Enzyme and Microbial Technology 60 (2014) 40–46
Contents lists available at ScienceDirect
Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt
Biochemical characterization of an l-tryptophan dehydrogenase from the photoautotrophic cyanobacterium Nostoc punctiforme Ryutaro Ogura 1,2 , Taisuke Wakamatsu ∗ , Yuta Mutaguchi 4 , Katsumi Doi, Toshihisa Ohshima 1,3 Microbial Genetics Division, Institute of Genetic Resources, Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan
a r t i c l e
i n f o
Article history: Received 25 February 2014 Received in revised form 27 March 2014 Accepted 2 April 2014 Available online 13 April 2014 Keywords: l-Tryptophan dehydrogenase NAD+ Nostoc punctiforme Amino acid dehydrogenase B-type stereospecificity
a b s t r a c t An NAD+ -dependent l-tryptophan dehydrogenase from Nostoc punctiforme NIES-2108 (NpTrpDH) was cloned and overexpressed in Escherichia coli. The recombinant NpTrpDH with a C-terminal His6 -tag was purified to homogeneity using a Ni-NTA agarose column, and was found to be a homodimer with a molecular mass of 76.1 kDa. The enzyme required NAD+ and NADH as cofactors for oxidative deamination and reductive amination, respectively, but not NADP+ or NADPH. l-Trp was the preferred substrate for deamination, though l-Phe was deaminated at a much lower rate. The enzyme exclusively aminated 3indolepyruvate; phenylpyruvate was inert. The pH optima for the deamination of l-Trp and amination of 3-indolpyruvate were 11.0 and 7.5, respectively. For deamination of l-Trp, maximum enzymatic activity was observed at 45 ◦ C. NpTrpDH retained more than 80% of its activity after incubation for 30 min at pHs ranging from 5.0 to 11.5 or incubation for 10 min at temperatures up to 40 ◦ C. Unlike l-Trp dehydrogenases from higher plants, NpTrpDH activity was not activated by metal ions. Typical Michaelis–Menten kinetics were observed for NAD+ and l-Trp for oxidative deamination, but with reductive amination there was marked substrate inhibition by 3-indolepyruvate. NMR analysis of the hydrogen transfer from the C4 position of the nicotinamide moiety of NADH showed that NpTrpDH has a pro-S (B-type) stereospecificity similar to the Glu/Leu/Phe/Val dehydrogenase family. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Amino acid dehydrogenases (EC 1.4.1.X) catalyze the reversible NAD(P)+ -dependent oxidative deamination of amino acids to their corresponding 2-oxoacids and ammonia [1–3]. More than fifteen kinds of amino acid dehydrogenases, including those acting on lGlu, l-Ala, l-Ser, l-Val, l-Leu, l-Gly, l-Lys, l-Phe and l-Asp, have
Abbreviations: TrpDH, l-Trp dehydrogenase; NpTrpDH, NAD+ -dependent ltryptophan dehydrogenase from Nostoc punctiforme NIES-2108. ∗ Corresponding author. Present address: Agricultural Science, Graduate School of Integrated Arts and Sciences, Kochi University, 200 Otsu, Monobe, Nankoku, Kochi 783-8502, Japan. Tel.: +81 88 864 5191; fax: +81 88 864 5191. E-mail address: [email protected] (T. Wakamatsu). 1 These authors contributed equally to this work. 2 Present address: Institute for Chemical Research, Kyoto University, Gokasho, Uji, Kyoto 611-0011, Japan. 3 Present address: Department of Biomedical Engineering, Osaka Institute of Technology, 5-16-1 Ohmiya, Asahi-ku, Osaka 535-8585, Japan. 4 Present address: Department of Biotechnology, Faculty of Bioresource Sciences, Akita Prefectural University, 241-438 Shimoshinjo-Nakano, Akita 010-0195, Japan. http://dx.doi.org/10.1016/j.enzmictec.2014.04.002 0141-0229/© 2014 Elsevier Inc. All rights reserved.
