mutation at each of the four N-glycosylation sites on BACE1 resulted in a down-shift of BACE1 in SDS/PAGE (Figure 4A, upper panel), confirming that all of these sites are indeed N-glycosylated. A mutation at the first (Asn153 ) or third (Asn223 ) N-glycosylation site effectively reduced the E4-PHA signal, and a double mutation of these two sites (BACE1N153,223S ) caused a drastic reduction in the E4PHA signal on BACE1 (Figure 4A, lower panel), indicating that these two sites are preferentially modified with bisecting GlcNAc. Cell surface biotinylation experiments confirmed that this double mutant is delivered to the cell surface, similar to wildtype BACE1 (Figure 4B). This excludes the possibility that loss of these two N-glycans caused a severe folding defect of BACE1. Wild-type BACE1 showed much faster degradation in Mgat3 − / − cells than in Mgat3 + / + cells in the presence of H2 O2 (Figure 4C, left and see Figure 2C), but the double mutation (BACE1N153,223S ) c 2016 Authors; published by Portland Press Limited
28
Y. Kizuka and others
almost cancelled the enhanced BACE1 degradation by Mgat3 deficiency (Figure 4C, right). This suggests that bisecting GlcNAc on BACE1 N-glycans is mainly involved in the regulation of BACE1 degradation on oxidative stress. As the degradation of BACE1N153,223S is still slightly faster in Mgat3 − / − cells, it is possible that another glycoprotein modified with bisecting GlcNAc also partially regulates the BACE1 degradation. Injury-induced BACE1 expression is suppressed in the Mgat3 − / − brain
Previous reports showed that the level of BACE1 protein is upregulated by traumatic brain injury [31,32], and such brain injury is known to induce oxidative stress [33]. We then investigated whether bisecting GlcNAc is required for injury-induced BACE1 up-regulation in vivo. We confirmed that BACE1 is up-regulated in the acute phase after brain injury (24 h) in Mgat3 + / + mice (Figure 5A, Ipsilateral), and this BACE1 up-regulation was found to occur mainly in neurons (Figure 5B). Although neuroinflammation was similarly induced in the vicinity of the injured area between Mgat3 + / + and Mgat3 − / − mice, as judged by the accumulation of reactive astrocytes (Figure 5A, GFAP), induction of BACE1 was significantly suppressed in the Mgat3 − / − brain (Figures 5C and 5D). These results demonstrate that bisecting GlcNAc modification is required for stress-mediated BACE1 up-regulation in the brain. DISCUSSION
We have, for the first time, demonstrated that modification of bisecting GlcNAc plays a key role in oxidative stress-mediated upregulation of BACE1. BACE1 up-regulation induced by oxidative stress could lead to enhanced Aβ generation, and increased levels of Aβ would in turn induce oxidative stress in cells [11,34]. This series of events could create a vicious cycle, thereby accelerating AD pathogenesis. The present study indicates that the absence of bisecting GlcNAc halts this cycle by accelerating lysosomal degradation of BACE1, which, in turn, leads to a reduction in Aβ deposition (Figure 6). Thus, the present study could offer a new therapeutic approach to lowering Aβ production induced by oxidative stress and traumatic brain injury, both of which are probable risk factors for AD development [35,36]. Detailed mechanisms remain to be clarified for an explanation of how BACE1 protein is relocated to lysosomes and degraded in Mgat3 − / − cells on oxidative stress. It is known that BACE1 degradation is regulated by a cytosolic protein GGA3 and that GGA3 is down-regulated on traumatic brain injury together with BACE1 up-regulation [31,37]. As bisected glycans on BACE1 are located on the luminal side, there is probably an unknown molecule that recognizes BACE1 N-glycans and regulates BACE1 lysosomal transport. It is possible that loss of bisecting GlcNAc might affect biosynthesis of other parts of the glycan, because it has been shown that bisecting GlcNAc could affect activity of other glycosyltransferases such as GnT-IV, GnT-V and α 3 GalT [38,39], and there is speculation that loss of a single glycan might induce up-regulation of other glycans as a compensation mechanism. Furthermore, the presence of bisecting GlcNAc could also have an impact on overall glyan conformation [40,41]. Therefore, it is still possible that loss or gain of bisecting GlcNAc might indirectly regulate BACE1 expression through other parts of the glycan. Although we are now searching for a novel intracellular lectin-like molecule that recognizes bisecting GlcNAc, a physical mechanism has not so far been clarified by which bisecting c 2016 Authors; published by Portland Press Limited
Figure 5 brain
Injury-mediated BACE1 induction is suppressed in the Mgat3 − / −
(A) Mgat3 + / + or Mgat3 − / − mice (10–16 weeks old) were subjected to brain injury and killed 24 h post-injury. Brain sections were immunostained for BACE1 and an astroglial marker glial fibrillary acidic protein (GFAP). The results for contralateral cortex (left) and ipsilateral cortex (right) are shown. Asterisks indicate an injured area (scale bar = 100 μm). (B) At 24 h post-injury, the ipsilateral cortices of Mgat3 + / + mice were double stained for BACE1 and a cell marker (βIII-tubulin for neurons or GFAP for astrocytes) (scale bar = 10 μm). (C, D) Magnified images for areas in the proximity of an injured region are shown (scale bar = 50 μm). Signal intensity of BACE1 in (C) was quantified (D). The graph shows means + − S.E.M.s (n = 3, **P < 0.05, Student’s t -test).
GlcNAc itself directly regulates a functional property of its carrier protein. Recent advances in redox biology revealed that elevation in H2 O2 levels will signal in cells as well as dampen macromolecule functions by oxidation [42]. Although the molecular mechanism explaining how glycans regulate BACE1 expression on H2 O2 treatment is unclear at present, it might involve oxidation of the cysteine residues of a BACE1 modulator or its transcriptional regulation. How a bisecting GlcNAc on BACE1 is involved in
Bisecting GlcNAc regulates stress-induced BACE1 expression
29
appreciate the technical help for brain injury experiments from Drs Hajime Hirase and Yoshiaki Shinohara (RIKEN BSI).
FUNDING This work was supported by RIKEN (the Systems Glycobiology Research project to N.T., Special Postdoctoral Researchers Program to Y.K. and Incentive Research Grant to Y.K.) and by the Japan Society for the Promotion of Science (Grant-in-Aid for Challenging Exploratory Research to Y.K. [26670148] and to N.T. [15K14481], Grant-in-Aid for Scientific Research (B) to N.T. [15H04700], and Grant-in-Aid for Scientific Research on Innovative Areas to Y.K. [26110723] and S.K. [26117522]).
REFERENCES
Figure 6
Schematic model for the present study
+/+
In Mgat3 cells, bisecting GlcNAc is expressed on BACE1 N -glycans. BACE1 expression is induced by cellular oxidative stress, leading to enhanced Aβ generation, creating a vicious cycle. In Mgat3 − / − cells, bisecting GlcNAc is lost on BACE1. On oxidative stress, more BACE1 is transported to lysosomes and then degraded.
stress-mediated regulation of BACE1 protein would be a difficult but fascinating future study. It was previously reported that GnT-III expression is transcriptionally up-regulated in phagocytic cells after Aβ treatment [43], although the roles of bisecting GlcNAc in Aβ clearance by phagocytosis in vivo remain to be elucidated. Even though we could not observe a significant increase of GnT-III mRNA in MEFs under oxidative stress conditions, we recently reported that GnT-III is up-regulated together with an increase in a key antioxidant transcriptional factor, Nrf2, in MEFs lacking core fucose, a widely distributed core structure in N-glycans [20]. These results suggest that GnT-III, and its product bisecting GlcNAc, respond to oxidative stress and may function to help cells adapt to this stress. As the role of glycans in redox signalling or oxidative stress has not been clarified to date, it would be interesting to investigate what kinds of glycans are up- or downregulated on cellular oxidative stress, and how these glycan changes are functionally involved in the adaptation to stress.
AUTHOR CONTRIBUTION Yasuhiko Kizuka, Shinobu Kitazume and Naoyuki Taniguchi designed the research and wrote the manuscript. Yasuhiko Kizuka performed all the biochemical experiments. Miyako Nakano carried out MS analysis. Yasuhiko Kizuka, Miyako Nakano, Shinobu Kitazume, Takashi Saito, Takaomi Saido and Naoyuki Taniguchi interpreted the data.
