International Journal of Food Microbiology 238 (2016) 63–67
Contents lists available at ScienceDirect
International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro
Biofilm formation, phenotypic production of cellulose and gene expression in Salmonella enterica decrease under anaerobic conditions A. Lamas, J.M. Miranda, B. Vázquez, A. Cepeda, C.M. Franco ⁎ Laboratorio de Higiene Inspección y Control de Alimentos, Departamento de Química Analítica, Nutrición y Bromatología, Universidad de Santiago de Compostela, 27002 Lugo, Spain
a r t i c l e
i n f o
Article history: Received 2 June 2016 Received in revised form 28 August 2016 Accepted 29 August 2016 Available online 31 August 2016 Keywords: Salmonella Biofilm Food safety Morphotype Gene expression
a b s t r a c t Salmonella enterica subsp. enterica is one of the main food-borne pathogens. This microorganism combines an aerobic life outside the host with an anaerobic life within the host. One of the main concerns related to S. enterica is biofilm formation and cellulose production. In this study, biofilm formation, morphotype, cellulose production and transcription of biofilm and quorum sensing-related genes of 11 S. enterica strains were tested under three different conditions: aerobiosis, microaerobiosis, and anaerobiosis. The results showed an influence of oxygen levels on biofilm production. Biofilm formation was significantly higher (P b 0.05) in aerobiosis than in microaerobiosis and anaerobiosis. Cellulose production and RDAR (red, dry, and rough) were expressed only in aerobiosis. In microaerobiosis, the strains expressed the SAW (smooth and white) morphotype, while in anaerobiosis the colonies appeared small and red. The expression of genes involved in cellulose synthesis (csgD and adrA) and quorum sensing (sdiA and luxS) was reduced in microaerobiosis and anaerobiosis in all S. enterica strains tested. This gene expression levels were less reduced in S. Typhimurium and S. Enteritidis compared to the tested serotypes. There was a relationship between the expression of biofilm and quorum sensing-related genes. Thus, the results from this study indicate that biofilm formation and cellulose production are highly influenced by atmospheric conditions. This must be taken into account as contamination with these bacteria can occur during food processing under vacuum or modified atmospheres. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Salmonella enterica subsp. enterica is one of the most important worldwide food-borne pathogens that were responsible for 88,715 cases of salmonellosis in 2014 in the European Union (EFSA, 2015). S. enterica is a facultative anaerobic microorganism that can adapt its metabolism to grow both aerobically and anaerobically. This results in a cyclic lifestyle that combines living in a host in anaerobic conditions with living without a host in aerobic conditions (Winfield and Groisman, 2003). The ability of S. enterica to grow in anaerobic conditions allows it to survive in food packed in low O2 conditions, contributing to the potential associated health problems (Wen and Dickson, 2012). One of the main problems associated with S. enterica is their capacity to form biofilms (Liu et al., 2015). A biofilm is defined as a structured community of microorganisms enclosed in a polymeric matrix that is able to adhere to and live on inert surfaces (Steenackers et al., 2012). Cellulose, one of the principal components of a biofilm, and other substances as curli fimbriae are responsible of the different morphotypes showed by S. enterica in growth media agar containing Congo red. The ⁎ Corresponding author at: Laboratorio de Higiene Inspección y Control de Alimentos, Facultad de Veterinaria, Pabellón 4 p.b., Campus Universitario, 27002 Lugo. Spain. E-mail address: [email protected] (C.M. Franco).
http://dx.doi.org/10.1016/j.ijfoodmicro.2016.08.043 0168-1605/© 2016 Elsevier B.V. All rights reserved.
characteristic RDAR (red, dry, and rough) morphotype, characterized by cellulose and curli fimbriae production, is well studied in S. enterica and allows it to persist in nutrient-limited environments (Chia et al., 2011). In addition, cells showing RDAR are related to biofilm formation on abiotic surfaces (Steenackers et al., 2012). This morphotype is closely related to the csgD and adrA genes, which are responsible for the regulation and expression of cellulose, respectively (Fabrega and Vila, 2013). Another factor related to biofilm formation is quorum sensing or bacterial cell-to-cell communication. The regulation of gene expression in bacteria by quorum sensing is caused by small molecules called autoinducers and results in phenotypic changes that enable bacteria to adapt efficiently to environmental conditions during growth. Thus, quorum-sensing genes, such as sdiA and luxS, play a role in the production of healthy and fully developed biofilms (Bai and Rai, 2011). Concordantly, the expression of these genes plays a key role in biofilm formation by S. enterica. The ability of S. enterica to form biofilms has been well studied in multiple conditions (i.e., varied temperature, nutrients or pH) with the morphotype varying under different temperatures according to conditions and strains (Steenackers et al., 2012). Some recent studies focused on the variation in expression of genes related to biofilm formation as affected by the prevailing environmental conditions (Wang et al., 2016; O'Sullivan et al., 2015). However, to the best of our knowledge, there have been no studies focused on the variability of biofilm
64
A. Lamas et al. / International Journal of Food Microbiology 238 (2016) 63–67
formation, morphotype and gene expression in atmospheres with different O2/CO2 concentrations. Thus, the aim of this study was to evaluate the variability of biofilm formation on polystyrene, cellulose production and expression of genes related to biofilm formation in three different atmospheres (aerobiosis, microaerobiosis and anaerobiosis) due to the ability of S. enterica to grow in all of these conditions and the implications it may have on the food industry.
was rinsed off by placing the microplate under running water. The microplates were air-dried and the dye bound to the adherent bacterial cells was resolubilized in 250 μl portions of 33% glacial acetic acid per well. The optical density (OD) of each well was measured at 630 nm with a Plate Reader (das, Italy). All assays were performed in triplicate in three independent experiments. 2.3. Colony morphology and cellulose production
2. Materials and methods 2.1. Bacterial strains and culture conditions The S. enterica strains utilized in this study are listed in Table 1. A total of 11 strains belonging to four different serotypes of the pathogen with special importance in human infections were used. The strains used were selected according to their previously established capacity for biofilm formation (Lamas et al., 2016). All strains were isolated from the food chain and serotyped using the Kauffman-Whyte typing scheme for the detection of somatic (O) and flagellar (H) antigens, with standard antisera (Bio-Rad Laboratories, California, EEUU). Salmonella CECT 7236 was used as a control in the phenotypic analysis. All isolates tested in this study showed the RDAR morphotype in aerobiosis conditions and possessed the genes studied in the transcription assays. S. enterica growth was examined in Tryptone Soy Broth (TSB, Oxoid Ltd., Hampshire, United Kingdom) incubated for 24 h and 37 °C under three different conditions (aerobiosis, microaerobiosis, and anaerobiosis) using GENbox atmosphere generators (bioMérieux, Marcy-l'Etoile, France). After 24 h incubation the S. enterica growth was quantified by plate count in Tryptone Soy Agar (Oxoid). The oxygen levels in the incubation jars were between 6.2 and 13.2% with microaerophilic generators and b 0.1% with anaerophilic generators. The CO2 levels were between 2.5 and 9.5% in microaerophilic generators and N15% in anaerophilic generators. 2.2. Biofilm formation on polystyrene Biofilm formation in polystyrene was measured in anaerobiosis, microaerobiosis, and anaerobiosis using atmosphere generators and incubation jars (bioMérieux). The method described by Stepanovic et al. (2004) was employed with some modifications. Briefly, the wells of a 96-well flat-bottomed polystyrene microplate were filled with 230 μl of TSB, then a volume of 20 μl of bacterial culture containing 108 cfu/ ml, was added to each well and the plates were incubated for 24 h at 37 °C. After incubation, the content of the plate was poured off and washed three times with 300 μl of distilled water. Then, the bacteria attached to the walls were fixed by adding 250 μl of methanol for 15 min. The plates were emptied and air dried. The wells were stained with 250 μl of 0.1% crystal violet solution for 5 min. Excess crystal violet
Overnight cultures of S. enterica strains grown in TSB were spread on LB agar without salt and supplemented with 40 mg/l of Congo red (Sigma-Aldrich, Germany) and 20 mg/l of Coomassie brilliant blue (Sigma-Aldrich). Cellulose production was determined using an LB supplement with 200 mg/l of calcofluor (Sigma-Aldrich). The colony morphology and cellulose production was determined after 72 h of incubation at 28 °C. Cellulose was detected by visual evaluation under UV light at 366 nm. All assays were performed in triplicate in three independent experiments. 2.4. Expression of biofilm and quorum sensing-related genes The expression of csgD, adrA, sdiA and luxS was evaluated in all strains under the three atmospheric conditions tested. RNA was extracted using the UltraClean® Microbial RNA Isolation Kit (MoBio, USA) following the manufacturer's recommendations. The RNA extraction procedure was performed in duplicate. RNA was analyzed for concentration and quality using BioDrop μLITE (BioDrop, UK). RNA samples were stored at −80 °C until further use. The RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, USA) according to the manufacturer's instructions. The PCR assays (10 μl) containing 5 μl of 2 × SYBR Green (Applied Biosystems), 0.4 μl of each primer (Table 2) (10 mM), 1 μl of cDNA template and 3.2 μl of RNase-free water were amplified using the QuantStudio™ 12 K Flex Real-Time PCR system (Applied Biosystems). The thermocycling conditions were as follows: initial denaturation at 95 °C for 20 s, followed by 40 cycles of denaturation at 95 °C for 1 s, annealing at 60 °C for 20 s and a final melting curve program of 15 s at 95 °C, 60 s at 60 °C followed by a dissociation step for 15 s at 95 °C. The mRNA levels of the target genes were normalized to the mRNA levels of the reference gene for 16S rRNA, used as an internal control because it is constitutively expressed under a wide range of conditions. The target genes' expression levels in comparison to the internal 16 s rRNA control were evaluated with the 2− ΔΔCt method (Livak and Schmittgen, 2001), where ΔΔCt = (Ct target genes-Ct 16s rRNA)treatment – (Ct target genes-Ct 16s rRNA)control. Three experimental and three technical replicates were used to determine the relative fold change.
