Odontology DOI 10.1007/s10266-015-0206-5
ORIGINAL ARTICLE
Biomechanical force induces the growth factor production in human periodontal ligament-derived cells Hiroaki Ichioka1,2 • Toshiro Yamamoto2 • Kenta Yamamoto2 • Ken-ichi Honjo1,2 Tetsuya Adachi2 • Fumishige Oseko2 • Osam Mazda1 • Narisato Kanamura2 • Masakazu Kita1
•
Received: 20 October 2014 / Accepted: 30 March 2015 Ó The Society of The Nippon Dental University 2015
Abstract Although many reports have been published on the functional roles of periodontal ligament (PDL) cells, the mechanisms involved in the maintenance and homeostasis of PDL have not been determined. We investigated the effects of biomechanical force on growth factor production, phosphorylation of MAPKs, and intracellular transduction pathways for growth factor production in human periodontal ligament (hPDL) cells using MAPK inhibitors. hPDL cells were exposed to mechanical force (6 MPa) using a hydrostatic pressure apparatus. The levels of growth factor mRNA and protein were examined by real-time RT-PCR and ELISA. The phosphorylation of MAPKs was measured using BDTM CBA Flex Set. In addition, MAPKs inhibitors were used to identify specific signal transduction pathways. Application of biomechanical force (equivalent to occlusal force) increased the synthesis of VEGF-A, FGF-2, and NGF. The application of biomechanical force increased the expression levels of phosphorylated ERK and p38, but not of JNK. Furthermore, the levels of VEGF-A and NGF expression were suppressed by ERK or p38 inhibitor. The growth factors induced by biomechanical force may play a role in the mechanisms of homeostasis of PDL.
& Hiroaki Ichioka [email protected] 1
Department of Immunology, Kyoto Prefectural University of Medicine Graduate School of Medical Science, 465 Kajiicho, Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan
2
Department of Dental Medicine, Kyoto Prefectural University of Medicine Graduate School of Medical Science, Kyoto, Japan
Keywords Biomechanical force Occlusal force Periodontal ligament (PDL) Growth factor MAPK
Introduction Periodontal tissue consists of the gingival epithelia, cementum, alveolar bone, and periodontal ligament (PDL). The PDL is interposed between the cementum and alveolar bone and its function is to act as a cushion that mitigates the mechanical forces exerted during mastication. The main cells that form the PDL are the fibroblasts, which play an important role in the maintenance and homeostasis of the PDL [1]. The importance of mechanical forces for clinical therapy and the biological roles of mechanical stress have been reported [2]. Our group has already reported that bacterial stimulation, such as stimulation with Porphyromonas gingivalis and Prevotella intermedia produced several inflammatory cytokines in human periodontal ligament (hPDL) cells and that these inflammatory cytokines may affect local inflammation and bone resorption [3]. Our group has also reported that biomechanical force applied as hydrostatic pressure induced the production of inflammatory cytokines such as Interleukin-1 (IL-1), IL-6, IL-8 and Tumour Necrosis Factor-a (TNF-a) in hPDL cells [4]. The changes in these cytokines expression are involved in PDL remodeling. Furthermore, it has been reported that several types of mechanical force induce the expression or production of growth factors in hPDL cells [5–7]. It has been reported that epidermal growth factor increased the number of PDL cells [8, 9]. Therefore, there is a possibility that the growth factors as well as cytokines play an important role in maintaining the homeostasis of the PDL. However, there have not been any reports of studies that investigated the
123
Odontology
effects of biomechanical force on the growth factor expression levels in hPDL. Mitogen-activated protein kinase (MAPK) cascades are sufficiently studied and extensively established signal transduction systems. It has been described that three kinds of most major MAPK cascades in mammalian cells are the extracellular signal-regulated kinase 1/2 (ERK1/2) cascade, the p-38 cascade, and the c-Jun N-terminal kinase (JNK) cascade. Many papers have previously reported the activation of MAPK signalling cascade by mechanical stress in hPDL [10–12] and the functional roles of MAPK in regulating growth factor production [13]. However, the role of MAPK on growth factor production in hPDL, in the presence of biomechanical force has not been estimated. In the present study, we investigated the effects of biomechanical force that was similar to occlusal force on growth factor expression in hPDL cells that were isolated from 10 healthy donors, using the original hydrostatic pressure apparatus. We also investigated the phosphorylation of MAPKs and intracellular transduction pathways for growth factor production in hPDL cells that were induced by biomechanical force, using MAPK inhibitors.
Materials and methods Human periodontal ligament (hPDL) cells hPDL cells were prepared from healthy erupted third molar and first premolar teeth that were extracted for orthodontic reasons from 10 donors (Table 1). After extraction of teeth, they were washed with phosphate-buffered saline (PBS) and the PDL attached to the middle-third of the root was removed with a scalpel. The tissue was minced and cultured as explants in Dulbecco’s modified Eagle’s medium (DMEM; Wako, Osaka, Japan) supplemented with 10 % foetal bovine serum and antibiotics as previously described [14]. Cells between passages three and four were used for experiments. After plating the hPDL cells in Petri dishes (35 mm diameter), the cells were exposed to biomechanical force at sub-confluence. This experimental procedure was approved by the Ethics Committee of Kyoto Prefectural University of Medicine and informed consent was obtained from each participant of this study. Table 1 Donors of periodontal ligament
M male, F female, 8 third molar, 4 first premolar
123
Hydrostatic pressure apparatus and biomechanical force A hydrostatic pressure apparatus was used for the application of biomechanical force, as previously described [15]. Hydrostatic pressure was intermittent, the magnitude of hydrostatic pressure was 6 MPa, time was 60 min and frequency was 1 Hz. Controls were cells not exposed to hydrostatic pressure and placed in the apparatus. Morphological changes in cells Effect of biomechanical force on morphological changes in hPDL cells was observed using a Giemsa stain (Wako, Osaka, Japan) and observing the cells under an inverted optical microscope (CK-2 and FX-71, Olympus, Tokyo, Japan). Cell viability analysis Cell viability test was performed using the water soluble tetrazolium salt (WST) assay. After the application of biomechanical force, 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2, 4-disulfophenyl)-2H-tetrazolium monosodium salt (WST-8) solution was added (Cell Count Reagent SF; Nacalai Tesque, Kyoto, Japan) to the culture medium at a 10 % concentration. After 2 h of incubation at 37 °C with WST-8, the culture supernatant was transferred from the dish to a 96-well plate. In a 96-well plate, the absorbance of each well was measured using a microplate reader (Emax; Molecular Devices, Sunnyvale, CA, USA). Readings were taken at 450 nm against 650 nm as a reference. Expression of growth factor mRNA RNA isolation was performed 2 h after the application of biomechanical force. Isolation of RNA and synthesis of cDNA was performed as previously described [16]. Realtime RT-PCR was performed for analysing the mRNA expression levels of the growth factors. We performed realtime RT-PCR using Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems, San Francisco, CA, USA). The amplification processes were performed as follows: 1 cycle of 50 °C for 2 min and 95 °C for 10 min, followed by 45 cycles for denaturation, annealing and extension. The condition of denaturing is 15 s at 95 °C and the condition of annealing and extension is 60 s at 60 °C. The PCR mixtures of 25 ll consisted of Master Mix (12.5 ll) (Roche Diagnostics, Penzberg, Germany), RNase-free water (5.77 ll), cDNA (2 ll), UPL probe (0.25 ll) (Roche Diagnostics, Penzberg, Germany) and a pair of 10 lM specific primers (2.24 ll). Specific primers
Odontology Table 2 Real-time RT-PCR primer sequences Gene
Primer
Sequences
Length
GAPDH
Left
agccacatcgctcagacac
19
Right
gcccaatacgaccaaatcc
19
Left
tgcccgctgctgtctaat
18
VEGF-A FGF-2 NGF
Right
tctccgctctgagcaagg
18
Left
ttcttcctgcgcatccac
18
Right
tgcttgaagttgtagcttgatgt
23
Left
tccggacccaataacagttt
20
Right
ggacattacgctatgcacctc
21
GAPDH Glyceraldehyde-3-phosphate dehydrogenase, VEGF-A vascular endothelial growth factor-A, FGF-2 fibroblast growth factors-2, NGF nerve growth factor
were designed by Universal Probe Library Assay Design Center (Roche Diagnostics, Penzberg, Germany). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Table 2 shows the sequences of the primer (Table 2).