been identified in various organisms [1,4,5], and detailed analyses of the structures and functions of l-Glu dehydrogenase [5], l-Leu dehydrogenase [6,7] and l-Phe dehydrogenase [8] have been reported. In addition, several amino acid dehydrogenases have been applied for use in biosensors for l-amino acid, 2-oxoacid and ammonia assays [1,9], disease diagnosis [10,11], and amino acids synthesis [9,12]. As compared to other amino acid dehydrogenases, l-Trp dehydrogenase (EC 1.4.1.19, TrpDH), which catalyzes the reversible oxidative deamination of l-Trp to 3-indolepyruvate in the presence of NAD(P)+ , has not been extensively investigated from the viewpoint of it biochemical or biotechnological potential due in large part to its extremely limited distribution. The enzyme was first identified in several higher plants (e.g., Pisum sativum, Spinacia oleracea and Zea mays, etc.) in the mid 1980s [13], and was partially characterized at that time [14–17]. There was then no further investigation of the enzyme until the product of the Npun R1275 gene (npun r1275) from the cyanobacterium Nostoc punctiforme ATCC 29133 was found to exhibit NAD+ -dependent oxidative deamination activity toward l-Trp [18]. This was the first microbial TrpDH known, and its gene (npun r1275) was located
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
in the gene cluster for biosynthesis of scytonemin, a cyanobacterial radiation-absorbing pigment. The authors suggested that Npun R1275 plays an important role in scytonemin biosynthesis by catalyzing the oxidative deamination of l-Trp, but no detailed analysis of the enzyme’s biochemical properties were reported. In the present study, we cloned a TrpDH homologous gene from N. punctiforme NIES-2108 (nptrpdh) in Escherichia coli and examined in detail the biochemical properties of the expressed product (NpTrpDH) from the viewpoint of its practical application.
41
2. Materials and methods
Gly-NaOH and 1% (v/v) DMSO, pH 11.0), we considered the effect of absorbance by 3-indolepyruvate on absorbance by NADH to calculate the initial velocity. One unit (U) of enzyme was defined as the amount of enzyme catalyzing the formation of 1 mol of NADH from NAD+ per minute under the standard conditions for oxidative deamination. We measured the reductive amination activity of NpTrpDH using a reaction mixture (pH 7.5, 1 ml) containing 200 mM Tris–HCl, 6.25 M 3-indolepyruvate (dissolved in 1% (v/v) DMSO), 400 mM NH4 Cl, 0.2 mM NADH and 15 nM NpTrpDH as the standard assay mixture. Just before the assay, 3-indolepyruvate was dissolved in DMSO, and added to the reaction mixture lacking NADH and NpTrpDH and incubated for 30 min at 25 ◦ C. It was then assumed that the majority of 3-indolepyruvate was in its keto form [19]. The assay for reductive amination was then performed using assay procedures similar to those for oxidative deamination.
2.1. Materials
2.5. Kinetic analyses
A pellet of N. punctiforme NIES-2108 was obtained from the Japan Society for Culture Collections. Enzymes that act on DNA, including restriction enzymes and KOD Plus Neo polymerase, were obtained from Takara Bio Inc. (Otsu, Japan) and TOYOBO (Osaka, Japan). DNA oligomers were synthesized by Hokkaido System Science (Sapporo, Japan). All other reagents used were of the highest commercially available grade.
The initial velocity for oxidative deamination was analyzed using the standard assay condition and the reaction mixture (pH 7.5, 1 ml) containing 200 mM Tris–HCl instead of 200 mM Gly-NaOH. To determine the kinetic constants for lTrp and NAD+ , several different concentrations of l-Trp (0.0100–5.00 mM) or NAD+ (0.0125–2.50 mM) were used. The initial velocity was then plotted against the substrate concentration, and the Km and kcat values were determined by curve fitting using Igor Pro ver. 3.14 software (WaveMetrics, Tigard, OR, USA). The Km and kcat values for 3-indolepyruvate in the reductive amination were determined using various 3-indolepyruvate concentrations (0.00313–1.25 mM) in the presence of 400 mM NH4 Cl and 0.2 mM NADH. Because marked substrate inhibition by 3-indolepyruvate was observed, even when the concentration was relatively low, the reciprocal initial velocities were plotted against the reciprocals of the 3indolepyruvate concentration, and the plots were fitted to the Haldane equation (Eq. (1)) using Igor Pro ver. 3.14 to obtain the Km and kcat values and the inhibition constant for 3-indolepyruvate (KiI ) [8,20].