ACKNOWLEDGEMENTS We thank Ms Reiko Fujinawa and Keiko Sato (RIKEN GRC) for technical help. We also thank Dr Jamey D. Marth (University of California–Santa Barbara) for kindly providing Mgat3 − / − mice. We appreciate the various discussions with Nobuhisa Iwata (Nagasaki University), Shigeo Murayama and Tamao Endo (Tokyo Metropolitan Institute of Gerontology), Yasuhiro Hashimoto (Fukushima Medical University) and Yoshiki Yamaguchi (RIKEN GRC). We
1 Selkoe, D.J. (2011) Resolving controversies on the path to Alzheimer’s therapeutics. Nat. Med. 17, 1060–1065 CrossRef PubMed 2 Abbott, A. (2011) Dementia: a problem for our age. Nature 475, S2–S4 CrossRef PubMed 3 O’Brien, R.J. and Wong, P.C. (2011) Amyloid precursor protein processing and Alzheimer’s disease. Annu. Rev. Neurosci. 34, 185–204 CrossRef PubMed 4 Karran, E., Mercken, M. and De Strooper, B. (2011) The amyloid cascade hypothesis for Alzheimer’s disease: an appraisal for the development of therapeutics. Nat. Rev. Drug Discov. 10, 698–712 CrossRef PubMed 5 Vassar, R., Kuhn, P.H., Haass, C., Kennedy, M.E., Rajendran, L., Wong, P.C. and Lichtenthaler, S.F. (2014) Function, therapeutic potential and cell biology of BACE proteases: current status and future prospects. J. Neurochem. 130, 4–28 CrossRef PubMed 6 Yang, L.B., Lindholm, K., Yan, R., Citron, M., Xia, W., Yang, X.L., Beach, T., Sue, L., Wong, P., Price, D. et al. (2003) Elevated beta-secretase expression and enzymatic activity detected in sporadic Alzheimer disease. Nat. Med. 9, 3–4 CrossRef PubMed 7 Loane, D.J., Pocivavsek, A., Moussa, C.E., Thompson, R., Matsuoka, Y., Faden, A.I., Rebeck, G.W. and Burns, M.P. (2009) Amyloid precursor protein secretases as therapeutic targets for traumatic brain injury. Nat. Med. 15, 377–379 CrossRef PubMed 8 Kandalepas, P.C., Sadleir, K.R., Eimer, W.A., Zhao, J., Nicholson, D.A. and Vassar, R. (2013) The Alzheimer’s beta-secretase BACE1 localizes to normal presynaptic terminals and to dystrophic presynaptic terminals surrounding amyloid plaques. Acta Neuropathol. 126, 329–352 CrossRef PubMed 9 Kao, S.C., Krichevsky, A.M., Kosik, K.S. and Tsai, L. H. (2004) BACE1 suppression by RNA interference in primary cortical neurons. J. Biol. Chem. 279, 1942–1949 CrossRef PubMed 10 Lu, T., Pan, Y., Kao, S.Y., Li, C., Kohane, I., Chan, J. and Yankner, B.A. (2004) Gene regulation and DNA damage in the ageing human brain. Nature 429, 883–891 CrossRef PubMed 11 Mohmmad Abdul, H., Sultana, R., Keller, J.N., St Clair, D.K., Markesbery, W.R. and Butterfield, D.A. (2006) Mutations in amyloid precursor protein and presenilin-1 genes increase the basal oxidative stress in murine neuronal cells and lead to increased sensitivity to oxidative stress mediated by amyloid beta-peptide (1–42), HO and kainic acid: implications for Alzheimer’s disease. J. Neurochem. 96, 1322–1335 CrossRef PubMed 12 Bains, M. and Hall, E.D. (2012) Antioxidant therapies in traumatic brain and spinal cord injury. Biochim. Biophys. Acta 1822, 675–684 CrossRef PubMed 13 Guglielmotto, M., Aragno, M., Autelli, R., Giliberto, L., Novo, E., Colombatto, S., Danni, O., Parola, M., Smith, M.A., Perry, G. et al. (2009) The up-regulation of BACE1 mediated by hypoxia and ischemic injury: role of oxidative stress and HIF1alpha. J. Neurochem. 108, 1045–1056 CrossRef PubMed 14 Tan, J.L., Li, Q.X., Ciccotosto, G.D., Crouch, P.J., Culvenor, J.G., White, A.R. and Evin, G. (2013) Mild oxidative stress induces redistribution of BACE1 in non-apoptotic conditions and promotes the amyloidogenic processing of Alzheimer’s disease amyloid precursor protein. PLoS One 8, e61246 CrossRef PubMed 15 Sadleir, K.R. and Vassar, R. (2012) Cdk5 protein inhibition and Abeta42 increase BACE1 protein level in primary neurons by a post-transcriptional mechanism: implications of CDK5 as a therapeutic target for Alzheimer disease. J. Biol. Chem. 287, 7224–7235 CrossRef PubMed 16 Kizuka, Y., Kitazume, S., Fujinawa, R., Saito, T., Iwata, N., Saido, T.C., Nakano, M., Yamaguchi, Y., Hashimoto, Y., Staufenbiel, M. et al. (2015) An aberrant sugar modification of BACE1 blocks its lysosomal targeting in Alzheimer’s disease. EMBO Mol. Med. 7, 175–189 CrossRef PubMed 17 Taniguchi, N., Miyoshi, E., Gu, J., Honke, K. and Matsumoto, A. (2006) Decoding sugar functions by identifying target glycoproteins. Curr. Opin. Struct. Biol. 16, 561–566 CrossRef PubMed c 2016 Authors; published by Portland Press Limited
30
Y. Kizuka and others
18 Miyoshi, E., Uozumi, N., Noda, K., Hayashi, N., Hori, M. and Taniguchi, N. (1997) Expression of alpha1–6 fucosyltransferase in rat tissues and human cancer cell lines. Int. J. Cancer 72, 1117–1121 CrossRef PubMed 19 Akasaka-Manya, K., Manya, H., Sakurai, Y., Wojczyk, B.S., Kozutsumi, Y., Saito, Y., Taniguchi, N., Murayama, S., Spitalnik, S.L. and Endo, T. (2010) Protective effect of N -glycan bisecting GlcNAc residues on beta-amyloid production in Alzheimer’s disease. Glycobiology 20, 99–106 CrossRef PubMed 20 Kurimoto, A., Kitazume, S., Kizuka, Y., Nakajima, K., Oka, R., Fujinawa, R., Korekane, H., Yamaguchi, Y., Wada, Y. and Taniguchi, N. (2014) The absence of core fucose up-regulates GnT-III and Wnt target genes: a possible mechanism for an adaptive response in terms of glycan function. J. Biol. Chem. 289, 11704–11714 CrossRef PubMed 21 Priatel, J.J., Sarkar, M., Schachter, H. and Marth, J.D. (1997) Isolation, characterization and inactivation of the mouse Mgat3 gene: the bisecting N -acetylglucosamine in asparagine-linked oligosaccharides appears dispensable for viability and reproduction. Glycobiology 7, 45–56 CrossRef PubMed 22 Saito, T., Matsuba, Y., Mihira, N., Takano, J., Nilsson, P., Itohara, S., Iwata, N. and Saido, T.C. (2014) Single App knock-in mouse models of Alzheimer’s disease. Nat. Neurosci. 17, 661–663 CrossRef PubMed 23 Kitazume, S., Tachida, Y., Oka, R., Shirotani, K., Saido, T.C. and Hashimoto, Y. (2001) Alzheimer’s beta-secretase, beta-site amyloid precursor protein-cleaving enzyme, is responsible for cleavage secretion of a Golgi-resident sialyltransferase. Proc. Natl. Acad. Sci. U.S.A. 98, 13554–13559 CrossRef PubMed 24 Nakano, M., Nakagawa, T., Ito, T., Kitada, T., Hijioka, T., Kasahara, A., Tajiri, M., Wada, Y., Taniguchi, N. and Miyoshi, E. (2008) Site-specific analysis of N -glycans on haptoglobin in sera of patients with pancreatic cancer: a novel approach for the development of tumor markers. Int. J. Cancer. 122, 2301–2309 CrossRef PubMed 25 Nakano, M., Saldanha, R., Gobel, A., Kavallaris, M. and Packer, N.H. (2011) Identification of glycan structure alterations on cell membrane proteins in desoxyepothilone B resistant leukemia cells. Mol. Cell Proteomics 10, M111.009001 CrossRef PubMed 26 Mouton-Liger, F., Paquet, C., Dumurgier, J., Bouras, C., Pradier, L., Gray, F. and Hugon, J. (2012) Oxidative stress increases BACE1 protein levels through activation of the PKR-eIF2alpha pathway. Biochim. Biophys. Acta 1822, 885–896 CrossRef PubMed 27 Zhang, X.M., Cai, Y., Xiong, K., Cai, H., Luo, X.G., Feng, J.C., Clough, R.W., Struble, R.G., Patrylo, P.R. and Yan, X.X. (2009) Beta-secretase-1 elevation in transgenic mouse models of Alzheimer’s disease is associated with synaptic/axonal pathology and amyloidogenesis: implications for neuritic plaque development. Eur. J. Neurosci. 30, 2271–2283 CrossRef PubMed 28 Cummings, R.D. and Kornfeld, S. (1982) Characterization of the structural determinants required for the high affinity interaction of asparagine-linked oligosaccharides with immobilized Phaseolus vulgaris leukoagglutinating and erythroagglutinating lectins. J. Biol. Chem. 257, 11230–11234 PubMed 29 Parrinello, S., Samper, E., Krtolica, A., Goldstein, J., Melov, S. and Campisi, J. (2003) Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat. Cell Biol. 5, 741–747 CrossRef PubMed Received 17 June 2015/13 October 2015; accepted 14 October 2015 Accepted Manuscript online 14 October 2015, doi:10.1042/BJ20150607
c 2016 Authors; published by Portland Press Limited