Table 1 Salmonella enterica serotypes used in the study and biofilm formation and morphotype showed under different atmospheres. Results are expressed as average ± standard deviation (SD). Different letters (a–c) in the same row differ significantly (P b 0.05). Biofilm formation Strains S. Typhimurium T1 S. Typhimurium T2 S. Typhimurium T14 S. Enteritidis ET1 S. Enteritidis ET2 S. Infantis I1 S. Infantis I2 S. Infantis I3 S. Newport N2 S. Newport N4 S. Newport N5 Average
Aerobiosis
Morphotype Microaerobiosis
a
0.252 ± 0.034 0.245 ± 0.048a 0.422 ± 0.048a 0.303 ± 0.018a 0.216 ± 0.017a 0.259 ± 0.0024a 0.254 ± 0.067a 0.283 ± 0.053a 0.262 ± 0.008a 0.195 ± 0.008a 0.389 ± 0.021a 0.280 ± 0.074a
b
0.178 ± 0.030 0.135 ± 0.021b 0.201 ± 0.022b 0.115 ± 0.006b 0.152 ± 0,023b 0.169 ± 0.029b 0.129 ± 0.012b 0.124 ± 0.015b 0.162 ± 0.047b 0.118 ± 0.005b 0.137 ± 0.016b 0.147 ± 0.034b
Anaerobiosis c
0.117 ± 0.006 0.079 ± 0.004b 0.200 ± 0.026b 0.086 ± 0.005c 0.091 ± 0.019c 0.109 ± 0.004c 0.107 ± 0.009b 0.103 ± 0.005b 0.082 ± 0.003c 0.104 ± 0.009b 0.084 ± 0.002c 0.106 ± 0.037c
Aerobiosis
Microaerobiosis
Anaerobiosis
RDAR RDAR RDAR RDAR RDAR RDAR RDAR RDAR RDAR RDAR RDAR
SAW SAW SAW SAW SAW SAW SAW SAW SAW SAW SAW
– – – – – – – – – – –
A. Lamas et al. / International Journal of Food Microbiology 238 (2016) 63–67 Table 2 Primers sequences of biofilm related and quorum sensing genes used in this study. Target genes
Sequence (5′–3′)
Reference
16s rRNA
F: AGGCCTTCGGGTTGTAAAGT R: GTTAGCCGGTGCTTCTTCTG F: TCCTGGTCTTCAGTAGCGTAA R: TATGATGGA AGCGGATAAGAA F: GAAGCTCGTCGCTGGAAGTC R: TTCCGCTTAATTTAATGGCCG F: AATATCGCTTCGTACCAC R: GTAGGTAAACGAGGAGCAG F: ATGCCATTATTAGATAGCTT R:GAGATGGTCGCGCATAAAGCCAGC
Lee et al. (2009)
csgD adrA sdiA luxS
Barak et al. (2005) Latasa et al. (2005) Halatsi et al. (2006) Karavolos et al. (2008)
2.5. Statistical analysis Statistical analyses were performed using SPSS software for windows (SPSS Inc., Chicago, USA). Analysis of variance (ANOVA) was used to study the influence of the atmosphere on biofilm formation on polystyrene and gene expression. Correlations of gene expression in the atmospheres tested were calculated by the bivariate correlations method (Pearson's coefficients) with a level of significance of P b 0.05.
65
of adrA, this expression was not affected as much as that of the other genes studied. Thus, the fold change for adrA in microaerobiosis and anaerobiosis were significantly lower (P b 0.05) than fold change for csgD, luxS and sdiA. Among the serotypes analyzed, significant difference (P b 0.05) was only observed with regard to luxS expression in microaerobiosis between S. Typhimurium and S. Newport. However, the fold change of the target genes for S. Typhimurium and S. Enteritidis in microaerobiosis (Fig. 2) and anaerobiosis (Fig. 3) was lower than for the others serotypes. A correlation analysis was carried out to determine the relationship between the selected gene expression levels (Table 3). In microaerobiosis, there was a positive correlation with downregulation of csgD, luxS and sdiA expression. In anaerobiosis, there was a positive correlation with downregulation of csgD and luxS expression. As expected, all S. enterica strains tested showed the RDAR morphotype in the aerobiosis condition. Thus, the strains possessed curli fimbriae and formed cellulose as determined by their fluorescence on calcofluor agar under aerobiosis. All strains showed the SAW morphotype (smooth and white) in microaerobiosis. Therefore, the isolates did not express curli fimbriae or cellulose, which was confirmed by UV using Luria Bertani (LB) calcofluor. In anaerobiosis, small red colonies appeared in the Congo red agar and no cellulose production was detected (Fig. 4). 4. Discussion
3. Results There were no significant differences (P = 0.05) among the 11 tested S. enterica strains with regard to their growth in TSB under the three different atmospheric conditions studied after 24 h incubation. However, biofilm formation on polystyrene was significantly higher in aerobiosis (P b 0.05) compared to the other two atmospheres in all of the strains tested. Likewise, seven strains formed significantly more biofilms under microaerobiosis than anaerobiosis (Table 1). The result of this study showed that the expression levels of these genes were significantly (P b 0.05) reduced in microaerobiosis and anaerobiosis compared to aerobiosis (considered as a control) (Fig. 1). In all of the S. enterica strains tested, the target genes were downregulated in microaerobiosis and anaerobiosis related to aerobic conditions. The gene expression levels decreased more in microaerobiosis than in anaerobiosis but there was no significant difference between these two conditions. Although oxygen levels significantly affected the expression
Fig. 1. Fold change normalized to reference gene 16S in the expression of biofilm- and quorum-sensing genes in microaerobiosis (micro) and anaerobiosis (ana) relative to aerobiosis. Error bars represent the standard error. Asterisks represent statistically significant differences (P b 0.05) in fold change relative to aerobic conditions.