2.2. Purification of NpTrpDH N. punctiforme NIES-2108 cells were collected from the pellet and initially treated with lysozyme and proteinase K for 1 h at 37 ◦ C. Thereafter, acetyl trimethyl ammonium bromide was added to the mixture (final concentration: 1% (w/v)), which was then incubated for 10 min at 65 ◦ C. After removing the cellular debris by centrifugation, the genomic DNA was isolated from the solution using the phenol/chloroform extraction method, and the nptrpdh coding sequence was amplified by PCR using genomic DNA as the template with primers 5 TATACATATGCTGCTATTTGAAACTGTTAGAGAAATGGGTCACGAACAAGTTCTTTTTTG3 (forward) and 5 -TATACTCGAGAGCTGCGATCGCTTTAGA CTTGCTGCGCTTACTATTG-3 (reverse). These two primers were constructed based on the sequence of npun r1275, with the forward primer containing a NdeI recognition site and the reverse primer containing a XhoI recognition site (underlined). The amplified gene fragments were ligated into plasmid pET-29b (Merck, Darmstadt, Germany) at the NdeI and XhoI sites, yielding an expression vector encoding NpTrpDH with a C-terminal His6 -tag, after which the sequence of the vector was confirmed. E. coli BL21(DE3) (Merck) cells were then transformed with the plasmid and cultured in 2.5 l of LB medium containing 20 g kanamycin/ml at 37 ◦ C until the OD600 = 0.8. Expression was then induced by addition of 0.6 mM IPTG, and the incubation was continued for an additional 3 h at 37 ◦ C. The cells (wet weight: ∼10 g) were then harvested by centrifugation and stored at −20 ◦ C. The following procedures were carried out at 4 ◦ C unless stated otherwise. Frozen cells (wet weight: ∼10 g) were thawed, suspended in 50 ml of buffer I (pH 8.0) [50 mM Tris–HCl, 300 mM NaCl, 5 mM -mercaptoethanol, 10 mM imidazole, 20% glycerol and a protease inhibitor cocktail tablet (EDTA-free; Roche, Basel, Switzerland)], disrupted by sonication on ice, and centrifuged (24,000 × g) for 30 min. The resultant supernatant was loaded onto a Ni-NTA agarose column (bed volume, 4 ml; QIAGEN, Hilden, Germany) equilibrated with buffer II (pH 8.0) [50 mM Tris–HCl, 300 mM NaCl, 5 mM -mercaptoethanol, 10 mM imidazole and 20% glycerol], and the proteins were eluted with a linear gradient of 0.06–1 M imidazole (total volume, 60 ml). Fractions containing NpTrpDH were dialyzed against buffer III (pH 8.0) [50 mM Tris–HCl, 300 mM NaCl, 1 mM DTT, and 20% glycerol]. The C-terminal Leu-Glu-His-His-His-His-His-His tag was retained.
v=
Vmax [S] 2
Km + [S] + [S] /KiI
Kinetic constants for ammonia were determined using different NH4 Cl concentrations (50.0–400 mM) in the presence of 4.17, 5.00 or 6.25 M 3-indolepyruvate and 0.2 mM NADH. Determination of the Km and kcat values for ammonia was carried out using a relatively low concentration of 3-indolepyruvate to avoid substrate inhibition. The reciprocal initial velocities (1/v) were then plotted against the reciprocal NH4 Cl concentrations (1/[NH4 Cl]) at each 3-indolepyruvate concentration and analyzed using linear regression. These data were then fitted to the following equation (Eq. (2)) to calculate the Km and kcat values for ammonia [8].