30 Koh, Y.H., von Arnim, C.A., Hyman, B.T., Tanzi, R.E. and Tesco, G. (2005) BACE is degraded via the lysosomal pathway. J. Biol. Chem. 280, 32499–32504 CrossRef PubMed 31 Walker, K.R., Kang, E.L., Whalen, M.J., Shen, Y. and Tesco, G. (2012) Depletion of GGA1 and GGA3 mediates postinjury elevation of BACE1. J. Neurosci. 32, 10423–10437 CrossRef PubMed 32 Tesco, G., Koh, Y.H., Kang, E.L., Cameron, A.N., Das, S., Sena-Esteves, M., Hiltunen, M., Yang, S.H., Zhong, Z., Shen, Y. et al. (2007) Depletion of GGA3 stabilizes BACE and enhances beta-secretase activity. Neuron 54, 721–737 CrossRef PubMed 33 Mustafa, A.G., Singh, I.N., Wang, J., Carrico, K.M. and Hall, E.D. (2010) Mitochondrial protection after traumatic brain injury by scavenging lipid peroxyl radicals. J. Neurochem. 114, 271–280 PubMed 34 Tamagno, E., Guglielmotto, M., Aragno, M., Borghi, R., Autelli, R., Giliberto, L., Muraca, G., Danni, O., Zhu, X., Smith, M.A. et al. (2008) Oxidative stress activates a positive feedback between the gamma- and beta-secretase cleavages of the beta-amyloid precursor protein. J. Neurochem. 104, 683–695 PubMed 35 von Bernhardi, R. and Eugenin, J. (2012) Alzheimer’s disease: redox dysregulation as a common denominator for diverse pathogenic mechanisms. Antioxid. Redox Signal. 16, 974–1031 CrossRef PubMed 36 Sivanandam, T.M. and Thakur, M.K. (2012) Traumatic brain injury: a risk factor for Alzheimer’s disease. Neurosci. Biobehav. Rev. 36, 1376–1381 CrossRef PubMed 37 Kang, E.L., Cameron, A.N., Piazza, F., Walker, K.R. and Tesco, G. (2010) Ubiquitin regulates GGA3-mediated degradation of BACE1. J. Biol. Chem. 285, 24108–24119 CrossRef PubMed 38 Zhao, Y., Sato, Y., Isaji, T., Fukuda, T., Matsumoto, A., Miyoshi, E., Gu, J. and Taniguchi, N. (2008) Branched N -glycans regulate the biological functions of integrins and cadherins. FEBS J. 275, 1939–1948 CrossRef PubMed 39 Taniguchi, N. and Korekane, H. (2011) Branched N -glycans and their implications for cell adhesion, signaling and clinical applications for cancer biomarkers and in therapeutics. BMB Rep. 44, 772–781 CrossRef PubMed 40 Nishima, W., Miyashita, N., Yamaguchi, Y., Sugita, Y. and Re, S. (2012) Effect of bisecting GlcNAc and core fucosylation on conformational properties of biantennary complex-type N -glycans in solution. J. Phys. Chem. B 116, 8504–8512 CrossRef PubMed 41 Re, S., Miyashita, N., Yamaguchi, Y. and Sugita, Y. (2011) Structural diversity and changes in conformational equilibria of biantennary complex-type N -glycans in water revealed by replica-exchange molecular dynamics simulation. Biophys. J. 101, L44–46 CrossRef PubMed 42 Schieber, M. and Chandel, N.S. (2014) ROS function in redox signaling and oxidative stress. Curr. Biol. 24, R453–462 CrossRef PubMed 43 Fiala, M., Liu, P.T., Espinosa-Jeffrey, A., Rosenthal, M. J., Bernard, G., Ringman, J.M., Sayre, J., Zhang, L., Zaghi, J., Dejbakhsh, S. et al. (2007) Innate immunity and transcription of MGAT-III and Toll-like receptors in Alzheimer’s disease patients are improved by bisdemethoxycurcumin. Proc. Natl. Acad. Sci. U.S.A. 104, 12849–12854 CrossRef PubMed
21
doi:10.1042/BJ20150607
Bisecting GlcNAc modification stabilizes BACE1 protein under oxidative stress conditions Yasuhiko Kizuka*, Miyako Nakano†, Shinobu Kitazume*1 , Takashi Saito‡, Takaomi C. Saido‡ and Naoyuki Taniguchi*1 *Disease Glycomics Team, Systems Glycobiology Research Group, RIKEN–Max Planck Joint Research Centre for Systems Chemical Biology, Global Research Cluster, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan †Graduate School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, Higashihiroshima, Hiroshima 739-8530, Japan ‡Laboratory for Proteolytic Neuroscience, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan
β-Site amyloid precursor protein-cleaving enzyme-1 (BACE1) is a protease essential for amyloid-β (Aβ) production in Alzheimer’s disease (AD). BACE1 protein is known to be up-regulated by oxidative stress-inducing stimuli but the mechanism for this upregulation still needs to be clarified. We have recently found that BACE1 is modified with bisecting N-acetylglucosamine (GlcNAc) by N-acetylglucosaminyltransferase-III (GnT-III, encoded by the Mgat3 gene) and that GnT-III deficiency reduces Aβ-plaque formation in the brain by accelerating lysosomal degradation of BACE1. Therefore, we hypothesized that bisecting GlcNAc would stabilize BACE1 protein on oxidative stress. In the present study, we first show that Aβ deposition in the mouse brain induces oxidative stress, together with an increase in levels of BACE1 and bisecting GlcNAc. Furthermore, prooxidant treatment induces expression of BACE1 protein in wild-type mouse embryonic fibroblasts (MEFs), whereas it reduces BACE1 protein in GnT-III (Mgat3) knock-out MEFs by accelerating
lysosomal degradation of BACE1. We purified BACE1 from Neuro2A cells and performed LC/ESI/MS analysis for BACE1derived glycopeptides and mapped bisecting GlcNAc-modified sites on BACE1. Point mutations at two N-glycosylation sites (Asn153 and Asn223 ) abolish the bisecting GlcNAc modification on BACE1. These mutations almost cancelled the enhanced BACE1 degradation seen in Mgat3 − / − MEFs, indicating that bisecting GlcNAc on BACE1 indeed regulates its degradation. Finally, we show that traumatic brain injury-induced BACE1 up-regulation is significantly suppressed in the Mgat3 − / − brain. These results highlight the role of bisecting GlcNAc in oxidative stress-induced BACE1 expression and offer a novel glycan-targeted strategy for suppressing Aβ generation.
INTRODUCTION
a glycan structure that is highly expressed in the brain [17,18]. We also found that the amount of bisecting GlcNAc on BACE1 is significantly higher in AD patients [19], and that mutant mice lacking the biosynthetic enzyme Nacetylglucosaminyltransferase-III (GnT-III, encoded by the Mgat3 gene) displayed greatly reduced numbers of Aβ plaques in the brain [16]. As an underlying molecular mechanism, we found that loss of bisecting GlcNAc leads to the relocation of BACE1 from early endosomes to late endosomes/lysosomes. This leads to reduced co-localization of BACE1 with APP, and decreased BACE1 protein levels because of its lysosomal degradation. In addition, our analysis of mutant cells lacking another type of glycosylation, core fucosylation, revealed that the lack of core fucose leads to the up-regulation of GnT-III, together with several oxidative stress-responsive genes [20], suggesting a relationship between bisecting GlcNAc and oxidative stress. From these results, we hypothesize that bisecting GlcNAc stabilizes BACE1 protein in oxidative stress conditions, resulting in an increase in Aβ generation. In the present study, we reveal that bisecting GlcNAc indeed plays a critical role in BACE1 induction in response to oxidative stress. Furthermore, by using mutant BACE1 lacking two key Nglycosylation sites, we found that bisecting GlcNAc on BACE1 is directly required for maintaining BACE1 stability under stress conditions. Finally, we show that injury-induced BACE1
Alzheimer’s disease (AD) is a devastating dementia characterized by progressive neurodegeneration [1,2]. One of the hallmarks of this disease is the presence of senile plaques in the brain that consist of accumulated amyloid-β (Aβ) peptide. Aβ is generated from the proteolytic cleavage of amyloid precursor protein (APP) by β-site APP-cleaving enzyme-1 (BACE1) and γ -secretase [3]. As Aβ deposition is considered to be a critical event in the development of AD [4], molecules involved in Aβ generation and clearance are promising drug targets for the treatment of AD. BACE1 is known to be a stress-responsive molecule [5], and BACE1 activity is up-regulated in AD patients [6]. Up-regulation of BACE1 and increased Aβ generation are observed during ageing and traumatic brain injury [7,8]. Furthermore, exposing cells to Aβ also up-regulates BACE1 [9]. These events are known to evoke cellular oxidative stress [10–12], and this stress has been reported to induce BACE1 expression and activity [9,13,14]. Although the molecular mechanism underlying BACE1 upregulation in response to oxidative stress is not well understood, BACE1 activation seems to be regulated at the protein level [15]. This raises the possibility that post-translational modifications could regulate BACE1 induction. We recently found that N-glycans of BACE1 are selectively modified with bisecting N-acetylglucosamine (GlcNAc) [16],
Key words: Alzheimer’s disease, BACE1, bisecting GlcNAc, glycobiology, GnT-III, oxidative stress.
Abbreviations: 8-OHdG, 8-hydroxydeoxyguanosine; AD, Alzheimer’s disease; APP, amyloid precursor protein; BACE1, β-site amyloid precursor proteincleaving enzyme-1; E4-PHA, erythroagglutinating phytohaemagglutinin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; GlcNAc, N -acetylglucosamine; GnT-III, N -acetylglucosaminyltransferase-III; HRP, horseradish peroxidase; MEF, mouse embryonic fibroblast. 1 To whom correspondence should be addressed (email [email protected] or [email protected]/[email protected]) c 2016 Authors; published by Portland Press Limited
22
Y. Kizuka and others
expression is significantly suppressed in the Mgat3 − / − brain. Our data provide a new link between glycan modification on BACE1 and up-regulation of BACE1 by oxidative stress.
transcribed using Superscript III (Life Technologies). For realtime PCR, cDNA was mixed with TaqMan Universal PCR Master Mix (Life Technologies), and amplified using an ABI PRISM 7900HT. The mRNA levels were normalized to the corresponding rRNA levels.
EXPERIMENTAL Materials
The following antibodies were used: anti-histone H3 (4620) and anti-BACE1 (5606) from Cell Signaling Technology, anti-8hydroxydeoxyguanosine (anti-8-OHdG; N45.1) from the Japan Institute for the Control of Ageing, anti-actin (A4700) from Sigma-Aldrich, anti-glyceraldehyde 3-phosphate dehydrogenase (anti-GAPDH; MAB374) from Millipore, anti-Aβ (clone 6E10) from Signet (9320-02), anti-glial fibrillary acidic protein (antiGFAP) from Life Technologies (13-0300), anti-syntaxin 6 (610635) from BD Biosciences and anti-βIII tubulin (TUJ1) from Covance (MMS-435P). Biotinylated and agarose-conjugated erythroagglutinating phytohaemagglutinin (E4-PHA) lectins were purchased from Seikagaku Corp. Primer-probe sets for mRNA quantification were purchased from Life Technologies: control ribosomal RNA, 4308329; Bace1, Mm00478664_m1.