S. enterica has a cyclic lifestyle that combines host colonization with survival in a particular environment. This implies that this pathogen can adapt rapidly from an anaerobic to an aerobic metabolism in order to survive (Encheva et al., 2009). Preliminary studies of the growth of tested isolates in TSB under the three atmospheres were performed after 24 h of incubation. The purpose of this study was determine if the different atmospheres modify the growth and the normal development of these strains, which could influence biofilm formation under the different conditions tested. The results showed no significant differences (P = 0.05), which indicates that lower formation of biofilm in microaerobiosis and anaerobiosis conditions is not due to reduced growth of the strains. Phippen and Oliver (2015) reported similar results in a study that tested the growth of Vibrio vulnificus in aerobiosis and anaerobiosis. These researchers observed differences in OD610 in liquid growth medium, but when this growth medium was plated and
Fig. 2. Fold change normalized to reference gene 16S in the expression of biofilm- and quorum-sensing genes in microaerobiosis relative to aerobiosis according to serotype. Error bars represent the standard error. Different letters in the same target gene represent statistically significant differences (P b 0.05) between serotypes.
66
A. Lamas et al. / International Journal of Food Microbiology 238 (2016) 63–67
Fig. 3. Fold change normalized to reference gene 16S in the expression of biofilm- and quorum-sensing genes in anaerobiosis (ana) relative to aerobiosis according to serotype. Error bars represent the standard error.
counted there were no significant differences. The authors explained that the discrepancy could be due to a smaller cell size when grown in anaerobiosis. This explanation was supported in this study by the observation of smaller colonies in anaerobiosis conditions on Congo red plates. The ability of S. enterica to form biofilms is a matter of concern in the food industry as well as in clinical microbiology. Microorganisms in biofilms are more protected against environmental stresses, antibiotics, disinfectants, and host immune systems than the planktonic cells (Jensen et al., 2010). Thus, the ability to form biofilms is an important virulence factor. In aerobiosis, all strains tested reached the highest OD630 value in the microtiter assay. However, these results were very different when oxygen levels decreased, with lower biofilm formation on polystyrene plates. Reuter et al. (2010) also found increased biofilm formation in Campylobacter in aerobiosis conditions. However, Campylobacter has a microaerobic metabolism and aerobiosis conditions are stressful for this microorganism, which could explain why biofilm formation is a survival strategy for cells growing in an aerobic environment (Reuter et al., 2010). In addition, in a study carried out with Staphylococcus aureus strains, Hess et al. (2013) reported less biofilm formation in anaerobiosis conditions than in aerobic conditions. Biofilm formation in S. enterica is regulated by different genes. The csgD gene contributes to biofilm production by its important role in synchronizing the expression of several determinants of this process. Also, the sdiA and luxS quorum-sensing genes play a role in biofilm formation by S. enterica. Expression of the adrA gene is associated with increased levels of the signaling molecule cyclic di-GMP, which mediates the posttranscriptional activation of cellulose biosynthesis. Thus, adrA is important in biofilm formation by regulating cellulose synthesis through c-diGMP, which is an important bacterial secondary messenger regulating
multicellular behavior (Steenackers et al., 2012). Therefore, its influence on other important cellular mechanisms may be the cause of the lower reduction in its expression under the different conditions observed in this study. S. Typhimurium and S. Enteritidis are the principal serovars responsible of S. enterica infections in humans (EFSA, 2015). Thus, the smallest decrease in the expression of genes may be related to the virulence of these serovars, which are in anaerobic conditions in the host. Thus, the lower fold change in quorum sensing genes in S. Typhimurium and S. Enteritidis could be due to their regulatory role in the expression of virulence genes (Bai and Rai, 2011). It has also been observed that the transcription of biofilm-related genes is influenced by environmental factors such as acidic or low-nutrient conditions (O'Leary et al., 2015; Wang et al., 2016). In concordance, the results of our study suggest that the expression of biofilm-related genes was clearly influenced by the atmospheric conditions in which the strains grew. Likewise, Phippen and Oliver (2015) found that the transcription of biofilmrelated genes was downregulated when V. vulnificus was cultured under anaerobic conditions. Our study showed a positive correlation in csgD, luxS and sdiA expression. These results suggest a relationship between the expression of biofilm and quorum sensing-related genes. Wang et al. (2016) found similar results after testing the same genes in different culture media, implying a joint expression of these genes. S. enterica is in aerobiosis conditions when the bacteria survive outside the host. In these environmental conditions, biofilm formation is an important resource for survival (Fabrega and Vila, 2013). Thus, as this study shows, when S. enterica strains are cultured aerobically, the genetic machinery that allows the production of cellulose and curli is induced. In this sense, Bayer et al. (1990) observed that Pseudomonas aeruginosa increased the production of extracellular polymeric substances by increasing oxygen levels. However, when oxygen rates decrease, the expression of this machinery is modified as a result of gene transcription. All strains tested in this study showed SAW morphotype in microaerobiosis. However, none of the S. enterica morphotypes observed in previous studies (Chia et al., 2011; Lamas et al., 2016; Steenackers et al., 2012) appeared in the Congo red plates incubated in anaerobiosis. In these conditions, small red colonies were observed, indicating that the production of cellulose was blocked and the colony size was reduced. These results, along with gene expression analyses, show that S. enterica can modulate its morphotype depending on atmospheric conditions. This could be an evolutionary mechanism that allows the production of cellulose when S. enterica is outside the host and represses cellulose production inside the host, promoting its virulence by c-di-GMP regulation and repressing the production of cellulose as an antivirulence trait (Pontes et al., 2015). Variation in biofilm formation on polystyrene and in the morphotype is not only important from a microbiological point of view. From a food technology standpoint, the reduction of biofilm formation and the repression of cellulose production under microaerobiosis and anaerobiosis conditions is an advantage. Currently, there are some food packaging technologies where oxygen levels are low. For example, modified atmosphere packaging (MAP), which can use CO2 as an active gas in low O2 packaging, is widely utilized in food preservation (Nair et al., 2015; Zhou et al., 2015). For example, vacuum packaging with low O2 is used for meat preservation (Zhou et al., 2010). S. enterica does not produce cellulose in these conditions, as observed in this study. This could allow that
Table 3 Pearson's coefficients of correlation between the expression levels of each gene in microaerobiosis and anaerobiosis compared to aerobiosis. Microaerobiosis csgD adrA luxS sdiA ⁎ P b 0.05. ⁎⁎ P b 0.01.
csgD 1
adrA
luxS
sdiA
−0.021 1
0.798⁎⁎
0.664⁎ −0.194 0.658⁎⁎ 1
0.264 1
Anaerobiosis csgD adrA luxS sdiA
csgD 1
adrA
luxS
sdiA
−0.165 1
0.918⁎⁎
0.035 0.015 0.237 1
−0.142 1
A. Lamas et al. / International Journal of Food Microbiology 238 (2016) 63–67
67
Fig. 4. Morphotype of S. enterica in Congo red agar under the three conditions tested: aerobiosis (a), microaerobiosis (b) and anaerobiosis (c).