v=
Vmax [NH4 Cl][3 − indolepyruvate] KmA [3 − indolepyruvate] + KmI [NH4 Cl] + [NH4 Cl][3 − indolepyruvate] + KiA KmI (2)
where KmA and KmI are the Km s for ammonia and 3-indolepyruvate, respectively. KiA then indicates the dissociation constant for the NpTrpDH–ammonia complex. Kinetic constants for NADH were calculated by varying the NADH concentration (0.00267–0.200 mM) in the presence of 4.17, 5.00 or 6.25 M 3-indolepyruvate and 400 mM NH4 Cl. The reciprocal initial velocities (1/v) were then plotted against the reciprocal NADH concentrations (1/[NADH]) at each 3-indolepyruvate concentration and analyzed using linear regression. These data were then fitted to the following equation (Eq. (3)) to calculate the Km and kcat values for NADH [8].
v=
Vmax [NADH][3 − indolepyruvate] KmN [3 − indolepyruvate] + KmI [NADH] + [NADH][3 − indolepyruvate]
2.3. Size exclusion chromatography
where KmN and KmI are Km s for NADH and 3-indolepyruvate, respectively.
NpTrpDH was applied to a Superdex 200 10/300 GL column (1.0 cm × 30 cm, GE Healthcare, Little Chalfont, UK) and eluted with buffer IV (pH 7.5) [50 mM Tris–HCl, 100 mM KCl, and 1 mM DTT] at a flow rate of 0.5 ml/min using an ÄKTA Explorer System (GE Healthcare). The apparent molecular mass was estimated by comparing the protein’s retention time with those of molecular mass markers (MWGF1000-1KT; Sigma–Aldrich, St. Louis, MO, USA).
2.6. Effects of pH and temperature on enzyme activity
2.4. Enzyme assays NpTrpDH-catalyzed reduction of NAD(P)+ or oxidation of NAD(P)H was followed at 340 nm using a UV-1600 UV–visible Spectrophotometer (Shimadzu, Kyoto, Japan) equipped with a temperature-controlled cuvette holder. Three independent experiments were performed for all enzyme assays. The standard assay mixture (pH 11.0, 1 ml) for oxidative deamination contained 200 mM Gly-NaOH, 5 mM l-Trp, 1.25 mM NAD+ and 100 nM NpTrpDH. The mixture (900 l) without NpTrpDH was first incubated for 3 min at 25 ◦ C before the enzyme reaction was started by addition of NpTrpDH solution (100 l, dissolved in buffer III) to the mixture. In each assay, the initial velocity was determined by measuring the linear increase in the absorbance at 340 nm. Because of the measurable absorbance of 3-indolepyruvate at 340 nm (extinction coefficient at 340 nm for 3-indolepyruvate: 680 M−1 cm−1 in 200 mM
(1)
(3)
The pH dependences for oxidative deamination and reductive amination catalyzed by NpTrpDH were determined at 25 ◦ C using 200 mM concentrations of the following buffers: MES-NaOH (pH 6.5 and 7.0), HEPES-NaOH (pH 7.0–8.0), TAPSNaOH (pH 8.0–9.0), Gly-NaOH (pH 9.0–11.0), and Na2 HPO4 -Na3 PO4 (pH 11.0–12.0). The temperature dependence was evaluated by measuring the oxidative deamination activity at temperatures ranging from 20 ◦ C to 60 ◦ C. These assays were monitored for 1 min. 2.7. Effects of pH and temperature on enzyme stability The effect of pH on enzyme stability was evaluated by incubating 0.332 M NpTrpDH for 30 min at 4 ◦ C with 100 mM concentrations of the following buffers: Na-citrate (pH 3.0–6.0), MES-NaOH (pH 6.0–7.0), Tris–HCl (pH 7.0–8.0), TAPS-NaOH (pH 8.0–9.0), Gly-NaOH (pH 9.0–11.0) and Na2 HPO4 -Na3 PO4 (pH 11.0–12.0). The enzyme solution was then rapidly cooled on ice, and the remaining activity was determined using the standard oxidative deamination assay. The thermal stability was determined by incubating 1.66 М NpTrpDH in 50 mM HEPES-NaOH (pH 7.5) for 10 min at various temperatures (20–50 ◦ C). The enzyme solution was then
