Mol Biotechnol DOI 10.1007/s12033-015-9858-1

RESEARCH

Biosynthesis of Resveratrol in Blastospore of the Macrofungus Tremella fuciformis LinZhi Kang1,2,3 • Qiongjie Li1,2,3 • JunFang Lin1,2,3 • LiQiong Guo1,2,3

Ó Springer Science+Business Media New York 2015

Abstract Tremella fuciformis is a known edible macrofungus that has medicinal value. It is widely cultivated in China and its products are distributed worldwide. In this study, a novel bioconversion system was established to produce resveratrol in the blastospore of T. fuciformis (bTf). The expression vector ptro1-4cl-rs that contains 4-coumarate:coenzyme A ligase gene (4cl) and resveratrol synthase gene (rs) was transformed into bTf by LiAc/PEG-mediated transformation. PCR and southern blotting analysis verified the successful integration of the exogenous 4cl and rs genes into the genome of bTf. HPLC analysis confirmed that two transformants can convert p-coumaric acid into resveratrol (0.92 and 0.83 lg/g resveratrol of dry weight within 7 days). This study is the first to report about the transformation and expression of resveratrol biosynthetic genes in bTf. This research is a significant step toward obtaining resveratrol-producing T. fuciformis strains, which not only satisfy the demand of resveratrol market, but also expand the category of functional food. Keywords Tremella fuciformis  Resveratrol  Blastospore  4-Coumarate:coenzyme A ligase  Resveratrol synthase

& LiQiong Guo [email protected]; [email protected] Qiongjie Li [email protected] 1

Department of Bioengineering, College of Food Science, South China Agricultural University, 482 Wushan Street Tianhe, Guangzhou 510640, China

2

China National Engineering Research Center of Juncao Technology, Fuzhou 350002, China

3

Institute of Biomass Research, South China Agricultural University, Guangzhou 510640, China

Introduction Resveratrol (3,5,40 -trihydroxy-trans-stilbene) is a polyphenolic compound that belongs to the stilbene class and is commonly found in red wine, bushberries, peanuts, cranberries, other vine plants, and even trees and ferns [1]. Resveratrol is speculated to cause a decreased risk of heart diseases and diabetes. Often called the ‘‘French paradox,’’ the high intake of saturated fat, affected by levels of radical scavengers such as resveratrol, has been shown to correlate with a low mortality rate [2, 3]. Resveratrol may have additional health benefits, given that numerous studies have found that it exhibits antioxidant, anti-inflammatory, antitumor, and estrogenic activities, as well as chemopreventive abilities [4, 5]. The most interesting activity attributed to resveratrol may be its ability to slow the aging process and prolong life spans, as shown in studies on a variety of evolutionarily distant species, including mice and vertebrate fish [6, 7]. In view of the described valuable properties, resveratrol is promising compound for health food supplement. Owing to its beneficial properties, the biotechnological production of resveratrol in microorganisms has attracted increasing industrial interest. Although great effort has been given to the biosynthesis of stilbene with the use of microorganisms, genes that are responsible for trans-resveratrol biosynthesis have not been found in microorganisms [8, 9]. Resveratrol biosynthesis branches from the phenylpropanoid pathway in certain plant species (Fig. 1). As an intermediate, p-coumaric acid is converted into p-coumaroyl-CoA by 4-coumarate:coenzyme A ligase (4CL). Subsequently, resveratrol synthase (RS) catalyzes the condensation of resveratrol from one molecule of 4-coumaroyl-CoA and three molecules of malonyl-CoA, which is involved in fatty acid biosynthesis. Thus, microorganisms

123

Mol Biotechnol Fig. 1 Biosynthetic pathway of resveratrol in specific plants. The names of the key enzymes are abbreviated as follows: PAL phenylalanine ammonia lyase, TAL tyrosine ammonia lyase, C4H cinnamic acid 4-hydroxylase, 4CL 4-coumarate:coenzyme A ligase, RS resveratrol synthase

can produce resveratrol by introducing two specific genes of 4CL and RS from the stilbene pathway and using p-coumaric acid as a starting precursor [8–10]. However, Escherichia coli are unable to complete the post-translational modifications of some proteins and it will be contain endotoxin [11]. Yeast is a lowest eukaryotic organism, which usually produces hyper-glycosylation-modified expression proteins [12, 13]. Thus, a novel higher eukaryotic organism should be investigated as expression host. Tremella fuciformis, generally called ‘white jelly mushroom’ or ‘silver ear,’ belongs to phylum Eumycota, subphylum Basidiomycotina. The nutritional and medicinal values of T. fuciformis are well known. It is widely cultivated in China and its products are distributed worldwide.