some food preservatives act more easily against S. enterica due to the absence of cellulose and a lower biofilm formation, which would prevent the growth of this pathogen on food. Similarly, films with antimicrobial substances are becoming important (Herzallah and Holley, 2015). The use of these films in an atmosphere that inhibits biofilm formation would improve their efficiency. In food industry, controlled atmospheric storage is used to preserve food (Deuchande et al., 2016). The use of low oxygen levels in these facilities could prevent biofilm formation by S. enterica and make it difficult their persistence. However, it must also be taken into account that lower biofilm formation in anaerobiosis conditions during food packaging could indicate that other pathogenic mechanisms in these bacteria may be more active. Moreover, the use of high O2 levels in packs is employed in the meat industry to promote oxymyoglobin development (O'Sullivan et al., 2015), which gives the meat a consumer acceptable color. The results of this study showed that biofilm formation in polystyrene was influenced by oxygen levels. Thus, food packaging with levels of atmospheric oxygen or higher values could enhance biofilm formation and facilitate the survival of S. enterica. 5. Conclusion This study demonstrates that S. enterica biofilm formation and cellulose production is directly associated with atmospheric conditions in all strains tested. This is supported by the inhibition of biofilm-related gene expression as atmospheric oxygen levels decreased. In addition, a positive correlation in the expression of biofilm and quorum sensing-related genes indicates that environmental conditions similarly affect the expression of these genes. As this study showed, test standard conditions can yield results not entirely valid. Therefore, in biofilm formation studies is important to consider the different types of metabolism that the microorganisms can use. Further analyses are necessary to demonstrate the cellular mechanisms involved in this variation and their implications for gut colonization by S. enterica, their virulence in the host and their persistence in food packed with low O2 concentrations. Food is a complex matrix with a variable microbiota that interacts between each other. In the future, more studies are needed to understand the influence of food and other microorganisms in the capacity of S. enterica to form biofilm. This knowledge should be transferred to other food-borne pathogens to elucidate their behavior in biofilm formation under different atmospheres. Thus, it would interesting to see the expression of biofilm and quorum sensing related genes and cellulose production in mixed biofilms composed by different pathogens. The results show that the food industry should be take special care when modified atmospheres are used due to its influence on the persistence of pathogens by forming biofilms. References Bai, A.J., Rai, V.R., 2011. Bacterial quorum sensing and food industry. Compr. Rev. Food Sci. Food Saf. 10, 183–193. Bayer, A.S., Eftekhar, F., Tu, J., Nast, C.C., Speert, D.P., 1990. Oxygen-dependent upregulation of mucoid exopolysaccharide (alginate) production in Pseudomonas aeruginosa. Infect. Immun. 58, 1344–1349.
Chia, T.W.R., McMeekin, T.A., Fegan, N., Dykes, G.A., 2011. Significance of the rdar and bdar morphotypes in the hydrophobicity and attachment to abiotic surfaces of Salmonella Sofia and other poultry-associated Salmonella serovars. Lett. Appl. Microbiol. 53, 581–584. Deuchande, T., Carvalho, S.M.P., Guterres, U., Fidalgo, F., Isidoro, N., Larrigaudiere, C., Vasconcelos, M.W., 2016. Dynamic controlled atmosphere for prevention of internal browning disorders in ‘Rocha’ pear. LWT-Food Sci. Technol. 65, 725–730. EFSA (European Food Safety Authority), ECDC (European Centre for Disease Prevention and Control), 2015r. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014. EFSA J. 13, 4329. Encheva, V., Shah, H.N., Gharbia, S.E., 2009. Proteomic analysis of the adaptive response of Salmonella enterica serovar typhimurium to growth under anaerobic conditions. Microbiol.-SGM 155, 2429–2441. Fabrega, A., Vila, J., 2013. Salmonella enterica serovar typhimurium skills to succeed in the host: virulence and regulation. Clin. Microbiol. Rev. 26, 308–341. Herzallah, S., Holley, R., 2015. Use of a nanoparticulate carboxymethyl cellulose film containing sinigrin as an antimicrobial precursor to kill Escherichia coli O157:H7 on fresh beef. Lett. Appl. Microbiol. 61, 139–145. Hess, D.J., Henry-Stanley, M.J., Lusczek, E.R., Beilman, G.J., Wells, C.L., 2013. Anoxia inhibits biofilm development and modulates antibiotic activity. J. Surg. Res. 184, 488–494. Jensen, P.O., Givskov, M., Bjarnsholt, T., Moser, C., 2010. The immune system vs. Pseudomonas aeruginosa biofilms. FEMS Immunol. Med. Mic. 59, 292–305. Lamas, A., Fernández-No, I.C., Miranda, J.M., Vázquez, B., Cepeda, A., Franco, C.M., 2016. Biofilm formation and morphotypes of Salmonella enterica subspecies arizonae differs from those of other Salmonella enterica subspecies in isolates from poultry houses. J. Food. Protect. 79, 1073–1300. Liu, Q., Niu, H., Zhang, W., Mu, H., Sun, C., Duan, J., 2015. Synergy among thymol, eugenol, berberine, cinnamaldehyde and streptomycin against planktonic and biofilmassociated food-borne pathogens. Lett. Appl. Microbiol. 60, 421–430. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402–408. Nair, D.V.T., Kiess, A., Nannapaneni, R., Schilling, W., Sharma, C.S., 2015. The combined efficacy of carvacrol and modified atmosphere packaging on the survival of Salmonella, Campylobacter jejuni and lactic acid bacteria on Turkey breast cutlets. Food Microbiol. 49, 134–141. O'Leary, D., McCabe, E.M., McCusker, M.P., Martins, M., Fanning, S., Duffy, G., 2015. Acid environments affect biofilm formation and gene expression in isolates of Salmonella enterica typhimurium DT104. Int. J. Food Microbiol. 206, 7–16. O'Sullivan, M.G., Le Floch, S., Kerry, J.P., 2015. Resting of MAP (modified atmosphere packed) beef steaks prior to cooking and effects on consumer quality. Meat Sci. 101, 13–18. Phippen, B.L., Oliver, J.D., 2015. Role of anaerobiosis in capsule production and biofilm formation in Vibrio vulnificus. Infect. Inmun. 83, 551–559. Pontes, M.H., Lee, E.J., Choi, J., Groisman, E.A., 2015. Salmonella promotes virulence by repressing cellulose production. P. Natl. Acad. Sci. USA 16, 5183–5188. Reuter, M., Mallett, A., Pearson, B.M., van Vliet, A.H.M., 2010. Biofilm formation by Campylobacter jejuni is increased under aerobic conditions. Appl. Environ. Microb. 76, 2122–2128. Steenackers, H., Hermans, K., Vanderleyden, J., De Keersmaecker, S.C.J., 2012. Salmonella biofilms: an overview on occurrence, structure, regulation and eradication. Food Res. Int. 45, 502–531. Stepanovic, S., Cirkovic, I., Ranin, L., Svabic-Vlahovic, M., 2004. Biofilm formation by Salmonella spp. and Listeria monocytogenes on plastic surface. Lett. Appl. Microbiol. 38, 428–432. Wang, H.H., Dong, Y., Wang, G.Y., Xu, X.L., Zhou, G.H., 2016. Effect of growth media on gene expression levels in Salmonella typhimurium biofilm formed on stainless steel surface. Food Control 59, 546–552. Wen, X.S., Dickson, J.S., 2012. Survival of Campylobacter jejuni and Salmonella enterica typhimurium in vacuum-packed, moisture-enhanced pork. J. Food Protect. 75, 576–579. Winfield, M.D., Groisman, E.A., 2003. Role of nonhost environments in the lifestyles of Salmonella and Escherichia coli. Appl. Environ. Microb. 69, 3687–3694. Zhou, G.H., Xu, X.L., Liu, Y., 2010. Preservation technologies for fresh meat - a review. Meat Sci. 86, 119–128. Zhou, S.Y., Sheen, S., Pang, Y.H., Liu, L.S., Yam, K.L., 2015. Modeling the impact of vapor thymol concentration, temperature, and modified atmosphere condition on growth behavior of Salmonella on raw shrimp. J. Food Protect. 78, 293–301.