MAPK inhibitors: ERK1/2 pathway inhibitor, PD98059 (Cayman Chemical, Ann Arbor, MI, USA); p-38 pathway inhibitor, SB202190 (Cayman Chemical, Ann Arbor, MI, USA); and JNK pathway inhibitor, SP600125 (Enzo Life Science, Farmingdale, NY, USA) at a concentration of 10 lM, 1 h prior to the exposure to biomechanical force [16]. Thereafter, biomechanical force was applied and isolation of RNA and synthesis of cDNA was performed for real-time RT-PCR. RNA isolation was performed 2 h after the application of biomechanical force. Statistical analysis In this study, data are showed by mean ± standard deviation (S.D.). Student’s t test, ANOVA with Dunnett’s test and Tukey test for multiple comparisons were used for analyses of statistical significance. P values \0.05 were considered significant.
Results Production of growth factors The culture supernatant was obtained 24 h and 48 h after application of biomechanical force. The concentration of growth factors in the culture supernatant was determined using the following ELISA kits: vascular endothelial growth factor-A (VEGF-A) (Invitrogen, Camarillo, CA, USA), fibroblast growth factors-2 (FGF-2) (Invitrogen, Camarillo, CA, USA) and nerve growth factor (NGF) (Promega, Madison, WI, USA). The absorbance of each well was measured with the microplate reader Emax at 450 nm and compared with standard curve. Phosphorylation of MAPKs To analyse the effect of biomechanical force on the phosphorylation of MAPKs, the phosphorylation of MAPKs (phospho-ERK1/2, phospho-p38, and phospho-JNK) was measured using BDTM Cytometric Bead Array Flex Set (BD Biosciences, San Jose, CA, USA). Cell lysates were collected 15, 30, 60, and 120 min after the application of biomechanical force. Analysis was carried out on a FACS CantoII flow cytometer. Mean fluorescence was compared with standard curve and concentrations of phosphoprotein (units/ml) were determined using the provided CBA software. Inhibition of MAPKs To analyse the role of the MAPK signalling pathway on biomechanical force-induced growth factor expression, hPDL cells were pre-treated with each of the following
Morphological changes in hPDL cells after application of biomechanical force To evaluate the influence of biomechanical force (BF) on the morphology of hPDL cells, these cells were exposed to biomechanical force of 6 MPa using a hydrostatic pressure apparatus. The morphology of hPDL cells was not changed by application of biomechanical force (Fig. 1). Cell viability of the hPDL cells after application of biomechanical force To evaluate influence of biomechanical force on cell viability in hPDL cells, cell viability test was performed. The viability of hPDL cells after application of biomechanical force was 100.8 %. Therefore, no reduction in the viability of hPDL cells was observed after the application of biomechanical force (Fig. 2). Effect of biomechanical force on the expression levels of growth factor mRNA in hPDL cells To examine whether the application of biomechanical force induced the production of growth factors, the mRNA levels of certain growth factors in hPDL cells after application of biomechanical force were analysed. As shown in Fig. 3, the application of biomechanical force caused an increase in the levels of VEGF-A, FGF-2, and NGF mRNA in hPDL cells. The VEGF-A, FGF-2, and NGF mRNA levels increased 3.4-, 1.5-, and 2.0-fold, respectively, in cells after application of biomechanical force (Fig. 3).
123
Odontology Fig. 1 Morphological changes of hPDL after application of biomechanical force (BF). a, b Observing the cells under an inverted optical microscope. c, d Observing the cells under an inverted optical microscope using a Giemsa stain; hPDL were not affected by biomechanical force
24 and 48 h, respectively (Fig. 4). These results demonstrated that the production of growth factors was increased in hPDL cells, owing to the application of biomechanical force. Effect of biomechanical force on phosphorylation of MAPKs in hPDL cells
Fig. 2 Cell viability of hPDL after application of biomechanical force (BF); the hPDL cells were not affected by the biomechanical force (n = 12; values are mean ± S.D., derived from 3 donors and estimated 4 times). N.S. not significant
Production of growth factors in the culture supernatants of hPDL cells The levels of VEGF-A, FGF-2, and NGF in the culture supernatants after application of biomechanical force were measured. After application of biomechanical force, the amount of VEGF-A increased to 221.9 and 355.5 pg/ml at 24 and 48 h, respectively, the amount of FGF-2 increased to 31.2 and 38.1 pg/ml at 24 and 48 h, respectively, and the amount of NGF increased to 15.1 and 31.4 pg/ml at
123
To evaluate whether biomechanical force induced the activation of the mitogen-activated protein kinase (MAPK) signalling cascade, the phosphorylation status of ERK1/2, p38, and JNK was assessed. As shown in Fig. 5, the expression levels of phosphorylated ERK1/2 and phosphorylated p38 were significantly increased in hPDL cells at 15 and 30 min after application of biomechanical force of 6 MPa. On the other hand, the phosphorylation level of JNK was not changed at 15, 30, 60, and 120 min after application of biomechanical force. Effect of MAPK inhibitors on biomechanical forceinduced growth factor expression in hPDL cells We used MAPK inhibitor for ERK1/2, p-38, and JNK to examine the signal transduction pathways involved in the induction of VEGF-A, FGF-2, and NGF mRNA in hPDL
Odontology
Fig. 3 Effect of biomechanical force on the expression of growth factors in hPDL cells. RNA isolation was performed 2 h after the application of biomechanical force. The mRNA levels of growth factors were analysed using real-time PCR. The results of real-time PCR are shown as ratios of fold changes between the expression
levels of the experimental cells and of the control cells after application of biomechanical force (biomechanical force/control). *P \ 0.05 and **P \ 0.01 vs. the control (n = 40; the values are mean ± S.D., derived from 10 donors and estimated 4 times)
Fig. 4 Effect of biomechanical force on the production of growth factors in hPDL cells. Supernatant was collected following centrifugation of cells 24 and 48 h after application of biomechanical force.