Plasmids
The construction of pCAGGS/human BACE1 (501 amino acid isoform) has been described previously [23]. The pcDNA6-mycHis A/human BACE1 (soluble BACE1-myc-his) was constructed using PCR to amplify the BACE1 cDNA fragment encoding Met1 to Ser453 . The fragment was inserted into pcDNA6/mycHis A with EcoRV and XhoI sites. The pCAGGS/human BACE1 mutants (Asn153 Ser, Asn172 Ser, Asn223 Ser, Asn354 Ser) were constructed using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies). The pCAGGS/human BACE1N153,223S was constructed by PCR using Asn153 Ser cDNA or Asn223 Ser cDNA as a template. The two amplified fragments were digested with EcoRI and StuI, and the smaller fragment derived from Asn153 Ser cDNA and the larger fragment from Asn223 Ser were then simultaneously inserted into pCAGGS, which had been digested with EcoRI. The primers used are listed in Table 1.
Mutant mice
The generation of the Mgat3-deficient mice has been described previously [21]. Mgat3-deficient mice were generously provided by Dr Jamey D. Marth (University of California–Santa Barbara) [21]. The generation of AD model mice (AppNL − G − F/NL − G − F ) has also been described previously [22]. All mice were from a C57BL/6 genetic background. They were housed (three or fewer mice per cage) at 20∼26 ◦ C and 45∼65 % humidity. The light conditions were 14 h:10 h (lights on at 07:00 hours). The Animal Experiment Committee of RIKEN approved all animal experiments. Lectin pull-down
Membrane fractions from mouse brains were prepared as described previously [16]. Proteins were solubilized with a buffer (TBS containing 0.5 % NP-40), followed by ultracentrifugation at 100 000 g for 15 min. The resultant supernatant (input) was incubated with E4-PHA agarose for 1 h with gentle shaking. After washing twice with TBS containing 0.1 % NP-40, bound proteins were eluted by boiling with SDS sample buffer. Cell culture and transfection
Neuro2A cells and immortalized mouse embryonic fibroblasts (MEFs) [16] were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10 % FBS. For plasmid transfection, cells at 80 % confluency on a 10-cm dish were transfected with 4–8 μg of each plasmid using 10–20 μl of Lipofectamine 2000 (for Neuro2A) or 16–32 μl of polyethyleneimine MAX (for MEF, Polysciences, Inc.). Polyethyleneimine MAX solution was prepared at 2 mg/ml, and the pH was adjusted to 7.2 with NaOH. In some experiments, MEFs were treated with 10 or 20 μM hydrogen peroxide, or 100 μM chloroquine, for 6 h. RNA extraction, reverse transcription and real-time PCR
Total RNA from cultured cells was extracted using TRI Reagent (Molecular Research Center, Inc.), according to the manufacturer’s protocol. Total RNA (1 μg) was reverse c 2016 Authors; published by Portland Press Limited
Western and lectin blots
Proteins were separated by SDS/5–20 % PAGE using the Laemmli buffer system, and then transferred to nitrocellulose membranes. After blocking with 5 % non-fat dry milk in TBS containing 0.05 % Tween-20 (or blocking with TBS containing 0.1 % Tween-20 for lectin blot), the membranes were incubated with primary antibodies or biotinylated lectin, followed by horseradish peroxidase (HRP)-conjugated secondary antibodies or HRP-conjugated streptavidin (VECTASTAIN ABC Standard Kit). Proteins were detected with Western Lightning ECL Pro (PerkinElmer) using an ImageQuant LAS-4000mini (GE Healthcare). Glycan analysis of recombinant BACE1
For purification of soluble BACE1-His, Neuro2A cells were transfected with the plasmid pcDNA6-myc-His A/human BACE1, and stable transfectants were established using blasticidin at 7.5 μg/ml. The culture medium was replaced with Opti-MEM I, followed by a further 2 or 3 days in culture in the presence or absence of 10 μM H2 O2 . The collected medium, to which NaCl (final concentration 0.5 M) and imidazole (final concentration 20 mM) were added, was applied to a Ni2 + /Sepharose column which had been equilibrated with buffer A (20 mM sodium phosphate, pH 7.2, 0.5 M NaCl) containing 20 mM imidazole. After washing with buffer A containing 20 mM imidazole, bound proteins were eluted with buffer A containing 0.5 M imidazole. For glycopeptide analysis, to remove NaCl and imidazole, the sample was diluted with 50 mM Tris/HCl and concentrated several times using Amicon ultracentrifugal filter units (Millipore), and then lyophilized. The lyophilized recombinant BACE1 (100 μg), obtained from 60 ml of culture medium, was reduced with DTT (10 mg) and alkylated with iodoacetamide (20 mg) [24]. After the reaction mixture was passed through a Nap-5 column (GE Healthcare) to remove salts from the reducing solution, as well as excess iodoacetamide, the sample was digested with lysylendopeptidase (2 μg, Wako Pure Chemical Industries Ltd) and trypsin (2 μg, Promega) for 16 h at 37 ◦ C, and then digested with endoprotease Glu-C (5 μg, Wako Pure Chemical Industries
Bisecting GlcNAc regulates stress-induced BACE1 expression
23
Table 1 Primers for plasmid construction Plasmid name
Forward primer
Reverse primer
pcDNA6-myc-His A/human BACE1 pCAGGS/human BACE1 Asn153 Ser pCAGGS/human BACE1 Asn172 Ser pCAGGS/human BACE1 Asn223 Ser pCAGGS/human BACE1 Asn354 Ser pCAGGS/human BACE1 Asn153,223 Ser
ATGGCCCAAGCCCTGCCCTG TAAGCATCCCCCATGGCCCCAGCGTCACTGTGCGTGCCAACAT AATCAGACAAGTTCTTCATCAGCGGCTCCAACTGGGAAGGCATC GTGGTGCTGGCTTCCCCCTCAGCCAGTCTGAAGTGCTGGCCTC ACCTAATGGGTGAGGTTACCAGCCAGTCCTTCCGCATCACCAT GGGGAATTCATGGCCCAAGCCCTGCCCTG
CATCTCGAGTGACTCATCTGTCTGTGGAA Complementary Complementary Complementary Complementary TGGGAATTCTCACTTCAGCAGGGAGATGT
Ltd) for 16 h at 37 ◦ C. The digest was divided into two portions. One portion was used as a ‘sialo sample without enrichment’, to detect the presence of bisecting GlcNAc at all glycosylation sites on BACE1. The other portion was treated with Sepharose CL4B to enrich glycopeptides [24], and then incubated with 2 M acetic acid for 2 h at 80 ◦ C to remove sialic acids. The resulting ‘desialo sample-enriched glycopeptides’ were used to show the presence of bisecting GlcNAc by MS/MS analysis. Both samples were analysed by LC/ESI/MS. The glycopeptide mixtures were separated using a Develosil 300ODS-HG-5 column (150×1.0 mm i.d., Nomura Chemical). The mobile phases were: (A) 0.08 % formic acid and (B) 0.15 % formic acid/80 % acetonitrile. The column was eluted with solvent A for 5 min, at which point the concentration of solvent B was increased to 40 % over 55 min at a flow rate of 50 μl/min using an Accela HPLC system (ThermoFisher Scientific). The eluate was continuously introduced into an ESI source (LTQ Orbitrap XL, ThermoFisher Scientific). MS spectra were obtained in the positive ion mode using Orbitrap MS, and MS/MS spectra were obtained using Iontrap MS. Monoisotopic masses were assigned with possible monosaccharide compositions using the GlycoMod tool available on the ExPASy server (http://web.expasy.org/glycomod/; mass tolerance for precursor ions is + −0.01 Da) and the proposed glycan structures were further verified through annotation using a fragmentation mass-matching approach based on the MS/MS data. For analysis of released N-glycan, the eluate from the Ni2 + column was subjected to SDS/PAGE, and proteins were transferred to a PVDF membrane. The dried membrane was washed with ethanol, and then three times with water. To stain proteins, the membrane was incubated for 5 min with Direct Blue 71 [800 μl of solution A (0.1 %, w/v), Direct Blue 71 (Sigma-Aldrich)] in 10 ml of solution B (acetic acid:ethanol:water at 1:4:5, by vol.). After destaining with solution B for 1 min, the membrane was dried overnight. The BACE1 bands were cut out and placed in the separate wells of a 96-well plate, and N-glycans were released by the method of Nakano et al. [25]. After evaporating the solution, the residue was dissolved in 2 M acetic acid (200 μl) and incubated for 2 h at 80 ◦ C to remove sialic acids. The solution was completely evaporated, and the dried desialo N-glycans were reacted with aminoxyTMT reagent (ThermoFisher Scientific) according to the manufacturer’s protocol. To remove excess reagent that had reacted with acetone, the clean-up method for MS analysis was conducted as described previously [24]. The samples were dissolved with 12 μl of 10 mM ammonium bicarbonate, and the 8 μl was used for LC/ESI/MS and MS/MS analysis. N-Glycans labelled with aminoxyTMT were separated on a carbon column (5 μm HyperCarb, 1 mm i.d. ×100 mm, ThermoFisher Scientific) using an Accela HPLC pump (flow rate: 50 μl/min) under the following gradient conditions – a sequence of isocratic and two segmented linear gradients:
0–8 min, 10 mM NH4 HCO3 ; 8–38 min, 9–22.5 % (v/v) acetonitrile in 10 mM NH4 HCO3 ; 38–73 min, 22.5–51.75 % (v/v) acetonitrile in 10 mM NH4 HCO3 ; increasing to 81 % (v/v) acetonitrile in 10 mM NH4 HCO3 for 7 min; and re-equilibrated with 10 mM NH4 HCO3 for 15 min. The eluate was continuously introduced into an ESI source (LTQ Orbitrap XL). MS spectra were obtained in the positive ion mode using Orbitrap (mass range: m/z 800 to m/z 2000; capillary temperature: 300 ◦ C, source voltage: 4.5 kV; capillary voltage: 18 V; tube lens voltage: 110 V). For MS/MS analysis the top three precursor ions were fragmented by higher-energy collisional dissociation (HCD) using stepped collision energy (normalized collision energy: 35.0 %; width: 40.0l %; steps: 3; minimum signal required: 10000 counts; isolation width: 4.00 m/z; activation time: 100 ms) using Orbitrap. Monoisotopic masses were assigned with possible monosaccharide compositions using the GlycoMod software tool (mass tolerance for precursor ions is + −0.01 Da – http://web.expasy.org/glycomod/) and the proposed glycan structures were further verified through annotation using a fragmentation mass-matching approach based on the MS/MS data. Cycloheximide chase