123

The blastospore of T. fuciformis (bTf) is a kind of asexual spore produced in asexual reproductive stage of the fungus and bTf is monokaryotic and easy to culture by submerged fermentation [14]. In a previous work, an endogenesis gpd-Tf promoter has been cloned from bTf [15]. In addition, the hygromycin resistance gene (hph), the green fluorescent protein gene (gfp), and the VHb genes have been transformed in bTf and expressed successfully [11, 16, 17]. As such, we could infer that bTf is a good recipient cell for exogenous gene expression as it possesses a complete post-translational modification system of protein. Many studies have reported about the compounds that comprise bTf, which show health aiding effects [18–20]. In particular, the polysaccharide

Mol Biotechnol

fraction composed of acidic and neutral heteroglycans has several pharmacological activities [21, 22], such as enhancing host immune functions [23] and antitumor activity [24, 25]. Massive production of these active ingredients necessitates large-scale production of bTf. At present, many products of basidiospore fermentation such as drinks and food additive agent are commercially available. Therefore, bTf as a host to produce health food supplement resveratrol is safe and easy to handle. In this work, the eukaryotic expression vector ptro1-4clrs containing the endogenous gpd-Tf promoters from T. fuciformis, 4CL, and RS gene from Vitis vinifera was successfully constructed and transformed into bTf by PEGmediated transformation. This study is the first to report on resveratrol biosynthesis in bTf. Heterologous expression of 4cl and rs genes in bTf represents a valuable step toward bioengineering production of resveratrol and provides more functional products, including resveratrol. Furthermore, such expression is significant in expanding the category of functional food.

number JN858959) and rs gene (GenBank accession number JN858961) from V. vinifera] were conserved in our laboratory (Fig. 2).

Materials and Methods

Pretreatment of Yeast-like Conidia of T. fuciformis

Strains and Vectors

A single colony of bTf was inoculated in PDB liquid medium (PDA medium removed agar) at 25 °C for 5 days on a rotary shaker at 1509g. The cells were harvested by centrifugation at 40009g for 5 min until the cell density reached OD600 of 10.0, and then washed twice with 0.1 mol/l Lithium Acetate (LiAc). The cells were then suspended in 20 ml of 0.1 mol/l LiAc and incubated in water bath at 25 °C for 30 min. Afterward, the cells were gathered by centrifugation and resuspended in 0.1 mol/l LiAc containing 15 % glycerol to attain 1.0 9 107 cells per milliliter. Then, 80 ll sample was pipetted into a 1.5 ml eppendorf tube, one tube for each transformation.

Tremella fuciformis strain Tro1 was purchased from the Gutian Edible Mushroom Institute (Gutian, Fujian Province, China) and maintained on PDA slant (20 % extract of boiled potato, 2 % glucose, 0.3 % KH2PO4, 0.15 % MgSO47H2O, agar 1.5 %, and H2O 1 L). The expression plasmid pgfvs-hph (containing the selectable marker gene hph conferring resistance to hygromycin B derived from E. coli and gpd-fvs promoter from F. velutipes) and the expression vector ptro1-4cl-rs [containing the gpd-Tf promoter from T. fuciformis and 4cl gene (GenBank accession

Enzymes and Reagents Taq DNA polymerase, DNA Purification Kit, and dNTPs were purchased from Shanghai Sangon Biotechnology Company (Shanghai, China). The restriction endonuclease Spe I and BsrG I were products of New England Biolabs Ltd. (Beijing, China). Digoxigenin (DIG) High Prime DNA Labeling and Detection Starter Kit was acquired from Roche Company (Mannheim, Germany). The primers were synthesized from Shanghai Sangon Biotechnology Company (Shanghai, China). All other reagents were analytically pure. Plasmid DNA was isolated from E. coli DH5a using the QIAgen MiniPrep kit (QIAgen, Mississauga, Ontario, Canada). Trans-resveratrol standard was purchased from Sigma Chemical Company (St. Louis, USA).