The production of growth factors was measured using an ELISA kit. *P \ 0.05 and **P \ 0.01 vs. the control (n = 10; the values are mean ± S.D., derived from 10 donors)
Fig. 5 Effect of biomechanical force on the phosphorylation of MAPKs in hPDL cells. Cell lysates were collected 15 and 30 min after the application of biomechanical force. The phosphorylation
levels of MAPKs were analysed using BDTM CBA Cell Signaling Flex Set system. *P \ 0.05 vs. the control. (n = 10, values are mean ± S.D., derived from 10 donors)
cells after application of biomechanical force. As shown in Fig. 6, the expression of VEGF-A mRNA in the biomechanical force ? ERK1/2 inhibitor (PD98059)-treated cells was significantly suppressed when compared with that of biomechanical force-treated cells. Moreover, the level of NGF mRNA in biomechanical force ? p-38 inhibitor (SB202190)-treated cells was decreased when compared to that of biomechanical force-treated cells. These results suggest that ERK1/2 and p-38 are involved in the production of growth factor in hPDL cells after application of biomechanical force, whereas JNK is not.
Discussion The cells of the PDL play an important role in the maintenance and homeostasis of the PDL. Although there are many reports describing the functional roles of PDL cells, there are insufficient data to elucidate the signalling cascades involved in PDL maintenance and homeostasis. The present study demonstrated that growth factor production was increased by the application of external biomechanical force that was equivalent to occlusal force and that the MAPK signalling was involved in the
123
Odontology
Fig. 6 Effect of MAPK inhibitors on the biomechanical forceinduced growth factor expression. RNA isolation was performed 2 h after the application of biomechanical force (BF). The mRNA levels of growth factors were analysed using real-time PCR. The results of real-time PCR are shown as ratios of fold changes between the
expression levels of the control and of the experimental samples (experiment/control). *P \ 0.05 vs. the control, #P \ 0.05 vs. the biomechanical force. N.S. not significant. (n = 10; the values are mean ± S.D., derived from 10 donors)
growth factor production after application of biomechanical force. The PDL contains sensory receptors, which detect occlusal force (biomechanical force) and help in maintaining periodontal tissue homeostasis. It has been described that the magnitude of the mechanical force due to human occlusal force is about 6 MPa [17]. Moreover, the human occlusal force is intermittent. The hydrostatic pressure apparatus used in this study had the capacity to intermittently apply a pressure of 6 MPa. The temperature was maintained at 37 °C, as previously reported [4, 15, 18]. We demonstrated that the intermittent application of 6 MPa pressure had no effect on the PDL cell morphology and viability. Therefore, we concluded that the growth factors were produced in PDL under normal physiological conditions. VEGF-A is a key regulator of physiological angiogenesis and is particularly important in normal development [19]. FGF-2 plays a role in angiogenesis, wound healing, and development [20, 21]. NGF is important for the growth, maintenance, and survival of nerve cells, and is also involved in angiogenesis and tissue remodelling during wound healing [22, 23]. We considered that these growth factors, produced by mechanical stress, may play a role in the maintenance of PDL homeostasis. However, it is necessary to clarify the significance of growth factor production induced by mechanical stress in hPDL cells in the future. Miyagawa et al. [5] reported that compressive forces induce VEGF production in periodontal tissues. Li and
colleagues [24] have reported that compressive forces induce FGF-2 expression in periodontal ligament. Kim et al. [25] reported that the application of tensile forces increases NGF levels in human dermal fibroblasts. It has been reported that the application of EGF increased the number of hPDL cells [8, 9]. Although hPDL cells obtained from a few donors were used in most reports, we used hPDL cells from 10 donors in this study. Taken together, our results demonstrate that VEGF-A, FGF-2, and NGF produced by biomechanical force maintain the homeostasis of PDL. The relationship between the MAPK cascade and growth factor production in hPDL cells due to mechanical force has not been examined. The present study showed that the levels of phosphorylated ERK1/2 and phosphorylated p38 increased after application of biomechanical force and that the presence of ERK1/2 or p38 inhibitor suppressed VEGF-A or NGF expression. These results suggest that components of the MAPK cascade, especially ERK1/2 and/or p38 are involved in growth factor production, particularly after application of biomechanical force. One of the PDL mechanical force sensory systems is integrins and integrin signal transduction pathways involve PI3K/Akt and Rho pathway. It is suggested that biomechanical stress-activated FGF-2 production is involved in PI3K/Akt or Rho pathway [26, 27]. Our group has previously reported that mechanical stress increased the inflammatory cytokines production in a magnitude- and time-dependent manner and changed the ratio of receptor activator of nuclear factor kappa-B
123
Odontology
ligand/Osteoprotegerin (RANKL/OPG) in favour of RANKL in mandible-derived osteoblasts [16]. These previous results suggest that mandible-derived osteoblasts play an important role in inflammatory cytokine production in response to mechanical stress and mechanical stress may regulate the homeostasis of mandible bone by activating bone remodelling through osteoclastogenesis in vivo [16]. Therefore, occlusal force may be a key regulator of regeneration of periodontal tissue, including the alveolar bone and PDL. hPDL cells sense and respond to mechanical force. However, the mechanisms of transduction of extracellular matrix forces and their conversion to biochemical signals are not known [28]. It has been reported that many kinds of signalling pathways, including MAPKs, small GTPases, and tyrosine kinases/phosphatases are involved in force transduction [28, 29]. All kinds of primary force-sensing mechanisms have been described, including mechanical tension of cytoplasmic protein, activation of ion channels, and formation of force-stabilized receptor–ligand bonds, which activate downstream signalling pathways [30]. In the future, it is necessary to elucidate the mechanism of biomechanical force sensing in hPDL cells. In conclusion, we demonstrated that the growth factor production was increased by the application of biomechanical force and that the MAPK signalling cascade was involved in this growth factor production. These results suggest that growth factors such as VEGF-A, FGF-2, and NGF, may play a role in the homeostasis of PDL. Acknowledgments We express deep gratitude to Professor Toshikazu Kubo from the Department of Orthopaedics, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, for tremendous support. This work was supported by a Grant-in-Aid for Young Scientists (B) Grant Number 22792000 from the JSPS (Japan Society for the Promotion of Science). Conflict of interest The authors declare that they have no conflict of interest in this study.