Cycloheximide (Fluka) was added to the culture medium at 100 μg/ml with or without chloroquine at 100 μM and/or H2 O2 at 20 μM. After incubation for 0, 3 and 6 h, the cells were collected and subjected to Western blotting. Immunoprecipitation
The cell pellet (obtained from a 10-cm dish) was lysed with 500 μl of TBS containing 0.5 % NP-40 and protease inhibitor cocktails, and then ultracentrifuged at 100 000 g for 15 min. The supernatant was incubated with antibody (3–5 μg) for 10 min at 4 ◦ C, after which Dynabeads protein G (1 mg, Life Technologies) was added to the mixture, followed by rotation for 2 h at 4 ◦ C. The beads were washed three times with TBS containing 0.1 % NP-40, and bound proteins were eluted with SDS sample buffer. Biotinylation of cell-surface proteins
Cells were washed with PBS and then treated with 1 mg/ml of Sulfo-NHS-LC-Biotin (ThermoFisher Scientific)/PBS for 30 min at 4 ◦ C with gentle shaking. The cells were washed three times with PBS containing 100 mM glycine and then collected. Cells were lysed with TBS containing 1 % Triton X-100. After ultracentrifugation at 100 000 g for 20 min, the cleared lysate was incubated with Streptavidin-Mutein Matrix (Roche) for 90 min with rotation. After washing, bound proteins were eluted by boiling in SDS sample buffer. c 2016 Authors; published by Portland Press Limited
24
Figure 1
Y. Kizuka and others
Increased expression of BACE1 and bisecting GlcNAc in the brain of AD model mice (AppNL − G − F/NL − G − F )
(A) The cerebral cortices of 10-month-old, male, wild-type or AD model mice were immunostained for Aβ (scale bar = 200 μm). (B) The cerebral cortices of 10-month-old, male, wild-type or AD model mice were stained with anti-8-OHdG antibody (scale bar = 100 μm). (C) Brain homogenates of 10-month-old, male, wild-type or AD model mice were Western blotted for BACE1 and GAPDH (loading control). The signal intensity of BACE1 relative to that of GAPDH was quantified. The graph shows means + − S.E.M.s (n = 3, *P < 0.05, Student’s t -test). (D) The cerebral cortices of 10-month-old, wild-type or AD model mice were stained with E4-PHA lectin (scale bar = 100 μm). (E) Proteins were extracted from brain membrane fractions of 3-month-old Mgat3 + / + , AD model mice or Mgat3 − / − mice, and then incubated with E4-PHA–agarose. Membrane extracts (input) or proteins bound to E4-PHA were Western blotted for BACE1 or syntaxin 6. (F) Soluble BACE1 with a C-terminal myc-6xHis tag was stably expressed in Neuro2A cells. Cells were treated with 10 μM H2 O2 for 2 days, and BACE1 was purified from culture medium through a Ni2 + column. The purity of BACE1, and its reactivity with E4-PHA, were confirmed by Coomassie Brilliant Blue (CBB) staining (left) and lectin blotting (right), respectively. The arrow indicates BACE1-His.
Cathepsin D activity assay
Cathepsin D activity was measured for cell lysates (10 μg of proteins) using a cathepsin D activity assay kit (PromoKine) according to the manufacturer’s protocol. After a 1-h reaction, the fluorescence at excitation and emission wavelengths of 320 nm and 460 nm, respectively, was measured using a Wallac 1420 ARVOsx multilabel counter.
(Muromachi Kikai) on the right parietal bone (2 mm lateral to the midline and 4 mm anterior to the lambda), and then a 23-G needle was vertically lowered (3-mm impact depth) and withdrawn immediately. After 24 h, mouse brains were fixed by perfusion and collected as described below for further experiments.
Immunofluorescence staining Brain injury
Male mice (10–16 weeks old) were anaesthetized with isoflurane, and then placed on a heated plate during the procedure. Craniotomy (2 mm) was carried out using a microdrill c 2016 Authors; published by Portland Press Limited
To prepare frozen brain sections, mice were transcardially perfused with PBS followed by 4 % paraformaldehyde in PBS. Brains were sequentially immersed in the same fixative for 16 h and 30 % sucrose in PBS for 3 days (with daily renewal of the buffer) at 4 ◦ C. Brain sections (30-μm thick) were stained using
Bisecting GlcNAc regulates stress-induced BACE1 expression
Figure 2
25
Destabilization of BACE1 protein in Mgat3 − / − cells after oxidative stress
(A) Immunoblot of BACE1 and GAPDH of cell lysates from immortalized MEFs treated with H2 O2 (10 or 20 μM for 6 h). The signal intensity of BACE1 relative to that of GAPDH was quantified (bottom, n = 4). Relative values to that of 0 μM H2 O2 sample are shown. (B) Immortalized MEFs were treated with or without 20 μM H2 O2 for 6 h, and mRNA levels of BACE1 were then quantified (n = 2). (C) Immortalized MEFs were chased in the presence of cycloheximide. The cells were simultaneously treated with or without H2 O2 (20 μM) in the presence or absence of chloroquine (100 μM). Lysates were then immunoblotted for BACE1 and histone H3. The relative intensity of BACE1 to that of histone H3 was quantified [bottom, n = 4 (left), n = 3 (right)]. Values relative to that of chase 0 h sample are shown. The right two graphs show the data from the chloroquine ( + ) samples. (D) Cathepsin D activity was measured in cell lysates of Mgat3 + / + and Mgat3 − / − MEFs (n = 3). All graphs show means + − S.E.M.s (*P < 0.05, Mann–Whitney U-test).
the floating method. Briefly, sections were incubated with PBS containing 50 μg/ml of digitonin and 3 % BSA for 20 min at room temperature, followed by incubation with a primary antibody or biotinylated lectin (overnight at 4 ◦ C) and an Alexa-labelled secondary antibody or rhodamine (or Alexa)-labelled avidin D (30 min at room temperature). Fluorescence was visualized using an Olympus FV-1000 confocal microscope, and the data acquisition and quantification of intensity were carried out using FV10-ASW ver.1.7 software (Olympus).
RESULTS Levels of bisecting GlcNAc and BACE1 are increased together with oxidative stress in an AD mouse model
We previously reported that bisecting GlcNAc modification plays a pathological role in AD development by preventing the targeting of BACE1 to late endosomes/lysosomes [16]. As BACE1 protein is considered to be up-regulated by cellular oxidative stress, which can be caused by Aβ deposition during ageing [9,11,12,26], we hypothesized that the level of bisecting GlcNAc on BACE1 is elevated, together with an increase in the level of oxidative stress in Aβ-deposited AD model mice. We first observed that, in older (10-month-old) AD model mice (AppNL − G − F/NL − G − F ) [22], Aβ is deposited in the brain (Figure 1A) together with the accumulation of oxidative damage (Figure 1B), compared with age-matched wild-type mice. The AppNL − G − F/NL − G − F mutant mouse has knock-in mutations of the endogenous mouse App and was recently established as a next-generation AD model without any artificial effects of APP overexpression [22]. In the older brains from these mutant mice, expression of BACE1 protein was up-regulated (Figure 1C), which is consistent with previous reports of other
AD mouse models [8,27]. We also found that the level of bisecting GlcNAc, as visualized by staining with E4-PHA lectin [16,28], was increased in older mutant mice compared with wild-type mice (Figure 1D). For further examination of whether bisecting GlcNAc on BACE1 is up-regulated, bisecting GlcNAcmodified proteins were pulled down with E4-PHA lectin–agarose (Figure 1E). As expected, the non-glycosylated, tail-anchored, membrane protein syntaxin 6 was not recognized with E4-PHA lectin (Figure 1E, lower panel). Furthermore, BACE1 from GnTIII (Mgat3)-deficient mice did not react with E4-PHA, confirming that the lectin binds specifically to bisecting GlcNAc. In young (3-month-old) AD model mice, the level of bisecting GlcNAc on BACE1 was increased compared with wild-type mice (Figure 1E). To show directly that oxidative stress induces bisecting GlcNAc expression on BACE1, soluble BACE1 protein was purified from Neuro2A cells that had been treated with prooxidant hydrogen peroxide (H2 O2 ), and glycan structures of BACE1 were analysed using lectin blotting and LC/MS analysis. As expected, BACE1 was strongly stained with E4-PHA by oxidant treatment (Figure 1F). LC/MS analysis of N-glycans released from BACE1 shows that overall N-glycan profiles were not drastically changed by H2 O2 treatment (see Supplementary Figure S1A, base peak chromatogram). The levels of three bisected glycans, in which the presence of bisecting GlcNAc was confirmed by MS/MS analysis (see Supplementary Figures S1B–S1D), seem to be increased by H2 O2 treatment, especially for tri- and tetra-antennary glycans, based on their peak intensity (see Supplementary Figure S1A). Collectively, these data indicate that bisecting GlcNAc on BACE1 is elevated under oxidative stress conditions, which is consistent with the increase in oxidative stress and bisecting GlcNAc in AD model mouse brains. Our previous finding showed that bisecting GlcNAc blocks lysosomal degradation of BACE1 [16], and BACE1 was reported to be up-regulated by several oxidative c 2016 Authors; published by Portland Press Limited
26
Figure 3
Y. Kizuka and others
Site-specific analysis of BACE1 N -glycans
(A) Soluble BACE1 with a C-terminal myc-6xHis tag was stably expressed in Neuro2A cells and purified from a culture medium through a Ni2 + column. The purity of BACE1, and its reactivity with E4-PHA, were confirmed by Coomassie Brilliant Blue (CBB) staining (left) and lectin blotting (right), respectively. The arrow indicates BACE1-His. (B) Average MS spectrum of a Neuro2A-derived BACE1 glycopeptide containing Asn153 -glycans. Asterisks indicate the peak of peptide without glycan. Numbers in parentheses indicate the charge state. (C) MS/MS spectrum of the m/z 1200.89 ion represented as [M + 3H]3 + of the Asn153 -asialoglycopeptides with (Hex)5 (HexNAc)5 . N -Glycans were chemically desialylated before LC/MS analysis. A diagnostic ion (m/z 1274.63) for bisecting GlcNAc was observed. Similar MS/MS results are shown (D) for the 980.39 ion from Asn172 -asialoglycopeptides, and (E) for the 893.04 ion from Asn354 -asialoglycopeptides.