Fig. 2 Schematic diagram of the construction of pgFvs-hph (a) and ptro1-4cl-rs (b). hph gene from S. hygroscopicus in the plasmid pgFvs-hph (in a) with the gpd promoter from Flammulina velutipes (gpd-fvs) and 4cl and rs genes from Vitis vinifera in the plasmid ptro14cl-rs (in a) with the one gpd promoter from Tremella fuciformis (gpd-tro1)

123

Mol Biotechnol

Co-transformation of Yeast-Like Conidia of T. fuciformis For co-transformation reactions, two plasmids ptro1-4cl-rs (1 lg) and pgfvs-hph (1 lg) were added into one transformation tube, mixed gently, and chilled immediately in an ice bath for 15 min. Then, 20 ll PEG buffer (25 % PEG-4000, 50 mM CaCl2, 10 mM Tris–HCl, pH 7.5, filter sterilized) was added into a tube. After 5 min, 1 mL PEG buffer was added and then the tubes were incubated in water bath at 25 °C for 60 min. After a heat shock at 40 °C for 20 min, the cells were harvested by centrifugation at 30009g for 15 min and resuspended in 1 ml of RM liquid medium (the sucrose concentration is 0.6 mol/l in PDB medium)with 30 lg/ml hygromycin Band spread onto RM plates containing 50 lg ml-1 hygromycin. A negative control tube was prepared in the same way but without plasmid. The primary putative transformants were obtained from the RM plates after incubation at 25 °C for 7 days. Screening of Putative Transformants After co-transformation of bTf, the colonies growing on selective RM plates containing 50 lg/ml hygromycin were considered primary putative transformants. All primary colonies were transferred onto PDA plates containing 100 lg/ml hygromycin to reduce false-positive colonies. The colonies that were able to grow on plates with high concentration of hygromycin were considered putative transformants and further identified. Characterization of Putative Transformants Characterization of Putative Transformants by PCR Genomic DNA was extracted from the putative transformants and control strain, respectively, in accordance with the method previously described by Lin et al. [26], and used as templates for PCR analysis. The primers for detection of 4cl gene and rs gene were designed based on the sequences 4cl and rs genes. The forward primer of 4cl gene 4s-1 was 50 - AGGTTTCACCGTCATTACCA -30 and the reverse primer 4s-2 was 50 - CCTCGGGATCGTTCAAGTA -30 . The forward primer of rs gene rs2-1 was 50 - TGAAA CATCGGTTAGAAGG -30 , and the reverse primer rs2-2 was 50 - CACAACGGTCTCAATGGTC -30 ; the predicted PCR products were 779 bp and 700 bp, respectively. The PCR amplification protocols consisted of an initial denaturing step of 5 min at 94 °C, followed by 33 cycles with 45 s of denaturation at 94 °C, 40 s of annealing at 47 °C, 55 s of elongation at 72 °C, and then a post-elongation step of 10 min at 72 °C, and a hold at 4 °C.

123

Southern Blotting Analysis Genomic DNA (20 lg) from each putative transformants (transformants were used after 5 generations of sub-cultivation) and the non-transformed Tro1 blastospores (negative control) was digested with Hind III overnight and separated on 1 % agarose gel. Plasmid ptro1-4cl-rs (50 pg) was also digested with Hind III and separated on the agarose gel as positive control. DNA transfer and blotting, probe labeling, pre-hybridization and hybridization, washing, and exposure were performed under conditions following the method mentioned by Ausubel et al. [27] and the instruction manual for the DIG hybridization system by Roche (Mannheim, Germany). Resveratrol Fermentation A shaking flask fermentation (25 °C, 1509g) of the engineered strain Tro1 carrying the 4cl and rs genes in PDB liquid medium supplemented with 0.1 mmol/l p-coumarate was performed. After 7 days, the cells were collected by centrifugation and ground in liquid nitrogen with mortar and pestle. The powder was extracted with ethyl acetate (m/v: 1/25) under shaking at 40 °C; three replicates were made. Extraction liquid was centrifuged at 90009g for 10 min and the supernatants were combined, and then evaporated in vacuo at 40 °C. Residues were resuspended in 1 ml methanol and filtered by 0.22 lm microporous membrane for HPLC analysis. HPLC Analysis The extracts were analyzed on a HPLC system using a phenomenex C18 (5 lm, 250 9 4.6 mm) column. Samples were separated using a 25 min linear gradient from 95 % water/5 % acetonitrile to 30 % water/70 % acetonitrile at a flow rate of 0.9 ml/min. The metabolites were first confirmed by retention time and UV absorption at 306 nm.