42
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
rapidly cooled on ice, and the remaining activity was determined using the standard oxidative deamination assay. 2.8. Effect of various compounds on enzyme activity The effect adding various compounds, including 1 mM concentrations of MgCl2 , MnCl2 , ZnCl2 , CaCl2 and CoCl2 ; 10 mM EDTA; 100 mM KCl or 1% DMSO was examined using the standard assay mixture for oxidative deamination. 2.9. Stereospecificity of NpTrpDH-catalyzed hydrogen transfer from NADH to 3-indolepyruvate The stereospecificity of NpTrpDH-catalyzed hydrogen transfer from NADH was analyzed using 1 H-NMR analysis. [4R-2 H]NADH was first prepared as described previously [21] with minor modifications. Briefly, 0.6 ml of deuterated ethanol (CD3 CD2 OD; Merck) were incubated with 150 U of alcohol dehydrogenase (Astereospecific) from Saccharomyces cerevisiae (Sigma–Aldrich) and 75 mol of NAD+ in 10 ml of 100 mM NH4 HCO3 buffer (pH 7.5) for 15 min at 25 ◦ C. The formation of [4R-2 H]NADH was monitored using a UV-1600 UV–visible spectrophotometer at a wavelength of 340 nm. The mixture was then passed through a centrifugal filter (10,000 molecular weight cutoff; Amicon Ultra, Millipore, Billerica, MA, USA) to remove the alcohol dehydrogenase. The filtrate was then diluted 5-fold with distilled water and applied to a 10-ml Toyopearl DEAE-650 M column (Tosoh, Shunanshi, Japan), and [4R-2 H]NADH was eluted using a linear gradient of 10–200 mM NH4 HCO3 buffer (pH 7.5, total 80 ml). The fractions containing [4R-2 H]NADH were collected as those that showed strong absorbance at 340 nm. They were then lyophilized, yielding 9 mg of [4R-2 H]NADH. To determine the hydrogen transfer stereospecificity for NADH in the NpTrpDH reaction, the mixture contained 0.10 M NpTrpDH (activity: 4.0 mol/min), 2.5 mM 3-indolepyruvate, 200 mM NH4 Cl, 2.9 mg of [4R-2 H] NADH and 100 mM NH4 HCO3
buffer (pH 7.5) in a final volume of 5.0 ml. As a reference for A-stereospecific (pro-R specific) hydrogen transfer by an amino acid dehydrogenase, we used NAD+ dependent l-Asp dehydrogenase from Archaeoglobus fulgidus (AfAspDH) [22]. This mixture contained 4.0 U of AfAspDH (a unit was defined as the amount of enzyme producing 1.0 mol of NADH per minute at 50 ◦ C under the standard assay conditions), 2.5 mM oxaloacetate, 200 mM NH4 Cl, 2.9 mg of [4R-2 H]NADH and 100 mM NH4 HCO3 buffer (pH 7.5) in a final volume of 5.0 ml. After incubating for 1 h at 25 ◦ C (NpTrpDH) or 50 ◦ C (AfAspDH), the reaction solution was passed through a centrifugal filter (10,000 molecular weight cutoff; Amicon Ultra). The 1 H-NMR spectra for the C4 position on the nicotinamide ring of NAD+ produced from [4R-2 H]NADH were then analyzed using a 400-MHz 1 H-NMR instrument (JEOL, Akishima, Japan).
3. Results 3.1. DNA and amino acid sequences of TrpDH from N. punctiforme NIES-2108 Although the sequence of the N. punctiforme ATCC 29133 (PCC 73102) (NC 010628.1) genome is known, the N. punctiforme NIES-2108 genome has not yet been sequenced. We therefore determined the DNA sequence of NpTrpDH and submitted it to GenBank (BankIt1608548). The amino acid sequence was then determined on the basis of the DNA sequence and the codon usage table for Nostoc sp. PCC 7120 (http://www.kazusa.or.jp/) (Fig. 1). The amino acid sequence of NpTrpDH shows 95% identity and 98% similarity to that of Npun R1275.