Contents lists available at ScienceDirect
International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro
Biofilm formation, phenotypic production of cellulose and gene expression in Salmonella enterica decrease under anaerobic conditions A. Lamas, J.M. Miranda, B. Vázquez, A. Cepeda, C.M. Franco ⁎ Laboratorio de Higiene Inspección y Control de Alimentos, Departamento de Química Analítica, Nutrición y Bromatología, Universidad de Santiago de Compostela, 27002 Lugo, Spain
a r t i c l e
i n f o
Article history: Received 2 June 2016 Received in revised form 28 August 2016 Accepted 29 August 2016 Available online 31 August 2016 Keywords: Salmonella Biofilm Food safety Morphotype Gene expression
a b s t r a c t Salmonella enterica subsp. enterica is one of the main food-borne pathogens. This microorganism combines an aerobic life outside the host with an anaerobic life within the host. One of the main concerns related to S. enterica is biofilm formation and cellulose production. In this study, biofilm formation, morphotype, cellulose production and transcription of biofilm and quorum sensing-related genes of 11 S. enterica strains were tested under three different conditions: aerobiosis, microaerobiosis, and anaerobiosis. The results showed an influence of oxygen levels on biofilm production. Biofilm formation was significantly higher (P b 0.05) in aerobiosis than in microaerobiosis and anaerobiosis. Cellulose production and RDAR (red, dry, and rough) were expressed only in aerobiosis. In microaerobiosis, the strains expressed the SAW (smooth and white) morphotype, while in anaerobiosis the colonies appeared small and red. The expression of genes involved in cellulose synthesis (csgD and adrA) and quorum sensing (sdiA and luxS) was reduced in microaerobiosis and anaerobiosis in all S. enterica strains tested. This gene expression levels were less reduced in S. Typhimurium and S. Enteritidis compared to the tested serotypes. There was a relationship between the expression of biofilm and quorum sensing-related genes. Thus, the results from this study indicate that biofilm formation and cellulose production are highly influenced by atmospheric conditions. This must be taken into account as contamination with these bacteria can occur during food processing under vacuum or modified atmospheres. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Salmonella enterica subsp. enterica is one of the most important worldwide food-borne pathogens that were responsible for 88,715 cases of salmonellosis in 2014 in the European Union (EFSA, 2015). S. enterica is a facultative anaerobic microorganism that can adapt its metabolism to grow both aerobically and anaerobically. This results in a cyclic lifestyle that combines living in a host in anaerobic conditions with living without a host in aerobic conditions (Winfield and Groisman, 2003). The ability of S. enterica to grow in anaerobic conditions allows it to survive in food packed in low O2 conditions, contributing to the potential associated health problems (Wen and Dickson, 2012). One of the main problems associated with S. enterica is their capacity to form biofilms (Liu et al., 2015). A biofilm is defined as a structured community of microorganisms enclosed in a polymeric matrix that is able to adhere to and live on inert surfaces (Steenackers et al., 2012). Cellulose, one of the principal components of a biofilm, and other substances as curli fimbriae are responsible of the different morphotypes showed by S. enterica in growth media agar containing Congo red. The ⁎ Corresponding author at: Laboratorio de Higiene Inspección y Control de Alimentos, Facultad de Veterinaria, Pabellón 4 p.b., Campus Universitario, 27002 Lugo. Spain. E-mail address: [email protected] (C.M. Franco).
http://dx.doi.org/10.1016/j.ijfoodmicro.2016.08.043 0168-1605/© 2016 Elsevier B.V. All rights reserved.
characteristic RDAR (red, dry, and rough) morphotype, characterized by cellulose and curli fimbriae production, is well studied in S. enterica and allows it to persist in nutrient-limited environments (Chia et al., 2011). In addition, cells showing RDAR are related to biofilm formation on abiotic surfaces (Steenackers et al., 2012). This morphotype is closely related to the csgD and adrA genes, which are responsible for the regulation and expression of cellulose, respectively (Fabrega and Vila, 2013). Another factor related to biofilm formation is quorum sensing or bacterial cell-to-cell communication. The regulation of gene expression in bacteria by quorum sensing is caused by small molecules called autoinducers and results in phenotypic changes that enable bacteria to adapt efficiently to environmental conditions during growth. Thus, quorum-sensing genes, such as sdiA and luxS, play a role in the production of healthy and fully developed biofilms (Bai and Rai, 2011). Concordantly, the expression of these genes plays a key role in biofilm formation by S. enterica. The ability of S. enterica to form biofilms has been well studied in multiple conditions (i.e., varied temperature, nutrients or pH) with the morphotype varying under different temperatures according to conditions and strains (Steenackers et al., 2012). Some recent studies focused on the variation in expression of genes related to biofilm formation as affected by the prevailing environmental conditions (Wang et al., 2016; O'Sullivan et al., 2015). However, to the best of our knowledge, there have been no studies focused on the variability of biofilm
64
A. Lamas et al. / International Journal of Food Microbiology 238 (2016) 63–67
formation, morphotype and gene expression in atmospheres with different O2/CO2 concentrations. Thus, the aim of this study was to evaluate the variability of biofilm formation on polystyrene, cellulose production and expression of genes related to biofilm formation in three different atmospheres (aerobiosis, microaerobiosis and anaerobiosis) due to the ability of S. enterica to grow in all of these conditions and the implications it may have on the food industry.
was rinsed off by placing the microplate under running water. The microplates were air-dried and the dye bound to the adherent bacterial cells was resolubilized in 250 μl portions of 33% glacial acetic acid per well. The optical density (OD) of each well was measured at 630 nm with a Plate Reader (das, Italy). All assays were performed in triplicate in three independent experiments. 2.3. Colony morphology and cellulose production
2. Materials and methods 2.1. Bacterial strains and culture conditions The S. enterica strains utilized in this study are listed in Table 1. A total of 11 strains belonging to four different serotypes of the pathogen with special importance in human infections were used. The strains used were selected according to their previously established capacity for biofilm formation (Lamas et al., 2016). All strains were isolated from the food chain and serotyped using the Kauffman-Whyte typing scheme for the detection of somatic (O) and flagellar (H) antigens, with standard antisera (Bio-Rad Laboratories, California, EEUU). Salmonella CECT 7236 was used as a control in the phenotypic analysis. All isolates tested in this study showed the RDAR morphotype in aerobiosis conditions and possessed the genes studied in the transcription assays. S. enterica growth was examined in Tryptone Soy Broth (TSB, Oxoid Ltd., Hampshire, United Kingdom) incubated for 24 h and 37 °C under three different conditions (aerobiosis, microaerobiosis, and anaerobiosis) using GENbox atmosphere generators (bioMérieux, Marcy-l'Etoile, France). After 24 h incubation the S. enterica growth was quantified by plate count in Tryptone Soy Agar (Oxoid). The oxygen levels in the incubation jars were between 6.2 and 13.2% with microaerophilic generators and b 0.1% with anaerophilic generators. The CO2 levels were between 2.5 and 9.5% in microaerophilic generators and N15% in anaerophilic generators. 2.2. Biofilm formation on polystyrene Biofilm formation in polystyrene was measured in anaerobiosis, microaerobiosis, and anaerobiosis using atmosphere generators and incubation jars (bioMérieux). The method described by Stepanovic et al. (2004) was employed with some modifications. Briefly, the wells of a 96-well flat-bottomed polystyrene microplate were filled with 230 μl of TSB, then a volume of 20 μl of bacterial culture containing 108 cfu/ ml, was added to each well and the plates were incubated for 24 h at 37 °C. After incubation, the content of the plate was poured off and washed three times with 300 μl of distilled water. Then, the bacteria attached to the walls were fixed by adding 250 μl of methanol for 15 min. The plates were emptied and air dried. The wells were stained with 250 μl of 0.1% crystal violet solution for 5 min. Excess crystal violet
Overnight cultures of S. enterica strains grown in TSB were spread on LB agar without salt and supplemented with 40 mg/l of Congo red (Sigma-Aldrich, Germany) and 20 mg/l of Coomassie brilliant blue (Sigma-Aldrich). Cellulose production was determined using an LB supplement with 200 mg/l of calcofluor (Sigma-Aldrich). The colony morphology and cellulose production was determined after 72 h of incubation at 28 °C. Cellulose was detected by visual evaluation under UV light at 366 nm. All assays were performed in triplicate in three independent experiments. 2.4. Expression of biofilm and quorum sensing-related genes The expression of csgD, adrA, sdiA and luxS was evaluated in all strains under the three atmospheric conditions tested. RNA was extracted using the UltraClean® Microbial RNA Isolation Kit (MoBio, USA) following the manufacturer's recommendations. The RNA extraction procedure was performed in duplicate. RNA was analyzed for concentration and quality using BioDrop μLITE (BioDrop, UK). RNA samples were stored at −80 °C until further use. The RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, USA) according to the manufacturer's instructions. The PCR assays (10 μl) containing 5 μl of 2 × SYBR Green (Applied Biosystems), 0.4 μl of each primer (Table 2) (10 mM), 1 μl of cDNA template and 3.2 μl of RNase-free water were amplified using the QuantStudio™ 12 K Flex Real-Time PCR system (Applied Biosystems). The thermocycling conditions were as follows: initial denaturation at 95 °C for 20 s, followed by 40 cycles of denaturation at 95 °C for 1 s, annealing at 60 °C for 20 s and a final melting curve program of 15 s at 95 °C, 60 s at 60 °C followed by a dissociation step for 15 s at 95 °C. The mRNA levels of the target genes were normalized to the mRNA levels of the reference gene for 16S rRNA, used as an internal control because it is constitutively expressed under a wide range of conditions. The target genes' expression levels in comparison to the internal 16 s rRNA control were evaluated with the 2− ΔΔCt method (Livak and Schmittgen, 2001), where ΔΔCt = (Ct target genes-Ct 16s rRNA)treatment – (Ct target genes-Ct 16s rRNA)control. Three experimental and three technical replicates were used to determine the relative fold change.