stress-inducing conditions [7–9]. In summary, we reasoned that this glycan modification plays a key role in stress-mediated BACE1 up-regulation in AD model mice.
Loss of bisecting GlcNAc destabilizes BACE1 protein during oxidative stress
For direct proof that bisecting GlcNAc regulates oxidative stress-mediated BACE1 expression, we used Mgat3 + / + (wildtype) and Mgat3 − / − MEFs. MEFs have been reported to be highly susceptible to oxidative stress under standard culture conditions [29], and the marked reduction in BACE1 protein has been observed at steady state in Mgat3 − / − MEFs compared with Mgat3 + / + MEFs [16]. Treatment with H2 O2 up-regulated c 2016 Authors; published by Portland Press Limited
BACE1 protein in wild-type cells (Figure 2A), consistent with previous reports [9]. In sharp contrast, H2 O2 treatment caused a significant reduction in BACE1 protein, but not its mRNA (consistent with a previous report [14]), in Mgat3 − / − cells (Figures 2A and 2B). This indicates that BACE1 is downregulated in Mgat3 − / − cells at the protein level on oxidative stress. As degradation of BACE1 protein occurs mainly in lysosomes but not in the proteasome [16,30], we expected that loss of bisecting GlcNAc would enhance lysosomal BACE1 degradation on oxidative stress. A cycloheximide chase experiment revealed that BACE1 was rapidly degraded in Mgat3 − / − cells after H2 O2 treatment (Figure 2C, left), whereas inhibition of lysosomal hydrolases by chloroquine abolished BACE1 degradation in both types of cells (Figure 2C, right). These results confirmed that the reduction in BACE1 protein in Mgat3 − / − cells under
Bisecting GlcNAc regulates stress-induced BACE1 expression
Figure 4
27
Degradation of a BACE1 N -glycosylation mutant is less affected by Mgat3 deficiency than wild-type BACE1
(A) Neuro2A cells were transfected with plasmids encoding wild-type (WT) BACE1 or mutant BACE1 with a mutation at one or two N -glycosylation sites (asparagine was replaced by serine) or with an empty plasmid (mock). Cells were lysed, and BACE1 was immunoprecipitated and then blotted with either anti-BACE1 antibody or E4-PHA lectin. The E4-PHA signal relative to that of BACE1 was quantified (n = 3–4, right). IP, immunoprecipitation. (B) Neuro2A cells were transfected with WT BACE1 or BACE1N153,223S -encoding plasmid or with an empty plasmid (mock), and then cell surface proteins were labelled with biotin. Cells were lysed and biotinylated proteins were purified with streptavidin beads. The cell lysates (total) and precipitated proteins (surface) were immunoblotted for BACE1. (C) Immortalized MEFs were transfected with WT BACE1 or BACE1N153,223S -encoding plasmid, and then chased in the presence of cycloheximide (100 μg/ml) and H2 O2 (20 μM). Lysates were immunoblotted for BACE1 and histone H3. The relative intensity of BACE1 to that of histone H3 was quantified (n = 3, *P < 0.05, Student’s t -test).
oxidative stress conditions was caused by accelerated lysosomal degradation. The possibility of abnormal up-regulation of global lysosomal enzyme activity in Mgat3 − / − cells was excluded, because comparable cathepsin D activity was observed in both cell types, regardless of oxidative stress (Figure 2D). These results indicate that bisecting GlcNAc modification protects BACE1 from lysosomal degradation during oxidative stress and that loss of this glycan releases BACE1 from this protection system, leading to degradation in lysosomes.
from a glycopeptide carrying bisecting GlcNAc-containing Nglycan was unambiguously detected at three N-glycosylation sites of Neuro2A-derived BACE1 (Asn153 , Asn172 and Asn354 ) (shown as ‘diagnostic ion’ in Figures 3C–3E). This clearly demonstrates the presence of bisecting GlcNAc on BACE1 Nglycans. Unfortunately, however, fragment ions derived from Asn223 glycopeptides were barely detected because of the large size of the peptide portion. Bisecting GlcNAc on BACE1 directly regulates BACE1 degradation
Site-specific analysis of BACE1 N -glycans
We next investigated whether modification of bisecting GlcNAc on BACE1 itself could protect BACE1 from lysosomal degradation. We first analysed N-glycan structures at each Nglycosylation site of BACE1, of which there are four potential sites. BACE1 was purified from overexpressing Neuro2A cells (Figure 3A) and BACE1-derived glycopeptides were analysed by LC/ESI/MS (Figure 3B and see Supplementary Figure S2). Sialic acid was chemically removed, because it would hamper further MS/MS analysis of glycopeptides. The MS spectra of glycopeptides exhibit the structural diversity of Nglycans, with a different number of branches and sialic acids. Notably, fucosylation of BACE1 N-glycans, found in BACE1 from mouse brains [16], was not detected in this analysis (Figure 3B), indicating cell-type-specific fucosylation of BACE1. Although such a partial difference in glycosylation between recombinant and native BACE1 was found, in the MS/MS spectra of desialo-glycopeptides a unique fragment ion derived
We next examined whether BACE1 instability found in Mgat3 − / − cells is caused by the loss of bisecting GlcNAc on either BACE1 or other glycoproteins. Mutation at each of the four N-glycosylation sites on BACE1 resulted in a down-shift of BACE1 in SDS/PAGE (Figure 4A, upper panel), confirming that all of these sites are indeed N-glycosylated. A mutation at the first (Asn153 ) or third (Asn223 ) N-glycosylation site effectively reduced the E4-PHA signal, and a double mutation of these two sites (BACE1N153,223S ) caused a drastic reduction in the E4PHA signal on BACE1 (Figure 4A, lower panel), indicating that these two sites are preferentially modified with bisecting GlcNAc. Cell surface biotinylation experiments confirmed that this double mutant is delivered to the cell surface, similar to wildtype BACE1 (Figure 4B). This excludes the possibility that loss of these two N-glycans caused a severe folding defect of BACE1. Wild-type BACE1 showed much faster degradation in Mgat3 − / − cells than in Mgat3 + / + cells in the presence of H2 O2 (Figure 4C, left and see Figure 2C), but the double mutation (BACE1N153,223S ) c 2016 Authors; published by Portland Press Limited
28
Y. Kizuka and others
almost cancelled the enhanced BACE1 degradation by Mgat3 deficiency (Figure 4C, right). This suggests that bisecting GlcNAc on BACE1 N-glycans is mainly involved in the regulation of BACE1 degradation on oxidative stress. As the degradation of BACE1N153,223S is still slightly faster in Mgat3 − / − cells, it is possible that another glycoprotein modified with bisecting GlcNAc also partially regulates the BACE1 degradation. Injury-induced BACE1 expression is suppressed in the Mgat3 − / − brain
Previous reports showed that the level of BACE1 protein is upregulated by traumatic brain injury [31,32], and such brain injury is known to induce oxidative stress [33]. We then investigated whether bisecting GlcNAc is required for injury-induced BACE1 up-regulation in vivo. We confirmed that BACE1 is up-regulated in the acute phase after brain injury (24 h) in Mgat3 + / + mice (Figure 5A, Ipsilateral), and this BACE1 up-regulation was found to occur mainly in neurons (Figure 5B). Although neuroinflammation was similarly induced in the vicinity of the injured area between Mgat3 + / + and Mgat3 − / − mice, as judged by the accumulation of reactive astrocytes (Figure 5A, GFAP), induction of BACE1 was significantly suppressed in the Mgat3 − / − brain (Figures 5C and 5D). These results demonstrate that bisecting GlcNAc modification is required for stress-mediated BACE1 up-regulation in the brain. DISCUSSION
We have, for the first time, demonstrated that modification of bisecting GlcNAc plays a key role in oxidative stress-mediated upregulation of BACE1. BACE1 up-regulation induced by oxidative stress could lead to enhanced Aβ generation, and increased levels of Aβ would in turn induce oxidative stress in cells [11,34]. This series of events could create a vicious cycle, thereby accelerating AD pathogenesis. The present study indicates that the absence of bisecting GlcNAc halts this cycle by accelerating lysosomal degradation of BACE1, which, in turn, leads to a reduction in Aβ deposition (Figure 6). Thus, the present study could offer a new therapeutic approach to lowering Aβ production induced by oxidative stress and traumatic brain injury, both of which are probable risk factors for AD development [35,36]. Detailed mechanisms remain to be clarified for an explanation of how BACE1 protein is relocated to lysosomes and degraded in Mgat3 − / − cells on oxidative stress. It is known that BACE1 degradation is regulated by a cytosolic protein GGA3 and that GGA3 is down-regulated on traumatic brain injury together with BACE1 up-regulation [31,37]. As bisected glycans on BACE1 are located on the luminal side, there is probably an unknown molecule that recognizes BACE1 N-glycans and regulates BACE1 lysosomal transport. It is possible that loss of bisecting GlcNAc might affect biosynthesis of other parts of the glycan, because it has been shown that bisecting GlcNAc could affect activity of other glycosyltransferases such as GnT-IV, GnT-V and α 3 GalT [38,39], and there is speculation that loss of a single glycan might induce up-regulation of other glycans as a compensation mechanism. Furthermore, the presence of bisecting GlcNAc could also have an impact on overall glyan conformation [40,41]. Therefore, it is still possible that loss or gain of bisecting GlcNAc might indirectly regulate BACE1 expression through other parts of the glycan. Although we are now searching for a novel intracellular lectin-like molecule that recognizes bisecting GlcNAc, a physical mechanism has not so far been clarified by which bisecting c 2016 Authors; published by Portland Press Limited
Figure 5 brain
Injury-mediated BACE1 induction is suppressed in the Mgat3 − / −
(A) Mgat3 + / + or Mgat3 − / − mice (10–16 weeks old) were subjected to brain injury and killed 24 h post-injury. Brain sections were immunostained for BACE1 and an astroglial marker glial fibrillary acidic protein (GFAP). The results for contralateral cortex (left) and ipsilateral cortex (right) are shown. Asterisks indicate an injured area (scale bar = 100 μm). (B) At 24 h post-injury, the ipsilateral cortices of Mgat3 + / + mice were double stained for BACE1 and a cell marker (βIII-tubulin for neurons or GFAP for astrocytes) (scale bar = 10 μm). (C, D) Magnified images for areas in the proximity of an injured region are shown (scale bar = 50 μm). Signal intensity of BACE1 in (C) was quantified (D). The graph shows means + − S.E.M.s (n = 3, **P < 0.05, Student’s t -test).