References 1. Henneman S, Bildt MM, Degroot J, Kuijpers-Jagtman AM, Von den Hoff JW. Relaxin stimulates MMP-2 and alpha-smooth muscle actin expression by human periodontal ligament cells. Arch Oral Biol. 2008;53(2):161–7. 2. Huang C, Holfeld J, Schaden W, Orgill D, Ogawa R. Mechanotherapy: revisiting physical therapy and recruiting mechanobiology for a new era in medicine. Trends Mol Med. 2013;19(9): 555–64. 3. Yamamoto T, Kita M, Oseko F, Nakamura T, Imanishi J, Kanamura N. Cytokine production in human periodontal ligament cells stimulated with Porphyromonas gingivalis. J Periodontal Res. 2006;41(6):554–9. 4. Yamamoto T, Kita M, Kimura I, Oseko F, Terauchi R, Takahashi K, et al. Mechanical stress induces expression of cytokines in human periodontal ligament cells. Oral Dis. 2006;12(2):171–5.
5. Miyagawa A, Chiba M, Hayashi H, Igarashi K. Compressive force induces VEGF production in periodontal tissues. J Dent Res. 2009;88(8):752–6. 6. Yoshino H, Morita I, Murota SI, Ishikawa I. Mechanical stress induces production of angiogenic regulators in cultured human gingival and periodontal ligament fibroblasts. J Periodontal Res. 2003;38(4):405–10. 7. Wescott DC, Pinkerton MN, Gaffey BJ, Beggs KT, Milne TJ, Meikle MC. Osteogenic gene expression by human periodontal ligament cells under cyclic tension. J Dent Res. 2007;86(12): 1212–6. 8. Yamawaki K, Matsuzaka K, Kokubu E, Inoue T. Effects of epidermal growth factor and/or nerve growth factor on Malassez’s epithelial rest cells in vitro: expression of mRNA for osteopontin, bone morphogenetic protein 2 and vascular endothelial growth factor. J Periodontal Res. 2010;45(3):421–7. 9. Nishimura F, Terranova VP. Comparative study of the chemotactic responses of periodontal ligament cells and gingival fibroblasts to polypeptide growth factors. J Dent Res. 1996;75(4): 986–92. 10. Lee SI, Park KH, Kim SJ, Kang YG, Lee YM, Kim EC. Mechanical stress-activated immune response genes via Sirtuin 1 expression in human periodontal ligament cells. Clin Exp Immunol. 2012;168(1):113–24. 11. Kook SH, Jang YS, Lee JC. Involvement of JNK-AP-1 and ERKNF-jB signaling in tension-stimulated expression of type I collagen and MMP-1 in human periodontal ligament fibroblasts. J Appl Physiol. 2011;111(6):1575–83. 12. Kook SH, Lee JC. Tensile force inhibits the proliferation of human periodontal ligament fibroblasts through Ras-p38 MAPK upregulation. J Cell Physiol. 2012;227(3):1098–106. 13. Tsang M, Dawid IB. Promotion and attenuation of FGF signaling through the Ras-MAPK pathway. Sci STKE. 2004;228:pe17. 14. Nishigaki M, Yamamoto T, Ichioka H, Honjo K, Yamamoto K, Oseko F, et al. b-cryptoxanthin regulates bone resorption relatedcytokine production in human periodontal ligament cells. Arch Oral Biol. 2013;58(7):880–6. 15. Yamamoto T, Kita M, Yamamoto K, Akamatsu Y, Oseko F, Kanamura N. Mechanical stress enhances production of cytokines in human periodontal ligament cells induced by Porphyromonas gingivalis. Arch Oral Biol. 2011;56(3):251–7. 16. Yamamoto K, Yamamoto T, Ichioka H, Akamatsu Y, Oseko F, Mazda O, et al. Effects of mechanical stress on cytokine production in mandible-derived osteoblasts. Oral Dis. 2011;17(7): 712–9. 17. Nagai I, Tanaka N, Noguchi M, Suda Y, Sonoda T, Kohama G. Changes in occlusal state of patients with mandibular prognathism after orthognathic surgery: a pilot study. Br J Oral Maxillofac Surg. 2001;39(6):429–33. 18. Sakao K, Takahashi KA, Arai Y, Inoue A, Tonomura H, Saito M, et al. Induction of chondrogenic phenotype in synovium-derived progenitor cells by intermittent hydrostatic pressure. Osteoarthr Cartil. 2008;16(7):805–14. 19. Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med. 2003;9(6):669–76. 20. Beenken A, Mohammadi M. The FGF family: biology, pathophysiology and therapy. Nat Rev Drug Discov. 2009;8(3): 235–53. 21. Kubota T, Yamamoto T, Ichioka H, Yamamoto K, Kanamura N, Kamegai A, et al. Biological implications of fetuin for bone remodeling system and possible evidence for its use in heterotopic ossification. J Oral Maxillofac Surg Med Pathol. 2012;24(1): 36–41. 22. Nico B, Mangieri D, Benagiano V, Crivellato E, Ribatti D. Nerve growth factor as an angiogenic factor. Microvasc Res. 2008;75 (2):135–41.
123
Odontology 23. Kawamoto K, Matsuda H. Nerve growth factor and wound healing. Prog Brain Res. 2004;146:369–84. 24. Li Y, Zheng W, Liu JS, Wang J, Yang P, Li ML, et al. Expression of osteoclastogenesis inducers in a tissue model of periodontal ligament under compression. J Dent Res. 2011;90(1):115–20. 25. Kim M, Shin DW, Shin H, Noh M, Shin JH. Tensile stimuli increase nerve growth factor in human dermal fibroblasts independent of tension-induced TGFb production. Exp Dermatol. 2013;22(1):72–4. 26. Gu J, Fujibayashi A, Yamada KM, Sekiguchi K. Laminin-10/11 and fibronectin differentially prevent apoptosis induced by serum removal via phosphatidylinositol 3-kinase/Akt- and MEK1/ERKdependent pathways. J Biol Chem. 2002;277(22):19922–8.
123
27. Gu J, Sumida Y, Sanzen N, Sekiguchi K. Laminin-10/11 and fibronectin differentially regulate integrin-dependent Rho and Rac activation via p130(Cas)-CrkII-DOCK180 pathway. J Biol Chem. 2001;276(29):27090–7. 28. Tamada M, Sheetz MP, Sawada Y. Activation of a signaling cascade by cytoskeleton stretch. Dev Cell. 2004;7(5):709–18. 29. Sawada Y, Tamada M, Dubin-Thaler BJ, Cherniavskaya O, Sakai R, Tanaka S, et al. Force sensing by mechanical extension of the Src family kinase substrate p130Cas. Cell. 2006;127(5):1015–26. 30. Vogel V, Sheetz M. Local force and geometry sensing regulate cell functions. Nat Rev Mol Cell Biol. 2006;7(4):265–75.