Table 1 Salmonella enterica serotypes used in the study and biofilm formation and morphotype showed under different atmospheres. Results are expressed as average ± standard deviation (SD). Different letters (a–c) in the same row differ significantly (P b 0.05). Biofilm formation Strains S. Typhimurium T1 S. Typhimurium T2 S. Typhimurium T14 S. Enteritidis ET1 S. Enteritidis ET2 S. Infantis I1 S. Infantis I2 S. Infantis I3 S. Newport N2 S. Newport N4 S. Newport N5 Average
Aerobiosis
Morphotype Microaerobiosis
a
0.252 ± 0.034 0.245 ± 0.048a 0.422 ± 0.048a 0.303 ± 0.018a 0.216 ± 0.017a 0.259 ± 0.0024a 0.254 ± 0.067a 0.283 ± 0.053a 0.262 ± 0.008a 0.195 ± 0.008a 0.389 ± 0.021a 0.280 ± 0.074a
b
0.178 ± 0.030 0.135 ± 0.021b 0.201 ± 0.022b 0.115 ± 0.006b 0.152 ± 0,023b 0.169 ± 0.029b 0.129 ± 0.012b 0.124 ± 0.015b 0.162 ± 0.047b 0.118 ± 0.005b 0.137 ± 0.016b 0.147 ± 0.034b
Anaerobiosis c
0.117 ± 0.006 0.079 ± 0.004b 0.200 ± 0.026b 0.086 ± 0.005c 0.091 ± 0.019c 0.109 ± 0.004c 0.107 ± 0.009b 0.103 ± 0.005b 0.082 ± 0.003c 0.104 ± 0.009b 0.084 ± 0.002c 0.106 ± 0.037c
Aerobiosis
Microaerobiosis
Anaerobiosis
RDAR RDAR RDAR RDAR RDAR RDAR RDAR RDAR RDAR RDAR RDAR
SAW SAW SAW SAW SAW SAW SAW SAW SAW SAW SAW
– – – – – – – – – – –
A. Lamas et al. / International Journal of Food Microbiology 238 (2016) 63–67 Table 2 Primers sequences of biofilm related and quorum sensing genes used in this study. Target genes
Sequence (5′–3′)
Reference
16s rRNA
F: AGGCCTTCGGGTTGTAAAGT R: GTTAGCCGGTGCTTCTTCTG F: TCCTGGTCTTCAGTAGCGTAA R: TATGATGGA AGCGGATAAGAA F: GAAGCTCGTCGCTGGAAGTC R: TTCCGCTTAATTTAATGGCCG F: AATATCGCTTCGTACCAC R: GTAGGTAAACGAGGAGCAG F: ATGCCATTATTAGATAGCTT R:GAGATGGTCGCGCATAAAGCCAGC
Lee et al. (2009)
csgD adrA sdiA luxS
Barak et al. (2005) Latasa et al. (2005) Halatsi et al. (2006) Karavolos et al. (2008)
2.5. Statistical analysis Statistical analyses were performed using SPSS software for windows (SPSS Inc., Chicago, USA). Analysis of variance (ANOVA) was used to study the influence of the atmosphere on biofilm formation on polystyrene and gene expression. Correlations of gene expression in the atmospheres tested were calculated by the bivariate correlations method (Pearson's coefficients) with a level of significance of P b 0.05.
65
of adrA, this expression was not affected as much as that of the other genes studied. Thus, the fold change for adrA in microaerobiosis and anaerobiosis were significantly lower (P b 0.05) than fold change for csgD, luxS and sdiA. Among the serotypes analyzed, significant difference (P b 0.05) was only observed with regard to luxS expression in microaerobiosis between S. Typhimurium and S. Newport. However, the fold change of the target genes for S. Typhimurium and S. Enteritidis in microaerobiosis (Fig. 2) and anaerobiosis (Fig. 3) was lower than for the others serotypes. A correlation analysis was carried out to determine the relationship between the selected gene expression levels (Table 3). In microaerobiosis, there was a positive correlation with downregulation of csgD, luxS and sdiA expression. In anaerobiosis, there was a positive correlation with downregulation of csgD and luxS expression. As expected, all S. enterica strains tested showed the RDAR morphotype in the aerobiosis condition. Thus, the strains possessed curli fimbriae and formed cellulose as determined by their fluorescence on calcofluor agar under aerobiosis. All strains showed the SAW morphotype (smooth and white) in microaerobiosis. Therefore, the isolates did not express curli fimbriae or cellulose, which was confirmed by UV using Luria Bertani (LB) calcofluor. In anaerobiosis, small red colonies appeared in the Congo red agar and no cellulose production was detected (Fig. 4). 4. Discussion
3. Results There were no significant differences (P = 0.05) among the 11 tested S. enterica strains with regard to their growth in TSB under the three different atmospheric conditions studied after 24 h incubation. However, biofilm formation on polystyrene was significantly higher in aerobiosis (P b 0.05) compared to the other two atmospheres in all of the strains tested. Likewise, seven strains formed significantly more biofilms under microaerobiosis than anaerobiosis (Table 1). The result of this study showed that the expression levels of these genes were significantly (P b 0.05) reduced in microaerobiosis and anaerobiosis compared to aerobiosis (considered as a control) (Fig. 1). In all of the S. enterica strains tested, the target genes were downregulated in microaerobiosis and anaerobiosis related to aerobic conditions. The gene expression levels decreased more in microaerobiosis than in anaerobiosis but there was no significant difference between these two conditions. Although oxygen levels significantly affected the expression
Fig. 1. Fold change normalized to reference gene 16S in the expression of biofilm- and quorum-sensing genes in microaerobiosis (micro) and anaerobiosis (ana) relative to aerobiosis. Error bars represent the standard error. Asterisks represent statistically significant differences (P b 0.05) in fold change relative to aerobic conditions.