Results Screening of Transformants The primary putative transformants that grew on PDA plates containing 50 lg/ml hygromycin were transferred on PDA plates containing 100 lg/ml hygromycin (Fig. 3). The results showed that 70 % of the primary putative transformants could continue to grow on PDA plates containing 100 lg/ml hygromycin, suggesting that the level of foreign gene expression considerably varies in different transformants. The transformants cannot grow at high concentration of hygromycin until the foreign genes were stably expressed in their cells, which is

Mol Biotechnol

extracted as PCR templates. The detection of 4cl and rs genes was conducted using primers 4 s-1/4s-2 and rs2-1/ rs2-2. The results (Fig. 4) showed that five out of nine putative transformants had an amplification band of approximately 700 bp, which is equivalent to the expected rs gene fragment in size, and an amplification band of approximately 779 bp, which is equivalent to the expected 4cl gene fragment in size. Thus, both the rs gene and the 4cl gene were transferred into these putative transformants. Southern Blotting Analysis

Fig. 3 Colonies of bTf growing on PDA plates containing 100 lg/ mL hygromycin

probably due to the different integration sites of foreign genes in the genome of the host cells [28–30]. Characterization of Putative Transformants by PCR Nine putative transformants and the control strain were randomly selected, from which the genomic DNA was

Genomic DNA from the five putative transformants with positive PCR results was subjected to Southern blotting using the 4cl and rs genes as the probe. Four out of the five transformants (Fig. 5a, b, lanes 4, 5, 6, 7) and the positive control plasmid (Fig. 5a, b, lane 2) show hybridization bands, which indicate the presence of the 4cl and rs genes in the genomes of these four transformants. No specific hybridization signal was found in the remaining one putative transformant and the nontransformed host strain (Fig. 5a, b, lanes 3, 8), suggesting the absence of the 4cl and rs genes in these genomes. These results indicate that 4cl and rs genes were transformed into bTf but cannot be stably inherited and that the genes cannot be integrated in the genomes of lane 8 transformant. By analysis of the hybridization bands, signal intensities, and the site of integration, the foreign 4cl gene was

Fig. 4 PCR amplification products of putative transformants. a Transformants of plasmid ptro1-4cl-rs with primers 4s-1/4s-2, M DNA marker III, a 1–9, transformants, - control, ? ptro1-4cl-rs. b Transformants of plasmid ptro1-4cl-rs with primers rs2-1/ rs2-2, M DNA marker III, 1–5 transformants, - control, ? ptro1-4cl-rs

123

Mol Biotechnol

integrated randomly into the chromosome DNA of all of the transformants with single signal, whereas the rs gene was integrated randomly into the chromosome DNA of most of the transformants with single signal, except one that was integrated with double signals (Fig. 5b, lane 6).The variation in the copy numbers and position of 4cl and rs genes among transformants indicated that the integration of genes was a random event and might occur by non-homologous recombination. DNA isolated from negative control strain did not hybridize with the 4cl and rs probe. The results indicate that the 4cl and rs genes were successfully integrated into the genome of T. fuciformis.

Fig. 7 HPLC analysis of resveratrol produced by recombinant bTf. c a Standard trans-resveratrol, b fermentation product of transformants T-1, c fermentation product of transformants T-3, d fermentation product of control strain

Genetic Stability of Transformants of bTf After five generations of sub-cultivation in PDB liquid medium, the transformants were able to grow well on PDA plates containing 100 lg l-1 hygromycin (data not shown). Thus, the hygromycin resistance of these transformants was stable and hereditable. PCR detection of 4cl and rs genes was performed with these transformants after five

The retention time of standard resveratrol was 18.132 min (Fig. 7a, indicate by an arrow). As shown in Fig. 7b, a peak was detected at nearly the same retention time as transresveratrol standard (18.117 min), indicating that T-1 transformant produced 0.92 lg/g resveratrol of dry weight when cultured with 1 mmol/l p-coumarate. In addition, peak at 18.123 min suggested that the T-3 transformant that was cultured the same way produced 0.83 lg/g of dry weight

Fig. 5 Southern blot hybridization analyses of DNA isolated from putative bTf transformants (PCR positive for 4cl and rs). Genomic DNA (approximately 15 lg) was isolated, digested with HindIII, and probed with DIG-labeled 4cl and rs gene sequence (a and b, respectively). a and b Lane 1 DNA molecular size markers