GlcNAc itself directly regulates a functional property of its carrier protein. Recent advances in redox biology revealed that elevation in H2 O2 levels will signal in cells as well as dampen macromolecule functions by oxidation [42]. Although the molecular mechanism explaining how glycans regulate BACE1 expression on H2 O2 treatment is unclear at present, it might involve oxidation of the cysteine residues of a BACE1 modulator or its transcriptional regulation. How a bisecting GlcNAc on BACE1 is involved in
Bisecting GlcNAc regulates stress-induced BACE1 expression
29
appreciate the technical help for brain injury experiments from Drs Hajime Hirase and Yoshiaki Shinohara (RIKEN BSI).
FUNDING This work was supported by RIKEN (the Systems Glycobiology Research project to N.T., Special Postdoctoral Researchers Program to Y.K. and Incentive Research Grant to Y.K.) and by the Japan Society for the Promotion of Science (Grant-in-Aid for Challenging Exploratory Research to Y.K. [26670148] and to N.T. [15K14481], Grant-in-Aid for Scientific Research (B) to N.T. [15H04700], and Grant-in-Aid for Scientific Research on Innovative Areas to Y.K. [26110723] and S.K. [26117522]).
REFERENCES
Figure 6
Schematic model for the present study
+/+
In Mgat3 cells, bisecting GlcNAc is expressed on BACE1 N -glycans. BACE1 expression is induced by cellular oxidative stress, leading to enhanced Aβ generation, creating a vicious cycle. In Mgat3 − / − cells, bisecting GlcNAc is lost on BACE1. On oxidative stress, more BACE1 is transported to lysosomes and then degraded.
stress-mediated regulation of BACE1 protein would be a difficult but fascinating future study. It was previously reported that GnT-III expression is transcriptionally up-regulated in phagocytic cells after Aβ treatment [43], although the roles of bisecting GlcNAc in Aβ clearance by phagocytosis in vivo remain to be elucidated. Even though we could not observe a significant increase of GnT-III mRNA in MEFs under oxidative stress conditions, we recently reported that GnT-III is up-regulated together with an increase in a key antioxidant transcriptional factor, Nrf2, in MEFs lacking core fucose, a widely distributed core structure in N-glycans [20]. These results suggest that GnT-III, and its product bisecting GlcNAc, respond to oxidative stress and may function to help cells adapt to this stress. As the role of glycans in redox signalling or oxidative stress has not been clarified to date, it would be interesting to investigate what kinds of glycans are up- or downregulated on cellular oxidative stress, and how these glycan changes are functionally involved in the adaptation to stress.
AUTHOR CONTRIBUTION Yasuhiko Kizuka, Shinobu Kitazume and Naoyuki Taniguchi designed the research and wrote the manuscript. Yasuhiko Kizuka performed all the biochemical experiments. Miyako Nakano carried out MS analysis. Yasuhiko Kizuka, Miyako Nakano, Shinobu Kitazume, Takashi Saito, Takaomi Saido and Naoyuki Taniguchi interpreted the data.
ACKNOWLEDGEMENTS We thank Ms Reiko Fujinawa and Keiko Sato (RIKEN GRC) for technical help. We also thank Dr Jamey D. Marth (University of California–Santa Barbara) for kindly providing Mgat3 − / − mice. We appreciate the various discussions with Nobuhisa Iwata (Nagasaki University), Shigeo Murayama and Tamao Endo (Tokyo Metropolitan Institute of Gerontology), Yasuhiro Hashimoto (Fukushima Medical University) and Yoshiki Yamaguchi (RIKEN GRC). We
1 Selkoe, D.J. (2011) Resolving controversies on the path to Alzheimer’s therapeutics. Nat. Med. 17, 1060–1065 CrossRef PubMed 2 Abbott, A. (2011) Dementia: a problem for our age. Nature 475, S2–S4 CrossRef PubMed 3 O’Brien, R.J. and Wong, P.C. (2011) Amyloid precursor protein processing and Alzheimer’s disease. Annu. Rev. Neurosci. 34, 185–204 CrossRef PubMed 4 Karran, E., Mercken, M. and De Strooper, B. (2011) The amyloid cascade hypothesis for Alzheimer’s disease: an appraisal for the development of therapeutics. Nat. Rev. Drug Discov. 10, 698–712 CrossRef PubMed 5 Vassar, R., Kuhn, P.H., Haass, C., Kennedy, M.E., Rajendran, L., Wong, P.C. and Lichtenthaler, S.F. (2014) Function, therapeutic potential and cell biology of BACE proteases: current status and future prospects. J. Neurochem. 130, 4–28 CrossRef PubMed 6 Yang, L.B., Lindholm, K., Yan, R., Citron, M., Xia, W., Yang, X.L., Beach, T., Sue, L., Wong, P., Price, D. et al. (2003) Elevated beta-secretase expression and enzymatic activity detected in sporadic Alzheimer disease. Nat. Med. 9, 3–4 CrossRef PubMed 7 Loane, D.J., Pocivavsek, A., Moussa, C.E., Thompson, R., Matsuoka, Y., Faden, A.I., Rebeck, G.W. and Burns, M.P. (2009) Amyloid precursor protein secretases as therapeutic targets for traumatic brain injury. Nat. Med. 15, 377–379 CrossRef PubMed 8 Kandalepas, P.C., Sadleir, K.R., Eimer, W.A., Zhao, J., Nicholson, D.A. and Vassar, R. (2013) The Alzheimer’s beta-secretase BACE1 localizes to normal presynaptic terminals and to dystrophic presynaptic terminals surrounding amyloid plaques. Acta Neuropathol. 126, 329–352 CrossRef PubMed 9 Kao, S.C., Krichevsky, A.M., Kosik, K.S. and Tsai, L. H. (2004) BACE1 suppression by RNA interference in primary cortical neurons. J. Biol. Chem. 279, 1942–1949 CrossRef PubMed 10 Lu, T., Pan, Y., Kao, S.Y., Li, C., Kohane, I., Chan, J. and Yankner, B.A. (2004) Gene regulation and DNA damage in the ageing human brain. Nature 429, 883–891 CrossRef PubMed 11 Mohmmad Abdul, H., Sultana, R., Keller, J.N., St Clair, D.K., Markesbery, W.R. and Butterfield, D.A. (2006) Mutations in amyloid precursor protein and presenilin-1 genes increase the basal oxidative stress in murine neuronal cells and lead to increased sensitivity to oxidative stress mediated by amyloid beta-peptide (1–42), HO and kainic acid: implications for Alzheimer’s disease. J. Neurochem. 96, 1322–1335 CrossRef PubMed 12 Bains, M. and Hall, E.D. (2012) Antioxidant therapies in traumatic brain and spinal cord injury. Biochim. Biophys. Acta 1822, 675–684 CrossRef PubMed 13 Guglielmotto, M., Aragno, M., Autelli, R., Giliberto, L., Novo, E., Colombatto, S., Danni, O., Parola, M., Smith, M.A., Perry, G. et al. (2009) The up-regulation of BACE1 mediated by hypoxia and ischemic injury: role of oxidative stress and HIF1alpha. J. Neurochem. 108, 1045–1056 CrossRef PubMed 14 Tan, J.L., Li, Q.X., Ciccotosto, G.D., Crouch, P.J., Culvenor, J.G., White, A.R. and Evin, G. (2013) Mild oxidative stress induces redistribution of BACE1 in non-apoptotic conditions and promotes the amyloidogenic processing of Alzheimer’s disease amyloid precursor protein. PLoS One 8, e61246 CrossRef PubMed 15 Sadleir, K.R. and Vassar, R. (2012) Cdk5 protein inhibition and Abeta42 increase BACE1 protein level in primary neurons by a post-transcriptional mechanism: implications of CDK5 as a therapeutic target for Alzheimer disease. J. Biol. Chem. 287, 7224–7235 CrossRef PubMed 16 Kizuka, Y., Kitazume, S., Fujinawa, R., Saito, T., Iwata, N., Saido, T.C., Nakano, M., Yamaguchi, Y., Hashimoto, Y., Staufenbiel, M. et al. (2015) An aberrant sugar modification of BACE1 blocks its lysosomal targeting in Alzheimer’s disease. EMBO Mol. Med. 7, 175–189 CrossRef PubMed 17 Taniguchi, N., Miyoshi, E., Gu, J., Honke, K. and Matsumoto, A. (2006) Decoding sugar functions by identifying target glycoproteins. Curr. Opin. Struct. Biol. 16, 561–566 CrossRef PubMed c 2016 Authors; published by Portland Press Limited