S. enterica has a cyclic lifestyle that combines host colonization with survival in a particular environment. This implies that this pathogen can adapt rapidly from an anaerobic to an aerobic metabolism in order to survive (Encheva et al., 2009). Preliminary studies of the growth of tested isolates in TSB under the three atmospheres were performed after 24 h of incubation. The purpose of this study was determine if the different atmospheres modify the growth and the normal development of these strains, which could influence biofilm formation under the different conditions tested. The results showed no significant differences (P = 0.05), which indicates that lower formation of biofilm in microaerobiosis and anaerobiosis conditions is not due to reduced growth of the strains. Phippen and Oliver (2015) reported similar results in a study that tested the growth of Vibrio vulnificus in aerobiosis and anaerobiosis. These researchers observed differences in OD610 in liquid growth medium, but when this growth medium was plated and
Fig. 2. Fold change normalized to reference gene 16S in the expression of biofilm- and quorum-sensing genes in microaerobiosis relative to aerobiosis according to serotype. Error bars represent the standard error. Different letters in the same target gene represent statistically significant differences (P b 0.05) between serotypes.
66
A. Lamas et al. / International Journal of Food Microbiology 238 (2016) 63–67
Fig. 3. Fold change normalized to reference gene 16S in the expression of biofilm- and quorum-sensing genes in anaerobiosis (ana) relative to aerobiosis according to serotype. Error bars represent the standard error.
counted there were no significant differences. The authors explained that the discrepancy could be due to a smaller cell size when grown in anaerobiosis. This explanation was supported in this study by the observation of smaller colonies in anaerobiosis conditions on Congo red plates. The ability of S. enterica to form biofilms is a matter of concern in the food industry as well as in clinical microbiology. Microorganisms in biofilms are more protected against environmental stresses, antibiotics, disinfectants, and host immune systems than the planktonic cells (Jensen et al., 2010). Thus, the ability to form biofilms is an important virulence factor. In aerobiosis, all strains tested reached the highest OD630 value in the microtiter assay. However, these results were very different when oxygen levels decreased, with lower biofilm formation on polystyrene plates. Reuter et al. (2010) also found increased biofilm formation in Campylobacter in aerobiosis conditions. However, Campylobacter has a microaerobic metabolism and aerobiosis conditions are stressful for this microorganism, which could explain why biofilm formation is a survival strategy for cells growing in an aerobic environment (Reuter et al., 2010). In addition, in a study carried out with Staphylococcus aureus strains, Hess et al. (2013) reported less biofilm formation in anaerobiosis conditions than in aerobic conditions. Biofilm formation in S. enterica is regulated by different genes. The csgD gene contributes to biofilm production by its important role in synchronizing the expression of several determinants of this process. Also, the sdiA and luxS quorum-sensing genes play a role in biofilm formation by S. enterica. Expression of the adrA gene is associated with increased levels of the signaling molecule cyclic di-GMP, which mediates the posttranscriptional activation of cellulose biosynthesis. Thus, adrA is important in biofilm formation by regulating cellulose synthesis through c-diGMP, which is an important bacterial secondary messenger regulating
multicellular behavior (Steenackers et al., 2012). Therefore, its influence on other important cellular mechanisms may be the cause of the lower reduction in its expression under the different conditions observed in this study. S. Typhimurium and S. Enteritidis are the principal serovars responsible of S. enterica infections in humans (EFSA, 2015). Thus, the smallest decrease in the expression of genes may be related to the virulence of these serovars, which are in anaerobic conditions in the host. Thus, the lower fold change in quorum sensing genes in S. Typhimurium and S. Enteritidis could be due to their regulatory role in the expression of virulence genes (Bai and Rai, 2011). It has also been observed that the transcription of biofilm-related genes is influenced by environmental factors such as acidic or low-nutrient conditions (O'Leary et al., 2015; Wang et al., 2016). In concordance, the results of our study suggest that the expression of biofilm-related genes was clearly influenced by the atmospheric conditions in which the strains grew. Likewise, Phippen and Oliver (2015) found that the transcription of biofilmrelated genes was downregulated when V. vulnificus was cultured under anaerobic conditions. Our study showed a positive correlation in csgD, luxS and sdiA expression. These results suggest a relationship between the expression of biofilm and quorum sensing-related genes. Wang et al. (2016) found similar results after testing the same genes in different culture media, implying a joint expression of these genes. S. enterica is in aerobiosis conditions when the bacteria survive outside the host. In these environmental conditions, biofilm formation is an important resource for survival (Fabrega and Vila, 2013). Thus, as this study shows, when S. enterica strains are cultured aerobically, the genetic machinery that allows the production of cellulose and curli is induced. In this sense, Bayer et al. (1990) observed that Pseudomonas aeruginosa increased the production of extracellular polymeric substances by increasing oxygen levels. However, when oxygen rates decrease, the expression of this machinery is modified as a result of gene transcription. All strains tested in this study showed SAW morphotype in microaerobiosis. However, none of the S. enterica morphotypes observed in previous studies (Chia et al., 2011; Lamas et al., 2016; Steenackers et al., 2012) appeared in the Congo red plates incubated in anaerobiosis. In these conditions, small red colonies were observed, indicating that the production of cellulose was blocked and the colony size was reduced. These results, along with gene expression analyses, show that S. enterica can modulate its morphotype depending on atmospheric conditions. This could be an evolutionary mechanism that allows the production of cellulose when S. enterica is outside the host and represses cellulose production inside the host, promoting its virulence by c-di-GMP regulation and repressing the production of cellulose as an antivirulence trait (Pontes et al., 2015). Variation in biofilm formation on polystyrene and in the morphotype is not only important from a microbiological point of view. From a food technology standpoint, the reduction of biofilm formation and the repression of cellulose production under microaerobiosis and anaerobiosis conditions is an advantage. Currently, there are some food packaging technologies where oxygen levels are low. For example, modified atmosphere packaging (MAP), which can use CO2 as an active gas in low O2 packaging, is widely utilized in food preservation (Nair et al., 2015; Zhou et al., 2015). For example, vacuum packaging with low O2 is used for meat preservation (Zhou et al., 2010). S. enterica does not produce cellulose in these conditions, as observed in this study. This could allow that
Table 3 Pearson's coefficients of correlation between the expression levels of each gene in microaerobiosis and anaerobiosis compared to aerobiosis. Microaerobiosis csgD adrA luxS sdiA ⁎ P b 0.05. ⁎⁎ P b 0.01.
csgD 1
adrA
luxS
sdiA
−0.021 1
0.798⁎⁎
0.664⁎ −0.194 0.658⁎⁎ 1
0.264 1
Anaerobiosis csgD adrA luxS sdiA
csgD 1
adrA
luxS
sdiA
−0.165 1
0.918⁎⁎
0.035 0.015 0.237 1
−0.142 1
A. Lamas et al. / International Journal of Food Microbiology 238 (2016) 63–67
67
Fig. 4. Morphotype of S. enterica in Congo red agar under the three conditions tested: aerobiosis (a), microaerobiosis (b) and anaerobiosis (c).