(kilobases), Lane 2 DNA isolated from plasmid ptro1-4cl-rs as positive control, Lane 3 negative control of wild type genomic DNA of bTf, Lanes 4–8 HindIII-digested genomic DNA of putative transformants (4, 5, 6, 7, and 8, respectively) was probed with the DIG-labeled rs and 4cl sequence

Fig. 6 PCR amplification products of putative transformants. a Transformants of plasmid ptro1-4cl-rs with primers rs2-1/rs2-2, M DNA marker III, a 1–5, transformants. b Transformants of plasmid ptro1-4cl-rs with primers 4s-1/ 4s-2. M DNA marker III, 1–5, transformants

123

generations of sub-cultivations. The results (Fig. 6) showed amplified bands that are equivalent to the expected 4cl and rs gene fragments in all lanes (799 and 700 bp, respectively), which further confirmed that the foreign genes were stable in the bTf by budding for generations. HPLC Analysis

Mol Biotechnol

123

Mol Biotechnol

resveratrol (Fig. 7c, indicated by an arrow). No resveratrol peak was found in the HPLC chromatograms of the other two transformants. As negative control, no resveratrol peak was found in the HPLC chromatogram of strain Tro1 (Fig. 7d). These results show that both 4CL and RS genes were successfully expressed to proper functional enzymes that converted p-coumaric acid into resveratrol in T-1 and T-3 transformants.

Discussion Resveratrol bioproduction has attracted considerable attention to understand the molecular mechanisms of resveratrol biosynthesis and to broaden its potential applications for human benefit. The resveratrol metabolic pathway comprises four steps, starting from phenylalanine to resveratrol, which are catalyzed by the enzymes PAL, C4H, 4CL, and STS. PAL and STS are two key enzymes involved, and their gene expression and activities have been shown to be enhanced in response to elicitation [31]. Previous efforts to engineer recombinant microbes for stilbene biosynthesis focused on the overexpression of pathway enzymes and diversification of the chemistry of stilbene compounds [32–34]. However, these studies lack sufficient understanding of resveratrol biosynthesis on the molecular level; for example, the catalytic turnover of the pathway enzymes as well as their transcription and translation efficiencies is largely determined by the employed gene expression system. A few enzyme combinations of 4cl and sts were subsequently selected for further optimization, including the gene expression system and strain background [1]. In the next research, we will focus on different 4cl and sts gene combinations to optimize and then improve the production of resveratrol. The production of resveratrol with the use of engineered microorganisms possesses many advantages over plants or plant cells, including higher growth rates and their wellestablished industrial fermentation technologies, and the synthesis of resveratrol has been found in microorganisms [1, 8, 9, 34–36]. A metabolically engineered E. coli (JM109 strain), which was transformed with the 4CL gene from Arabidopsis thaliana and the STS gene from Arachis hypogea, was able to convert 4-coumaric acid into resveratrol, producing a 100 mg/L yield [8]. When the same E. coli strain was modified with the 4CL gene from Lithospermum erythrorhizon and STS gene from A. hypogea and coumaroylCoA was used as a substrate, resveratrol production reached 171 mg/L [9]. Saccharomyces cerevisiae (CEN.PK113-3b strain) transformed with the 4CL gene from tobacco and the STS gene from grapevine produced 5.8 mg/L trans-resveratrol, which is the highest level of trans-resveratrol that has been obtained in yeast culture [10]. A variety of resveratrol-

123

producing plant species contain low resveratrol levels (up to 0.03 % dry wt.; not more than 5 mg/l of nutrient medium), and the treatment of the cultures with UV irradiation, elicitors, or other agents did not result in a considerable increase in resveratrol production [37–40]. Significant progress in increasing resveratrol content in plant cells has been reached (up to 5,027 mg/l) by transformation of grape cells with the root loci (rolC) gene of Agrobacterium rhizogenes [41] and treatment various plant cell cultures with cyclodextrins [42, 43]. By comparison, edible fungi are superior to other microorganisms as models for recombinant expression of functional and medicinal proteins because of their wide acceptance to consumers. Edible fungi have been utilized for the expression of exogenous genes, such as the antifreeze protein gene (afp) from the insect Choristoneura fumiferana in Volvariella volvacea [28], a multi-functional cellulase gene (mfc) from the animal Ampullaria crossean in Coprinopsis cinerea [29], a fungal immunomodulatory protein gene (fip-gsi) from Ganoderma sinense in C. cinerea [30], and gfp in Flammulina velutipes [44]. However, little effort has been made in the homologous expression of resveratrol in basidiomycetes. The bioproduction of resveratrol remains a considerable challenge in the bTf. Given that the stilbene pathway does not exist in T. fuciformis, the entire functional pathway needs to be introduced if biosynthesis of resveratrol is to be realized. In addition, the culture conditions should be optimized for high yield production. Given that resveratrol is mainly excreted, its purification can be easily performed using polar solvents such as ethyl acetate. A better knowledge of resveratrol excretion mechanisms through fungal cell wall might be helpful in enhancing production/ secretion in culture media. In our study, the yield is lower than that in other recent publications, but we obtained a new resveratrol-producing bTf strain that can have a large market that is similar to functional fungi. Moreover, many products of basidiospore fermentation such as drinks and food additives have more health benefits [6].