ORIGINAL ARTICLE
Biomechanical force induces the growth factor production in human periodontal ligament-derived cells Hiroaki Ichioka1,2 • Toshiro Yamamoto2 • Kenta Yamamoto2 • Ken-ichi Honjo1,2 Tetsuya Adachi2 • Fumishige Oseko2 • Osam Mazda1 • Narisato Kanamura2 • Masakazu Kita1
•
Received: 20 October 2014 / Accepted: 30 March 2015 Ó The Society of The Nippon Dental University 2015
Abstract Although many reports have been published on the functional roles of periodontal ligament (PDL) cells, the mechanisms involved in the maintenance and homeostasis of PDL have not been determined. We investigated the effects of biomechanical force on growth factor production, phosphorylation of MAPKs, and intracellular transduction pathways for growth factor production in human periodontal ligament (hPDL) cells using MAPK inhibitors. hPDL cells were exposed to mechanical force (6 MPa) using a hydrostatic pressure apparatus. The levels of growth factor mRNA and protein were examined by real-time RT-PCR and ELISA. The phosphorylation of MAPKs was measured using BDTM CBA Flex Set. In addition, MAPKs inhibitors were used to identify specific signal transduction pathways. Application of biomechanical force (equivalent to occlusal force) increased the synthesis of VEGF-A, FGF-2, and NGF. The application of biomechanical force increased the expression levels of phosphorylated ERK and p38, but not of JNK. Furthermore, the levels of VEGF-A and NGF expression were suppressed by ERK or p38 inhibitor. The growth factors induced by biomechanical force may play a role in the mechanisms of homeostasis of PDL.
& Hiroaki Ichioka [email protected] 1
Department of Immunology, Kyoto Prefectural University of Medicine Graduate School of Medical Science, 465 Kajiicho, Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan
2
Department of Dental Medicine, Kyoto Prefectural University of Medicine Graduate School of Medical Science, Kyoto, Japan
Keywords Biomechanical force Occlusal force Periodontal ligament (PDL) Growth factor MAPK
Introduction Periodontal tissue consists of the gingival epithelia, cementum, alveolar bone, and periodontal ligament (PDL). The PDL is interposed between the cementum and alveolar bone and its function is to act as a cushion that mitigates the mechanical forces exerted during mastication. The main cells that form the PDL are the fibroblasts, which play an important role in the maintenance and homeostasis of the PDL [1]. The importance of mechanical forces for clinical therapy and the biological roles of mechanical stress have been reported [2]. Our group has already reported that bacterial stimulation, such as stimulation with Porphyromonas gingivalis and Prevotella intermedia produced several inflammatory cytokines in human periodontal ligament (hPDL) cells and that these inflammatory cytokines may affect local inflammation and bone resorption [3]. Our group has also reported that biomechanical force applied as hydrostatic pressure induced the production of inflammatory cytokines such as Interleukin-1 (IL-1), IL-6, IL-8 and Tumour Necrosis Factor-a (TNF-a) in hPDL cells [4]. The changes in these cytokines expression are involved in PDL remodeling. Furthermore, it has been reported that several types of mechanical force induce the expression or production of growth factors in hPDL cells [5–7]. It has been reported that epidermal growth factor increased the number of PDL cells [8, 9]. Therefore, there is a possibility that the growth factors as well as cytokines play an important role in maintaining the homeostasis of the PDL. However, there have not been any reports of studies that investigated the
123
Odontology
effects of biomechanical force on the growth factor expression levels in hPDL. Mitogen-activated protein kinase (MAPK) cascades are sufficiently studied and extensively established signal transduction systems. It has been described that three kinds of most major MAPK cascades in mammalian cells are the extracellular signal-regulated kinase 1/2 (ERK1/2) cascade, the p-38 cascade, and the c-Jun N-terminal kinase (JNK) cascade. Many papers have previously reported the activation of MAPK signalling cascade by mechanical stress in hPDL [10–12] and the functional roles of MAPK in regulating growth factor production [13]. However, the role of MAPK on growth factor production in hPDL, in the presence of biomechanical force has not been estimated. In the present study, we investigated the effects of biomechanical force that was similar to occlusal force on growth factor expression in hPDL cells that were isolated from 10 healthy donors, using the original hydrostatic pressure apparatus. We also investigated the phosphorylation of MAPKs and intracellular transduction pathways for growth factor production in hPDL cells that were induced by biomechanical force, using MAPK inhibitors.
Materials and methods Human periodontal ligament (hPDL) cells hPDL cells were prepared from healthy erupted third molar and first premolar teeth that were extracted for orthodontic reasons from 10 donors (Table 1). After extraction of teeth, they were washed with phosphate-buffered saline (PBS) and the PDL attached to the middle-third of the root was removed with a scalpel. The tissue was minced and cultured as explants in Dulbecco’s modified Eagle’s medium (DMEM; Wako, Osaka, Japan) supplemented with 10 % foetal bovine serum and antibiotics as previously described [14]. Cells between passages three and four were used for experiments. After plating the hPDL cells in Petri dishes (35 mm diameter), the cells were exposed to biomechanical force at sub-confluence. This experimental procedure was approved by the Ethics Committee of Kyoto Prefectural University of Medicine and informed consent was obtained from each participant of this study. Table 1 Donors of periodontal ligament
M male, F female, 8 third molar, 4 first premolar
123
Hydrostatic pressure apparatus and biomechanical force A hydrostatic pressure apparatus was used for the application of biomechanical force, as previously described [15]. Hydrostatic pressure was intermittent, the magnitude of hydrostatic pressure was 6 MPa, time was 60 min and frequency was 1 Hz. Controls were cells not exposed to hydrostatic pressure and placed in the apparatus. Morphological changes in cells Effect of biomechanical force on morphological changes in hPDL cells was observed using a Giemsa stain (Wako, Osaka, Japan) and observing the cells under an inverted optical microscope (CK-2 and FX-71, Olympus, Tokyo, Japan). Cell viability analysis Cell viability test was performed using the water soluble tetrazolium salt (WST) assay. After the application of biomechanical force, 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2, 4-disulfophenyl)-2H-tetrazolium monosodium salt (WST-8) solution was added (Cell Count Reagent SF; Nacalai Tesque, Kyoto, Japan) to the culture medium at a 10 % concentration. After 2 h of incubation at 37 °C with WST-8, the culture supernatant was transferred from the dish to a 96-well plate. In a 96-well plate, the absorbance of each well was measured using a microplate reader (Emax; Molecular Devices, Sunnyvale, CA, USA). Readings were taken at 450 nm against 650 nm as a reference. Expression of growth factor mRNA RNA isolation was performed 2 h after the application of biomechanical force. Isolation of RNA and synthesis of cDNA was performed as previously described [16]. Realtime RT-PCR was performed for analysing the mRNA expression levels of the growth factors. We performed realtime RT-PCR using Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems, San Francisco, CA, USA). The amplification processes were performed as follows: 1 cycle of 50 °C for 2 min and 95 °C for 10 min, followed by 45 cycles for denaturation, annealing and extension. The condition of denaturing is 15 s at 95 °C and the condition of annealing and extension is 60 s at 60 °C. The PCR mixtures of 25 ll consisted of Master Mix (12.5 ll) (Roche Diagnostics, Penzberg, Germany), RNase-free water (5.77 ll), cDNA (2 ll), UPL probe (0.25 ll) (Roche Diagnostics, Penzberg, Germany) and a pair of 10 lM specific primers (2.24 ll). Specific primers
Odontology Table 2 Real-time RT-PCR primer sequences Gene
Primer
Sequences
Length
GAPDH
Left
agccacatcgctcagacac
19
Right
gcccaatacgaccaaatcc
19
Left
tgcccgctgctgtctaat
18
VEGF-A FGF-2 NGF
Right
tctccgctctgagcaagg
18
Left
ttcttcctgcgcatccac
18
Right
tgcttgaagttgtagcttgatgt
23
Left
tccggacccaataacagttt
20
Right
ggacattacgctatgcacctc
21
GAPDH Glyceraldehyde-3-phosphate dehydrogenase, VEGF-A vascular endothelial growth factor-A, FGF-2 fibroblast growth factors-2, NGF nerve growth factor
were designed by Universal Probe Library Assay Design Center (Roche Diagnostics, Penzberg, Germany). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Table 2 shows the sequences of the primer (Table 2).