some food preservatives act more easily against S. enterica due to the absence of cellulose and a lower biofilm formation, which would prevent the growth of this pathogen on food. Similarly, films with antimicrobial substances are becoming important (Herzallah and Holley, 2015). The use of these films in an atmosphere that inhibits biofilm formation would improve their efficiency. In food industry, controlled atmospheric storage is used to preserve food (Deuchande et al., 2016). The use of low oxygen levels in these facilities could prevent biofilm formation by S. enterica and make it difficult their persistence. However, it must also be taken into account that lower biofilm formation in anaerobiosis conditions during food packaging could indicate that other pathogenic mechanisms in these bacteria may be more active. Moreover, the use of high O2 levels in packs is employed in the meat industry to promote oxymyoglobin development (O'Sullivan et al., 2015), which gives the meat a consumer acceptable color. The results of this study showed that biofilm formation in polystyrene was influenced by oxygen levels. Thus, food packaging with levels of atmospheric oxygen or higher values could enhance biofilm formation and facilitate the survival of S. enterica. 5. Conclusion This study demonstrates that S. enterica biofilm formation and cellulose production is directly associated with atmospheric conditions in all strains tested. This is supported by the inhibition of biofilm-related gene expression as atmospheric oxygen levels decreased. In addition, a positive correlation in the expression of biofilm and quorum sensing-related genes indicates that environmental conditions similarly affect the expression of these genes. As this study showed, test standard conditions can yield results not entirely valid. Therefore, in biofilm formation studies is important to consider the different types of metabolism that the microorganisms can use. Further analyses are necessary to demonstrate the cellular mechanisms involved in this variation and their implications for gut colonization by S. enterica, their virulence in the host and their persistence in food packed with low O2 concentrations. Food is a complex matrix with a variable microbiota that interacts between each other. In the future, more studies are needed to understand the influence of food and other microorganisms in the capacity of S. enterica to form biofilm. This knowledge should be transferred to other food-borne pathogens to elucidate their behavior in biofilm formation under different atmospheres. Thus, it would interesting to see the expression of biofilm and quorum sensing related genes and cellulose production in mixed biofilms composed by different pathogens. The results show that the food industry should be take special care when modified atmospheres are used due to its influence on the persistence of pathogens by forming biofilms. References Bai, A.J., Rai, V.R., 2011. Bacterial quorum sensing and food industry. Compr. Rev. Food Sci. Food Saf. 10, 183–193. Bayer, A.S., Eftekhar, F., Tu, J., Nast, C.C., Speert, D.P., 1990. Oxygen-dependent upregulation of mucoid exopolysaccharide (alginate) production in Pseudomonas aeruginosa. Infect. Immun. 58, 1344–1349.
Chia, T.W.R., McMeekin, T.A., Fegan, N., Dykes, G.A., 2011. Significance of the rdar and bdar morphotypes in the hydrophobicity and attachment to abiotic surfaces of Salmonella Sofia and other poultry-associated Salmonella serovars. Lett. Appl. Microbiol. 53, 581–584. Deuchande, T., Carvalho, S.M.P., Guterres, U., Fidalgo, F., Isidoro, N., Larrigaudiere, C., Vasconcelos, M.W., 2016. Dynamic controlled atmosphere for prevention of internal browning disorders in ‘Rocha’ pear. LWT-Food Sci. Technol. 65, 725–730. EFSA (European Food Safety Authority), ECDC (European Centre for Disease Prevention and Control), 2015r. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014. EFSA J. 13, 4329. Encheva, V., Shah, H.N., Gharbia, S.E., 2009. Proteomic analysis of the adaptive response of Salmonella enterica serovar typhimurium to growth under anaerobic conditions. Microbiol.-SGM 155, 2429–2441. Fabrega, A., Vila, J., 2013. Salmonella enterica serovar typhimurium skills to succeed in the host: virulence and regulation. Clin. Microbiol. Rev. 26, 308–341. Herzallah, S., Holley, R., 2015. Use of a nanoparticulate carboxymethyl cellulose film containing sinigrin as an antimicrobial precursor to kill Escherichia coli O157:H7 on fresh beef. Lett. Appl. Microbiol. 61, 139–145. Hess, D.J., Henry-Stanley, M.J., Lusczek, E.R., Beilman, G.J., Wells, C.L., 2013. Anoxia inhibits biofilm development and modulates antibiotic activity. J. Surg. Res. 184, 488–494. Jensen, P.O., Givskov, M., Bjarnsholt, T., Moser, C., 2010. The immune system vs. Pseudomonas aeruginosa biofilms. FEMS Immunol. Med. Mic. 59, 292–305. Lamas, A., Fernández-No, I.C., Miranda, J.M., Vázquez, B., Cepeda, A., Franco, C.M., 2016. Biofilm formation and morphotypes of Salmonella enterica subspecies arizonae differs from those of other Salmonella enterica subspecies in isolates from poultry houses. J. Food. Protect. 79, 1073–1300. Liu, Q., Niu, H., Zhang, W., Mu, H., Sun, C., Duan, J., 2015. Synergy among thymol, eugenol, berberine, cinnamaldehyde and streptomycin against planktonic and biofilmassociated food-borne pathogens. Lett. Appl. Microbiol. 60, 421–430. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402–408. Nair, D.V.T., Kiess, A., Nannapaneni, R., Schilling, W., Sharma, C.S., 2015. The combined efficacy of carvacrol and modified atmosphere packaging on the survival of Salmonella, Campylobacter jejuni and lactic acid bacteria on Turkey breast cutlets. Food Microbiol. 49, 134–141. O'Leary, D., McCabe, E.M., McCusker, M.P., Martins, M., Fanning, S., Duffy, G., 2015. Acid environments affect biofilm formation and gene expression in isolates of Salmonella enterica typhimurium DT104. Int. J. Food Microbiol. 206, 7–16. O'Sullivan, M.G., Le Floch, S., Kerry, J.P., 2015. Resting of MAP (modified atmosphere packed) beef steaks prior to cooking and effects on consumer quality. Meat Sci. 101, 13–18. Phippen, B.L., Oliver, J.D., 2015. Role of anaerobiosis in capsule production and biofilm formation in Vibrio vulnificus. Infect. Inmun. 83, 551–559. Pontes, M.H., Lee, E.J., Choi, J., Groisman, E.A., 2015. Salmonella promotes virulence by repressing cellulose production. P. Natl. Acad. Sci. USA 16, 5183–5188. Reuter, M., Mallett, A., Pearson, B.M., van Vliet, A.H.M., 2010. Biofilm formation by Campylobacter jejuni is increased under aerobic conditions. Appl. Environ. Microb. 76, 2122–2128. Steenackers, H., Hermans, K., Vanderleyden, J., De Keersmaecker, S.C.J., 2012. Salmonella biofilms: an overview on occurrence, structure, regulation and eradication. Food Res. Int. 45, 502–531. Stepanovic, S., Cirkovic, I., Ranin, L., Svabic-Vlahovic, M., 2004. Biofilm formation by Salmonella spp. and Listeria monocytogenes on plastic surface. Lett. Appl. Microbiol. 38, 428–432. Wang, H.H., Dong, Y., Wang, G.Y., Xu, X.L., Zhou, G.H., 2016. Effect of growth media on gene expression levels in Salmonella typhimurium biofilm formed on stainless steel surface. Food Control 59, 546–552. Wen, X.S., Dickson, J.S., 2012. Survival of Campylobacter jejuni and Salmonella enterica typhimurium in vacuum-packed, moisture-enhanced pork. J. Food Protect. 75, 576–579. Winfield, M.D., Groisman, E.A., 2003. Role of nonhost environments in the lifestyles of Salmonella and Escherichia coli. Appl. Environ. Microb. 69, 3687–3694. Zhou, G.H., Xu, X.L., Liu, Y., 2010. Preservation technologies for fresh meat - a review. Meat Sci. 86, 119–128. Zhou, S.Y., Sheen, S., Pang, Y.H., Liu, L.S., Yam, K.L., 2015. Modeling the impact of vapor thymol concentration, temperature, and modified atmosphere condition on growth behavior of Salmonella on raw shrimp. J. Food Protect. 78, 293–301.