Conclusion In the present study, we report for the first time the homologous expression of resveratrol in bTf, which is widely acceptable and safe to consumers. The 4cl and rs genes were successfully transferred and expressed in bTf using LiCl/PEG-mediated transformation. Results showed that V. vinifera 4cl gene and rs gene had been integrated into the genome steadily, and they were expressed in two recombinant strains to produce resveratrol from p-coumarate. This study represents a substantial step toward establishing new T. fuciformis strains that can produce resveratrol.

Mol Biotechnol Acknowledgments This work was supported by the National Natural Science Foundation of China (Grant Nos. 31071837, 31272217, 31372116); the Projects of Science and Technology of Guangdong Province (Grant Nos. 2011B090400412, 2012B020316004, 2012A0 20100010, 2013B010404041), and China National Engineering Research Center of Juncao Technology.

16.

17.

References 1. Chin, G. L., Zachary, L. F., Thomas, H., Steffen, S., & Mattheos, A. G. K. (2011). High-yield resveratrol production in engineered Escherichia coli. Applied and Environmental Microbiology, 77, 3451–3460. 2. Bernard, F., Pierre, W., Francois, H., Laurence, B., Alain, D., & Jean-Michel, M. (1997). Comparative study of radical scavenger and antioxidant properties of phenolic compounds from Vitis vinifera cell cultures using in vitro tests. Life Sciences, 61, 2103–2110. 3. Renaud, S., & de Lorgeril, M. (1992). Wine, alcohol, platelets, and the French paradox for coronary heart disease. Lancet, 339, 1523–1526. 4. Bhat, K. P. L., Kosmeder, J. W., & Pezzuto, J. M. (2001). Biological effects of resveratrol. Antioxidants & Redox Signaling, 3, 1041–1064. 5. Jang, M., Cai, L., Udeani, G. O., Slowing, K. V., Thomas, C. F., Beecher, C. W., & Pezzuto, J. M. (1997). Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science, 275(5297), 218–220. 6. Baur, J. A., Pearson, K. J., Price, N. L., Jamieson, H. A., Lerin, C., Kalra, A., & Sinclair, D. A. (2006). Resveratrol improves health and survival of mice on a high-calorie diet. Nature, 444(7117), 337–342. 7. Wood, J. G., Rogina, B., Lavu, S., Howitz, K., Helfand, S. L., Tatar, M., & Sinclair, D. (2004). Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature, 430(7000), 686–689. 8. Watts, K. T., Lee, P. C., & Schmidt-Dannert, C. (2006). Biosynthesis of plant specific stilbene polyketides in metabolically engineered Escherichia coli. BMC Biotechnology, 6, 22. 9. Katsuyamal, Y., Funa, N., Miyahisa, I., & Horinouchi, S. (2007). Synthesis of unnatural flavonoids and stilbenes by exploiting the plant biosynthetic pathway in Escherichia coli. Chemistry & Biology, 14, 613–621. 10. Beekwilder, J., Wolswinkel, R., Jonker, H., Hall, R., de Vos, C. H. R., & Bovy, A. (2006). Production of resveratrol in recombinant microorganisms. Applied and Environment Microbiology, 72, 5670–5672. 11. Guo, L. Q., Liu, E. X., Wang, J., & Lin, J. F. (2009). Development of highly efficient transformation system of yeast-like conidia of Tremella fuciformis. Agricultural Sciences in China, 8(3), 268–275. 12. Reyes-Ruiz, J. M., & Barrera-Saldan˜a, H. A. (2006). Proteins in a DNA world: Expression systems for their study. Revista de investigacio´n clı´nica, 58(1), 47. 13. Schmidt, F. R. (2004). Recombinant expression systems in the pharmaceutical industry. Applied Microbiology and Biotechnology, 65(4), 363–372. 14. Cho, E. J., Chang, H. Y., & Yun, J. W. (2006). Production of exopolysaccharides by submerged mycelial culture of a mushroom Tremella fuciformis. Journal of Biotechnology, 127(1), 129–140. 15. Nie, Y. H., Lin, J. F., Wang, J., & Guo, L. Q. (2012). Isolation and functional analysis of a Gpd—Tf promoter from yeast like

18.