MAPK inhibitors: ERK1/2 pathway inhibitor, PD98059 (Cayman Chemical, Ann Arbor, MI, USA); p-38 pathway inhibitor, SB202190 (Cayman Chemical, Ann Arbor, MI, USA); and JNK pathway inhibitor, SP600125 (Enzo Life Science, Farmingdale, NY, USA) at a concentration of 10 lM, 1 h prior to the exposure to biomechanical force [16]. Thereafter, biomechanical force was applied and isolation of RNA and synthesis of cDNA was performed for real-time RT-PCR. RNA isolation was performed 2 h after the application of biomechanical force. Statistical analysis In this study, data are showed by mean ± standard deviation (S.D.). Student’s t test, ANOVA with Dunnett’s test and Tukey test for multiple comparisons were used for analyses of statistical significance. P values \0.05 were considered significant.
Results Production of growth factors The culture supernatant was obtained 24 h and 48 h after application of biomechanical force. The concentration of growth factors in the culture supernatant was determined using the following ELISA kits: vascular endothelial growth factor-A (VEGF-A) (Invitrogen, Camarillo, CA, USA), fibroblast growth factors-2 (FGF-2) (Invitrogen, Camarillo, CA, USA) and nerve growth factor (NGF) (Promega, Madison, WI, USA). The absorbance of each well was measured with the microplate reader Emax at 450 nm and compared with standard curve. Phosphorylation of MAPKs To analyse the effect of biomechanical force on the phosphorylation of MAPKs, the phosphorylation of MAPKs (phospho-ERK1/2, phospho-p38, and phospho-JNK) was measured using BDTM Cytometric Bead Array Flex Set (BD Biosciences, San Jose, CA, USA). Cell lysates were collected 15, 30, 60, and 120 min after the application of biomechanical force. Analysis was carried out on a FACS CantoII flow cytometer. Mean fluorescence was compared with standard curve and concentrations of phosphoprotein (units/ml) were determined using the provided CBA software. Inhibition of MAPKs To analyse the role of the MAPK signalling pathway on biomechanical force-induced growth factor expression, hPDL cells were pre-treated with each of the following
Morphological changes in hPDL cells after application of biomechanical force To evaluate the influence of biomechanical force (BF) on the morphology of hPDL cells, these cells were exposed to biomechanical force of 6 MPa using a hydrostatic pressure apparatus. The morphology of hPDL cells was not changed by application of biomechanical force (Fig. 1). Cell viability of the hPDL cells after application of biomechanical force To evaluate influence of biomechanical force on cell viability in hPDL cells, cell viability test was performed. The viability of hPDL cells after application of biomechanical force was 100.8 %. Therefore, no reduction in the viability of hPDL cells was observed after the application of biomechanical force (Fig. 2). Effect of biomechanical force on the expression levels of growth factor mRNA in hPDL cells To examine whether the application of biomechanical force induced the production of growth factors, the mRNA levels of certain growth factors in hPDL cells after application of biomechanical force were analysed. As shown in Fig. 3, the application of biomechanical force caused an increase in the levels of VEGF-A, FGF-2, and NGF mRNA in hPDL cells. The VEGF-A, FGF-2, and NGF mRNA levels increased 3.4-, 1.5-, and 2.0-fold, respectively, in cells after application of biomechanical force (Fig. 3).
123
Odontology Fig. 1 Morphological changes of hPDL after application of biomechanical force (BF). a, b Observing the cells under an inverted optical microscope. c, d Observing the cells under an inverted optical microscope using a Giemsa stain; hPDL were not affected by biomechanical force
24 and 48 h, respectively (Fig. 4). These results demonstrated that the production of growth factors was increased in hPDL cells, owing to the application of biomechanical force. Effect of biomechanical force on phosphorylation of MAPKs in hPDL cells
Fig. 2 Cell viability of hPDL after application of biomechanical force (BF); the hPDL cells were not affected by the biomechanical force (n = 12; values are mean ± S.D., derived from 3 donors and estimated 4 times). N.S. not significant
Production of growth factors in the culture supernatants of hPDL cells The levels of VEGF-A, FGF-2, and NGF in the culture supernatants after application of biomechanical force were measured. After application of biomechanical force, the amount of VEGF-A increased to 221.9 and 355.5 pg/ml at 24 and 48 h, respectively, the amount of FGF-2 increased to 31.2 and 38.1 pg/ml at 24 and 48 h, respectively, and the amount of NGF increased to 15.1 and 31.4 pg/ml at
123
To evaluate whether biomechanical force induced the activation of the mitogen-activated protein kinase (MAPK) signalling cascade, the phosphorylation status of ERK1/2, p38, and JNK was assessed. As shown in Fig. 5, the expression levels of phosphorylated ERK1/2 and phosphorylated p38 were significantly increased in hPDL cells at 15 and 30 min after application of biomechanical force of 6 MPa. On the other hand, the phosphorylation level of JNK was not changed at 15, 30, 60, and 120 min after application of biomechanical force. Effect of MAPK inhibitors on biomechanical forceinduced growth factor expression in hPDL cells We used MAPK inhibitor for ERK1/2, p-38, and JNK to examine the signal transduction pathways involved in the induction of VEGF-A, FGF-2, and NGF mRNA in hPDL
Odontology
Fig. 3 Effect of biomechanical force on the expression of growth factors in hPDL cells. RNA isolation was performed 2 h after the application of biomechanical force. The mRNA levels of growth factors were analysed using real-time PCR. The results of real-time PCR are shown as ratios of fold changes between the expression
levels of the experimental cells and of the control cells after application of biomechanical force (biomechanical force/control). *P \ 0.05 and **P \ 0.01 vs. the control (n = 40; the values are mean ± S.D., derived from 10 donors and estimated 4 times)
Fig. 4 Effect of biomechanical force on the production of growth factors in hPDL cells. Supernatant was collected following centrifugation of cells 24 and 48 h after application of biomechanical force.