30
Y. Kizuka and others
18 Miyoshi, E., Uozumi, N., Noda, K., Hayashi, N., Hori, M. and Taniguchi, N. (1997) Expression of alpha1–6 fucosyltransferase in rat tissues and human cancer cell lines. Int. J. Cancer 72, 1117–1121 CrossRef PubMed 19 Akasaka-Manya, K., Manya, H., Sakurai, Y., Wojczyk, B.S., Kozutsumi, Y., Saito, Y., Taniguchi, N., Murayama, S., Spitalnik, S.L. and Endo, T. (2010) Protective effect of N -glycan bisecting GlcNAc residues on beta-amyloid production in Alzheimer’s disease. Glycobiology 20, 99–106 CrossRef PubMed 20 Kurimoto, A., Kitazume, S., Kizuka, Y., Nakajima, K., Oka, R., Fujinawa, R., Korekane, H., Yamaguchi, Y., Wada, Y. and Taniguchi, N. (2014) The absence of core fucose up-regulates GnT-III and Wnt target genes: a possible mechanism for an adaptive response in terms of glycan function. J. Biol. Chem. 289, 11704–11714 CrossRef PubMed 21 Priatel, J.J., Sarkar, M., Schachter, H. and Marth, J.D. (1997) Isolation, characterization and inactivation of the mouse Mgat3 gene: the bisecting N -acetylglucosamine in asparagine-linked oligosaccharides appears dispensable for viability and reproduction. Glycobiology 7, 45–56 CrossRef PubMed 22 Saito, T., Matsuba, Y., Mihira, N., Takano, J., Nilsson, P., Itohara, S., Iwata, N. and Saido, T.C. (2014) Single App knock-in mouse models of Alzheimer’s disease. Nat. Neurosci. 17, 661–663 CrossRef PubMed 23 Kitazume, S., Tachida, Y., Oka, R., Shirotani, K., Saido, T.C. and Hashimoto, Y. (2001) Alzheimer’s beta-secretase, beta-site amyloid precursor protein-cleaving enzyme, is responsible for cleavage secretion of a Golgi-resident sialyltransferase. Proc. Natl. Acad. Sci. U.S.A. 98, 13554–13559 CrossRef PubMed 24 Nakano, M., Nakagawa, T., Ito, T., Kitada, T., Hijioka, T., Kasahara, A., Tajiri, M., Wada, Y., Taniguchi, N. and Miyoshi, E. (2008) Site-specific analysis of N -glycans on haptoglobin in sera of patients with pancreatic cancer: a novel approach for the development of tumor markers. Int. J. Cancer. 122, 2301–2309 CrossRef PubMed 25 Nakano, M., Saldanha, R., Gobel, A., Kavallaris, M. and Packer, N.H. (2011) Identification of glycan structure alterations on cell membrane proteins in desoxyepothilone B resistant leukemia cells. Mol. Cell Proteomics 10, M111.009001 CrossRef PubMed 26 Mouton-Liger, F., Paquet, C., Dumurgier, J., Bouras, C., Pradier, L., Gray, F. and Hugon, J. (2012) Oxidative stress increases BACE1 protein levels through activation of the PKR-eIF2alpha pathway. Biochim. Biophys. Acta 1822, 885–896 CrossRef PubMed 27 Zhang, X.M., Cai, Y., Xiong, K., Cai, H., Luo, X.G., Feng, J.C., Clough, R.W., Struble, R.G., Patrylo, P.R. and Yan, X.X. (2009) Beta-secretase-1 elevation in transgenic mouse models of Alzheimer’s disease is associated with synaptic/axonal pathology and amyloidogenesis: implications for neuritic plaque development. Eur. J. Neurosci. 30, 2271–2283 CrossRef PubMed 28 Cummings, R.D. and Kornfeld, S. (1982) Characterization of the structural determinants required for the high affinity interaction of asparagine-linked oligosaccharides with immobilized Phaseolus vulgaris leukoagglutinating and erythroagglutinating lectins. J. Biol. Chem. 257, 11230–11234 PubMed 29 Parrinello, S., Samper, E., Krtolica, A., Goldstein, J., Melov, S. and Campisi, J. (2003) Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat. Cell Biol. 5, 741–747 CrossRef PubMed Received 17 June 2015/13 October 2015; accepted 14 October 2015 Accepted Manuscript online 14 October 2015, doi:10.1042/BJ20150607
c 2016 Authors; published by Portland Press Limited
30 Koh, Y.H., von Arnim, C.A., Hyman, B.T., Tanzi, R.E. and Tesco, G. (2005) BACE is degraded via the lysosomal pathway. J. Biol. Chem. 280, 32499–32504 CrossRef PubMed 31 Walker, K.R., Kang, E.L., Whalen, M.J., Shen, Y. and Tesco, G. (2012) Depletion of GGA1 and GGA3 mediates postinjury elevation of BACE1. J. Neurosci. 32, 10423–10437 CrossRef PubMed 32 Tesco, G., Koh, Y.H., Kang, E.L., Cameron, A.N., Das, S., Sena-Esteves, M., Hiltunen, M., Yang, S.H., Zhong, Z., Shen, Y. et al. (2007) Depletion of GGA3 stabilizes BACE and enhances beta-secretase activity. Neuron 54, 721–737 CrossRef PubMed 33 Mustafa, A.G., Singh, I.N., Wang, J., Carrico, K.M. and Hall, E.D. (2010) Mitochondrial protection after traumatic brain injury by scavenging lipid peroxyl radicals. J. Neurochem. 114, 271–280 PubMed 34 Tamagno, E., Guglielmotto, M., Aragno, M., Borghi, R., Autelli, R., Giliberto, L., Muraca, G., Danni, O., Zhu, X., Smith, M.A. et al. (2008) Oxidative stress activates a positive feedback between the gamma- and beta-secretase cleavages of the beta-amyloid precursor protein. J. Neurochem. 104, 683–695 PubMed 35 von Bernhardi, R. and Eugenin, J. (2012) Alzheimer’s disease: redox dysregulation as a common denominator for diverse pathogenic mechanisms. Antioxid. Redox Signal. 16, 974–1031 CrossRef PubMed 36 Sivanandam, T.M. and Thakur, M.K. (2012) Traumatic brain injury: a risk factor for Alzheimer’s disease. Neurosci. Biobehav. Rev. 36, 1376–1381 CrossRef PubMed 37 Kang, E.L., Cameron, A.N., Piazza, F., Walker, K.R. and Tesco, G. (2010) Ubiquitin regulates GGA3-mediated degradation of BACE1. J. Biol. Chem. 285, 24108–24119 CrossRef PubMed 38 Zhao, Y., Sato, Y., Isaji, T., Fukuda, T., Matsumoto, A., Miyoshi, E., Gu, J. and Taniguchi, N. (2008) Branched N -glycans regulate the biological functions of integrins and cadherins. FEBS J. 275, 1939–1948 CrossRef PubMed 39 Taniguchi, N. and Korekane, H. (2011) Branched N -glycans and their implications for cell adhesion, signaling and clinical applications for cancer biomarkers and in therapeutics. BMB Rep. 44, 772–781 CrossRef PubMed 40 Nishima, W., Miyashita, N., Yamaguchi, Y., Sugita, Y. and Re, S. (2012) Effect of bisecting GlcNAc and core fucosylation on conformational properties of biantennary complex-type N -glycans in solution. J. Phys. Chem. B 116, 8504–8512 CrossRef PubMed 41 Re, S., Miyashita, N., Yamaguchi, Y. and Sugita, Y. (2011) Structural diversity and changes in conformational equilibria of biantennary complex-type N -glycans in water revealed by replica-exchange molecular dynamics simulation. Biophys. J. 101, L44–46 CrossRef PubMed 42 Schieber, M. and Chandel, N.S. (2014) ROS function in redox signaling and oxidative stress. Curr. Biol. 24, R453–462 CrossRef PubMed 43 Fiala, M., Liu, P.T., Espinosa-Jeffrey, A., Rosenthal, M. J., Bernard, G., Ringman, J.M., Sayre, J., Zhang, L., Zaghi, J., Dejbakhsh, S. et al. (2007) Innate immunity and transcription of MGAT-III and Toll-like receptors in Alzheimer’s disease patients are improved by bisdemethoxycurcumin. Proc. Natl. Acad. Sci. U.S.A. 104, 12849–12854 CrossRef PubMed