19.

20.

21.

22.

23.

24.

25.

26.

27. 28.

29.

30.

31.

conidia of Tremella fuciformi. Acta Edulis Fungi, 19(2), 1–7. (in Chinese). Guo, L. Q., Liu, Y., Zhao, S. X., Liu, E. X., & Lin, J. F. (2008). Highly efficient transformation of intact yeast-like conidia of Tremella fuciformis by electroporation. Science in China Series C Life Science, 51(10), 932–940. Zhu, H., Wang, T. W., Sun, S. J., Shen, Y. L., & Wei, D. Z. (2006). Chromosomal integration of the Vitreoscilla hemoglobin gene and its physiological actions in Tremella fuciformis. Applied Microbiology and Biotechnology, 72(4), 770–776. Lin, Z., Ma, J., Chai, B., Guan, H., & Yue, W. (1982). Studies on the pharmacology of Tremella fuciformis. Preliminary research on the fermented solution and polysaccharides of Tremella fuciformis spores. Journal of Traditional Chinese Medicine, 2, 95–98. Kiho, T., Tsujimura, Y., Sakushima, M., Usui, S., & Ukai, S. (1994). Polysaccharides in fungi. XXXIII. Hypoglycemic activity of an acidic polysaccharide (AC) from Tremella fuciformis. Yakugaku Zasshi, 114, 308–315. Japanese. Cheng, H., Hou, W., & Lu, M. (2002). Interactions of lipid metabolism and intestinal physiology with Tremella fuciformis berk edible mushroom in rats fed a high-cholesterol diet with or without Nebacitin. Journal of Agriculture and Food Chemistry, 50, 7438–7443. Gao, Q., Jiang, R., Chen, H., Jensen, E., & Seljelid, R. (1996). Characterization and cytokine stimulating activities of heteroglycans from Tremella fuciformis. Planta Medica, 62, 297–302. Gao, Q., Killie, M. K., Chen, H., Jiang, R., & Seljelid, R. (1997). Characterization and cytokine-stimulating activities of acidic heteroglycans from Tremella fuciformis. Planta Medica, 63, 457–460. Yang, F., & Xu, Q. (2002). The immunoloregulation of mushroom polysaccharides and Tremella polysaccharides for mouse loading tumor. Zhejiang Clin Med, J4, 730–731. Dong, Z., & Qu, M. (2004). Study on the cytotoxicity of splenocytes activated by IL-2 and Tremella polysaccharide to tumor cells in vitro. Journal of BeiHua University (Natural Science), 5, 506–508. Dong, Z., Wei, C., Qu, M., & Fan, Z. (2004). The study on the experiment of hepatocarcinoma with homogenous spleenocytes activated by IL-2 and Tremella Polysaccharide. Journal of BeiHua University (Natural Science), 20, 356–359. Lin, J. F., Zheng, M., Wang, J., Shu, W., & Guo, L. Q. (2008). Efficient transformation and expression of gfp gene in the edible mushroom Pleurotus nebrodensis. Progress in Natural Science, 18(7), 819–824. Ausubel, F., et al. (1995). Short protocols in molecular biology (3rd ed., pp. 228–244). New York: Wiley. Wang, J., Guo, L. Q., Zhang, K., Wu, Q., & Lin, J. F. (2008). Highly efficient Agrobacterium—mediated transformation of Volvariella volvacea. Bioresource Technology, 99(17), 8524–8527. Cheng, S. J., Yang, P. Z., Guo, L. Q., Lin, J. F., & Lou, N. N. (2009). Expression of multi-functional cellulase gene mfc in Coprinus cinereus under control of different basidiomycete promoters. Bioresource Technology, 100(19), 4475–4480. Han, F., Liu, Y., Guo, L. Q., Zeng, X. L., Liu, Z. M., & Lin, J. F. (2010). Heterologous expression of the immunomodulatory protein gene from Ganoderma sinense in the basidiomycete Coprinopsis cinerea. Journal of Applied Microbiology, 109(5), 1838–1844. Irie, T., Honda, Y., Hirano, T., Sato, T., Enei, H., Watanabe, T., & Kuwahara, M. (2001). Stable transformation of Pleurotus ostreatus to hygromycin B resistance using Lentinus edodes GPD expression signals. Applied Microbiology and Biotechnology, 56(5-6), 707–709.