Fig. 1. Alignment of the amino acid sequences of NpTrpDH and Npun R1275 from N. punctiforme ATCC 29133, NAD+ -dependent l-Leu dehydrogenase from Lysinibacillus sphaericus (LsLeuDH, PDB ID: 1LEH) and NAD+ -dependent l-Phe dehydrogenase from Rhodococcus sp. (RsPheDH, PDB ID: 1C1D). The sequence alignment was prepared using ClustalW [23]. Residues that interact with NAD+ are boxed. Residues that form a hydrophobic pocket in the crystal structure (PDB ID: 1C1D) are indicated by arrows.
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46 Table 1 Coenzyme specificity of TrpDH activity. Coenzyme
43
Table 2 Substrate specificity.a Relative activity (%)
Oxidative deaminationa NAD+ NADP+
100b 0c
Reductive aminationa NADH NADPH
100b 3.0 ± 0.26
Assays were performed at 25 ◦ C, as described in Section 2. A value of 100% denotes activities of 6.6 U/mg and 7.2 mol/min mg for oxidative deamination and reductive amination, respectively. c A value of 0% indicates that activity was not detected, even with a 10 times molar excess of enzyme, as compared to the activity with NAD+ . a
b
3.2. Purification of NpTrpDH Recombinant E. coli expressed NpTrpDH in both the soluble and insoluble protein fractions, and the soluble fraction exhibited NAD+ -dependent oxidative deamination activity toward l-Trp. NpTrpDH was purified from the cell extract of recombinant E. coli using a Ni-NTA agarose column. Approximately 40 mg of purified NpTrpDH was obtained with a 68% yield from the cell extract (10 g of cells (wet weight) from 2.5 l of culture medium). The purity was at least 95%, as judged from SDS-PAGE (data not shown). 3.3. Molecular mass determination The apparent molecular mass of the native protein was determined to be 76.1 kDa using HPLC with a Superdex 200 column (data not shown). The molecular mass of the monomer with the retained C-terminal His6 -tag was calculated to be 39.5 kDa from the amino acid sequences (Fig. 1). The native protein thus appears to exist as a homodimer. 3.4. Coenzyme and substrate specificity NpTrpDH exhibited NAD+ -dependent oxidative deamination activity toward l-Trp, whereas no NADP+ -dependent activity was detected, even when the assay was run with a 10 times higher concentration of NpTrpDH (1 M) (Table 1). In the reductive amination of 3-indolepyruvate, NpTrpDH showed much less activity with NADPH (relative activity: 3%) than with NADH. The activity for oxidative deamination of l-Trp with NAD+ was 6.6 ± 0.3 U/mg, and for reductive amination of 3-indolepyruvate with NADH it was 7.2 ± 0.4 mol (of NAD+ formed)/min mg.
Substrate
Relative activity (%)
Oxidative deaminationb l-Trp d-Trp l-Phe l-Tyr l-Ala l-Val l-Leu l-Ile l-Pro l-Cys l-Met l-Asp l-Glu l-Asn l-Gln l-Ser l-Thr l-His l-Arg l-Lys Gly
100d 0e 23 ± 0.46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Reductive aminationc 3-Indolepyruvate Phenylpyruvate
100d 0
a NAD+ and NADH were used as the coenzymes for oxidative deamination and reductive amination, respectively. b Assays were performed at 25 ◦ C in a mixture (pH 11.0) containing 200 mM GlyNaOH, 5 mM substrate, 1.25 mM NAD+ and 100 nM NpTrpDH. c Assays were performed at 25 ◦ C in a mixture (pH 7.5) containing 200 mM Tris–HCl, 6.25 M substrate, 400 mM NH4 Cl, 0.2 mM NADH and 15 nM NpTrpDH. d A value of 100% denotes activities of 6.6 U/mg and 7.2 mol/min mg for oxidative deamination and reductive amination, respectively. e A value of 0% indicates that activity was not detected under this condition.