The production of growth factors was measured using an ELISA kit. *P \ 0.05 and **P \ 0.01 vs. the control (n = 10; the values are mean ± S.D., derived from 10 donors)
Fig. 5 Effect of biomechanical force on the phosphorylation of MAPKs in hPDL cells. Cell lysates were collected 15 and 30 min after the application of biomechanical force. The phosphorylation
levels of MAPKs were analysed using BDTM CBA Cell Signaling Flex Set system. *P \ 0.05 vs. the control. (n = 10, values are mean ± S.D., derived from 10 donors)
cells after application of biomechanical force. As shown in Fig. 6, the expression of VEGF-A mRNA in the biomechanical force ? ERK1/2 inhibitor (PD98059)-treated cells was significantly suppressed when compared with that of biomechanical force-treated cells. Moreover, the level of NGF mRNA in biomechanical force ? p-38 inhibitor (SB202190)-treated cells was decreased when compared to that of biomechanical force-treated cells. These results suggest that ERK1/2 and p-38 are involved in the production of growth factor in hPDL cells after application of biomechanical force, whereas JNK is not.
Discussion The cells of the PDL play an important role in the maintenance and homeostasis of the PDL. Although there are many reports describing the functional roles of PDL cells, there are insufficient data to elucidate the signalling cascades involved in PDL maintenance and homeostasis. The present study demonstrated that growth factor production was increased by the application of external biomechanical force that was equivalent to occlusal force and that the MAPK signalling was involved in the
123
Odontology
Fig. 6 Effect of MAPK inhibitors on the biomechanical forceinduced growth factor expression. RNA isolation was performed 2 h after the application of biomechanical force (BF). The mRNA levels of growth factors were analysed using real-time PCR. The results of real-time PCR are shown as ratios of fold changes between the
expression levels of the control and of the experimental samples (experiment/control). *P \ 0.05 vs. the control, #P \ 0.05 vs. the biomechanical force. N.S. not significant. (n = 10; the values are mean ± S.D., derived from 10 donors)
growth factor production after application of biomechanical force. The PDL contains sensory receptors, which detect occlusal force (biomechanical force) and help in maintaining periodontal tissue homeostasis. It has been described that the magnitude of the mechanical force due to human occlusal force is about 6 MPa [17]. Moreover, the human occlusal force is intermittent. The hydrostatic pressure apparatus used in this study had the capacity to intermittently apply a pressure of 6 MPa. The temperature was maintained at 37 °C, as previously reported [4, 15, 18]. We demonstrated that the intermittent application of 6 MPa pressure had no effect on the PDL cell morphology and viability. Therefore, we concluded that the growth factors were produced in PDL under normal physiological conditions. VEGF-A is a key regulator of physiological angiogenesis and is particularly important in normal development [19]. FGF-2 plays a role in angiogenesis, wound healing, and development [20, 21]. NGF is important for the growth, maintenance, and survival of nerve cells, and is also involved in angiogenesis and tissue remodelling during wound healing [22, 23]. We considered that these growth factors, produced by mechanical stress, may play a role in the maintenance of PDL homeostasis. However, it is necessary to clarify the significance of growth factor production induced by mechanical stress in hPDL cells in the future. Miyagawa et al. [5] reported that compressive forces induce VEGF production in periodontal tissues. Li and
colleagues [24] have reported that compressive forces induce FGF-2 expression in periodontal ligament. Kim et al. [25] reported that the application of tensile forces increases NGF levels in human dermal fibroblasts. It has been reported that the application of EGF increased the number of hPDL cells [8, 9]. Although hPDL cells obtained from a few donors were used in most reports, we used hPDL cells from 10 donors in this study. Taken together, our results demonstrate that VEGF-A, FGF-2, and NGF produced by biomechanical force maintain the homeostasis of PDL. The relationship between the MAPK cascade and growth factor production in hPDL cells due to mechanical force has not been examined. The present study showed that the levels of phosphorylated ERK1/2 and phosphorylated p38 increased after application of biomechanical force and that the presence of ERK1/2 or p38 inhibitor suppressed VEGF-A or NGF expression. These results suggest that components of the MAPK cascade, especially ERK1/2 and/or p38 are involved in growth factor production, particularly after application of biomechanical force. One of the PDL mechanical force sensory systems is integrins and integrin signal transduction pathways involve PI3K/Akt and Rho pathway. It is suggested that biomechanical stress-activated FGF-2 production is involved in PI3K/Akt or Rho pathway [26, 27]. Our group has previously reported that mechanical stress increased the inflammatory cytokines production in a magnitude- and time-dependent manner and changed the ratio of receptor activator of nuclear factor kappa-B
123
Odontology
ligand/Osteoprotegerin (RANKL/OPG) in favour of RANKL in mandible-derived osteoblasts [16]. These previous results suggest that mandible-derived osteoblasts play an important role in inflammatory cytokine production in response to mechanical stress and mechanical stress may regulate the homeostasis of mandible bone by activating bone remodelling through osteoclastogenesis in vivo [16]. Therefore, occlusal force may be a key regulator of regeneration of periodontal tissue, including the alveolar bone and PDL. hPDL cells sense and respond to mechanical force. However, the mechanisms of transduction of extracellular matrix forces and their conversion to biochemical signals are not known [28]. It has been reported that many kinds of signalling pathways, including MAPKs, small GTPases, and tyrosine kinases/phosphatases are involved in force transduction [28, 29]. All kinds of primary force-sensing mechanisms have been described, including mechanical tension of cytoplasmic protein, activation of ion channels, and formation of force-stabilized receptor–ligand bonds, which activate downstream signalling pathways [30]. In the future, it is necessary to elucidate the mechanism of biomechanical force sensing in hPDL cells. In conclusion, we demonstrated that the growth factor production was increased by the application of biomechanical force and that the MAPK signalling cascade was involved in this growth factor production. These results suggest that growth factors such as VEGF-A, FGF-2, and NGF, may play a role in the homeostasis of PDL. Acknowledgments We express deep gratitude to Professor Toshikazu Kubo from the Department of Orthopaedics, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, for tremendous support. This work was supported by a Grant-in-Aid for Young Scientists (B) Grant Number 22792000 from the JSPS (Japan Society for the Promotion of Science). Conflict of interest The authors declare that they have no conflict of interest in this study.