123

Mol Biotechnol 32. Aggarwal, B. B., Bhardwaj, A., Aggarwal, R. S., Seeram, N. P., Shishodia, S., & Takada, Y. (2004). Role of resveratrol in prevention and therapy of cancer: Preclinical and clinical studies. Anticancer Research, 24(5A), 2783–2840. 33. Walle, T., Hsieh, F., DeLegge, M. H., Oatis, J. E., & Walle, U. K. (2004). High absorption but very low bioavailability of oral resveratrol in humans. Drug Metabolism and Disposition, 32(12), 1377–1382. 34. Becker, J. V., Armstrong, G. O., Merwe, M. J., Lambrechts, M. G., Vivier, M. A., & Pretorius, I. S. (2003). Metabolic engineering of Saccharomyces cerevisiae for the synthesis of the wine related antioxidant resveratrol. FEMS Yeast Research, 4(1), 79–85. 35. Trantas, E., Panopoulos, N., & Ververidis, F. (2009). Metabolic engineering of the complete pathway leading to heterologous biosynthesis of various flavonoids and stilbenoids in Saccharomyces cerevisiae. Metabolic Engineering, 11(6), 355–366. 36. Shin, S. Y., Han, N. S., Park, Y. C., Kim, M. D., & Seo, J. H. (2011). Production of resveratrol from p-coumaric acid in recombinant Saccharomyces cerevisiae expressing 4-coumarate:coenzyme A ligase and stilbene synthase genes. Enyzme and Microbial Technology, 48(1), 48–53. 37. Ku, K. L., Chang, P. S., Cheng, Y. C., & Lien, C. Y. (2005). Production of stilbenoids from thecallus of Arachis hypogaea: a novel source of the anticancer compound piceatannol. Journal of Agriculture and Food Chemistry, 53, 3877–3881. 38. Wang, W., Tang, K., Yang, H. R., Wen, P. F., Zhang, P., Wang, H. L., & Huang, W. D. (2010). Distribution of resveratrol and

123

39.

40.

41.

42. 43.

44.

stilbene synthase in young grape plants (Vitis vinifera L. cv. Cabernet Sauvignon) and the effect of UV-C on its accumulation. Plant Physiology and Biochemistry, 48, 142–152. Kiselev, K. V., Tyunin, A. P., Manyakhin, A. Y., & Zhuravlev, Y. N. (2011). Resveratrolcontent and expression patterns of stilbene synthase genes in Vitis amurensis cells treated with 5-azacytidine. Plant Cell Tissue Organ Culture, 105, 65–72. Shumakova, O. A., Manyakhin, A. Y., & Kiselev, K. V. (2011). Resveratrol content and expression of phenylalanine ammonialyase and stilbene synthase genes in cell cultures of Vitis amurensis treated with coumaric acid. Applied Biochemistry and Biotechnology, 165, 1427–1436. Dubrovina, A. S., Manyakhin, A. Y., Zhuravlev, Y. N., & Kiselev, K. V. (2010). Resveratrol content and expression of phenylalanine ammonialyase and stilbene synthase genes in rolC transgenic cell cultures of Vitis amurensis. Applied Microbiology and Biotechnology, 88, 727–736. Bru M. R., Pedreno GMLDE. (2003) Method for the production of resveratrol in cell cultures. PCT Patent WO/2003/062406. Lijavetzky, D., Almagro, L., Belchi-Navarro, S., Martinez-Zapater, J. M., Bru, R., & Pedreno, M. A. (2008). Synergistic effect of methyljasmonate and cyclodextrin on stilbene biosynthesis pathway gene expression and resveratrol production in Monastrell grapevine cell cultures. BMC Research Notes, 1, 132. Kuo, C. Y., Chou, S. Y., & Huang, C. T. (2004). Cloning of glyceraldehyde-3-phosphate dehydrogenase gene and use of the gpd promoter for transformation in Flammulina velutipes. Applied Microbiology and Biotechnology, 65(5), 593–599.