References 1. Henneman S, Bildt MM, Degroot J, Kuijpers-Jagtman AM, Von den Hoff JW. Relaxin stimulates MMP-2 and alpha-smooth muscle actin expression by human periodontal ligament cells. Arch Oral Biol. 2008;53(2):161–7. 2. Huang C, Holfeld J, Schaden W, Orgill D, Ogawa R. Mechanotherapy: revisiting physical therapy and recruiting mechanobiology for a new era in medicine. Trends Mol Med. 2013;19(9): 555–64. 3. Yamamoto T, Kita M, Oseko F, Nakamura T, Imanishi J, Kanamura N. Cytokine production in human periodontal ligament cells stimulated with Porphyromonas gingivalis. J Periodontal Res. 2006;41(6):554–9. 4. Yamamoto T, Kita M, Kimura I, Oseko F, Terauchi R, Takahashi K, et al. Mechanical stress induces expression of cytokines in human periodontal ligament cells. Oral Dis. 2006;12(2):171–5.
5. Miyagawa A, Chiba M, Hayashi H, Igarashi K. Compressive force induces VEGF production in periodontal tissues. J Dent Res. 2009;88(8):752–6. 6. Yoshino H, Morita I, Murota SI, Ishikawa I. Mechanical stress induces production of angiogenic regulators in cultured human gingival and periodontal ligament fibroblasts. J Periodontal Res. 2003;38(4):405–10. 7. Wescott DC, Pinkerton MN, Gaffey BJ, Beggs KT, Milne TJ, Meikle MC. Osteogenic gene expression by human periodontal ligament cells under cyclic tension. J Dent Res. 2007;86(12): 1212–6. 8. Yamawaki K, Matsuzaka K, Kokubu E, Inoue T. Effects of epidermal growth factor and/or nerve growth factor on Malassez’s epithelial rest cells in vitro: expression of mRNA for osteopontin, bone morphogenetic protein 2 and vascular endothelial growth factor. J Periodontal Res. 2010;45(3):421–7. 9. Nishimura F, Terranova VP. Comparative study of the chemotactic responses of periodontal ligament cells and gingival fibroblasts to polypeptide growth factors. J Dent Res. 1996;75(4): 986–92. 10. Lee SI, Park KH, Kim SJ, Kang YG, Lee YM, Kim EC. Mechanical stress-activated immune response genes via Sirtuin 1 expression in human periodontal ligament cells. Clin Exp Immunol. 2012;168(1):113–24. 11. Kook SH, Jang YS, Lee JC. Involvement of JNK-AP-1 and ERKNF-jB signaling in tension-stimulated expression of type I collagen and MMP-1 in human periodontal ligament fibroblasts. J Appl Physiol. 2011;111(6):1575–83. 12. Kook SH, Lee JC. Tensile force inhibits the proliferation of human periodontal ligament fibroblasts through Ras-p38 MAPK upregulation. J Cell Physiol. 2012;227(3):1098–106. 13. Tsang M, Dawid IB. Promotion and attenuation of FGF signaling through the Ras-MAPK pathway. Sci STKE. 2004;228:pe17. 14. Nishigaki M, Yamamoto T, Ichioka H, Honjo K, Yamamoto K, Oseko F, et al. b-cryptoxanthin regulates bone resorption relatedcytokine production in human periodontal ligament cells. Arch Oral Biol. 2013;58(7):880–6. 15. Yamamoto T, Kita M, Yamamoto K, Akamatsu Y, Oseko F, Kanamura N. Mechanical stress enhances production of cytokines in human periodontal ligament cells induced by Porphyromonas gingivalis. Arch Oral Biol. 2011;56(3):251–7. 16. Yamamoto K, Yamamoto T, Ichioka H, Akamatsu Y, Oseko F, Mazda O, et al. Effects of mechanical stress on cytokine production in mandible-derived osteoblasts. Oral Dis. 2011;17(7): 712–9. 17. Nagai I, Tanaka N, Noguchi M, Suda Y, Sonoda T, Kohama G. Changes in occlusal state of patients with mandibular prognathism after orthognathic surgery: a pilot study. Br J Oral Maxillofac Surg. 2001;39(6):429–33. 18. Sakao K, Takahashi KA, Arai Y, Inoue A, Tonomura H, Saito M, et al. Induction of chondrogenic phenotype in synovium-derived progenitor cells by intermittent hydrostatic pressure. Osteoarthr Cartil. 2008;16(7):805–14. 19. Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med. 2003;9(6):669–76. 20. Beenken A, Mohammadi M. The FGF family: biology, pathophysiology and therapy. Nat Rev Drug Discov. 2009;8(3): 235–53. 21. Kubota T, Yamamoto T, Ichioka H, Yamamoto K, Kanamura N, Kamegai A, et al. Biological implications of fetuin for bone remodeling system and possible evidence for its use in heterotopic ossification. J Oral Maxillofac Surg Med Pathol. 2012;24(1): 36–41. 22. Nico B, Mangieri D, Benagiano V, Crivellato E, Ribatti D. Nerve growth factor as an angiogenic factor. Microvasc Res. 2008;75 (2):135–41.
123
Odontology 23. Kawamoto K, Matsuda H. Nerve growth factor and wound healing. Prog Brain Res. 2004;146:369–84. 24. Li Y, Zheng W, Liu JS, Wang J, Yang P, Li ML, et al. Expression of osteoclastogenesis inducers in a tissue model of periodontal ligament under compression. J Dent Res. 2011;90(1):115–20. 25. Kim M, Shin DW, Shin H, Noh M, Shin JH. Tensile stimuli increase nerve growth factor in human dermal fibroblasts independent of tension-induced TGFb production. Exp Dermatol. 2013;22(1):72–4. 26. Gu J, Fujibayashi A, Yamada KM, Sekiguchi K. Laminin-10/11 and fibronectin differentially prevent apoptosis induced by serum removal via phosphatidylinositol 3-kinase/Akt- and MEK1/ERKdependent pathways. J Biol Chem. 2002;277(22):19922–8.
123
27. Gu J, Sumida Y, Sanzen N, Sekiguchi K. Laminin-10/11 and fibronectin differentially regulate integrin-dependent Rho and Rac activation via p130(Cas)-CrkII-DOCK180 pathway. J Biol Chem. 2001;276(29):27090–7. 28. Tamada M, Sheetz MP, Sawada Y. Activation of a signaling cascade by cytoskeleton stretch. Dev Cell. 2004;7(5):709–18. 29. Sawada Y, Tamada M, Dubin-Thaler BJ, Cherniavskaya O, Sakai R, Tanaka S, et al. Force sensing by mechanical extension of the Src family kinase substrate p130Cas. Cell. 2006;127(5):1015–26. 30. Vogel V, Sheetz M. Local force and geometry sensing regulate cell functions. Nat Rev Mol Cell Biol. 2006;7(4):265–75.