NpTrpDH used l-Trp as its preferred electron donor for oxidative deamination and showed much less activity with l-Phe (relative activity: 23%) (Table 2). Other l-amino acids and D-Trp were inert as electron donors for NpTrpDH in the presence of NAD+ . For reductive amination, 3-indolepyruvate was preferentially aminated in the presence of ammonia and NADH. Phenylpyruvate was inert. 3.5. Effects of pH and temperature on enzyme activity NpTrpDH-catalyzed oxidative deamination increased with increasing pH, and maximum activity was observed at around pH 11.0 (Fig. 2a). For reductive amination, maximum activity was
Fig. 2. Effects of pH (a) and temperature (b) on TrpDH activity. (a) Effect of pH on oxidative deamination (open symbols) and reductive amination (filled symbols) by NpTrpDH. A value of 100% denotes activities of 6.6 U/mg and 7.2 mol/min mg for oxidative deamination and reductive amination, respectively. (b) Effect of temperature on oxidative deamination by NpTrpDH. The enzyme activity was measured at various temperatures between 20 ◦ C and 60 ◦ C. A value of 100% denotes a specific activity of 30.1 mol/min mg at 45 ◦ C.
44
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
Fig. 3. Effects of pH (a) and temperature (b) on enzyme stability. (a) Oxidative deamination by NpTrpDH after incubation for 30 min at 4 ◦ C in buffer solutions of various pH. A value of 100% denotes an activity of 6.6 U/mg. (b) Oxidative deamination by NpTrpDH after incubation for 10 min at various temperatures in 50 mM HEPES-NaOH buffer (pH 7.5). A value of 100% denotes an activity of 6.6 U/mg.
observed around pH 7.5 (Fig. 2a). In addition, maximum activity for oxidative deamination at pH 11.0 was observed at 45 ◦ C (Fig. 2b). 3.6. Effects of pH and temperature on enzyme stability NpTrpDH retained more than 80% of its activity after incubation for 30 min at pH 5.0–11.5 (Fig. 3a). Similarly, no enzyme activity was lost after incubation for 10 min at up to 40 ◦ C (Fig. 3b). On the other hand, there was a complete loss of activity when the enzyme was incubated at temperatures above 50 ◦ C. 3.7. Kinetic constants Initial velocity plots versus l-Trp or NAD+ concentrations showed typical Michaelis–Menten type kinetics (data not shown), which suggests NpTrpDH exhibits no homotropic cooperativity with l-Trp and NAD+ . The kinetic constants determined using Igor Pro ver. 3.14 are listed in Table 3. NpTrpDH also showed significant deamination activity, even at pH 7.5, which may be near physiological pH. For reductive amination, however, marked substrate inhibition by 3-indolepyruvate was observed (Fig. 4, Table 3). The reciprocal initial velocities (1/v) plotted against
Fig. 4. Substrate inhibition by 3-indolepyruvate. Double reciprocal plots of initialvelocity/mg-NpTrpDH versus 3-indolepyruvate concentration. The solid line was drawn by curve fitting to the Haldane equation (Eq. (1)) using Igor Pro ver. 3.14. The broken line was drawn based on the initial-velocity/mg data for 3.13–6.25 M 3-indolepyruvate and shows the hypothetical initial-velocity/mg pattern without substrate inhibition by 3-indolepyruvate.
1/[NH4 Cl] and 1/[NADH] in the presence of constant concentration or several concentrations of 3-indolepyruvate gave an intersectingand a parallel-initial velocity pattern, respectively, without substrate inhibition (data not shown). This suggests that, unlike 3-indolepyruvate, ammonia and NADH do not mediate substrate inhibition. The kinetic constants determined with Igor Pro ver. 3.14 are also listed in Table 3.
3.8. Effect of various compounds on the enzyme activity None of the metal ions tested (1 mM) or EDTA (10 mM), KCl (100 mM) or DMSO (1%) had a large effect on NpTrpDH activity (remaining activity: 92–107%).
Fig. 5. 1 H-NMR spectra for the C4 position on the nicotinamide ring of NAD+ . NAD+ was produced using NpTrpDH, 3-indolepyruvate, NH4 Cl and [4R-2 H]NADH (a) or using AfAspDH, oxaloacetate, NH4 Cl and [4R-2 H]NADH (b). The filled and open arrows show the proton signal at C4 of NAD+ and the peak for 3-indolepyruvate, respectively.
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
45
Table 3 Kinetic constants. Substrate
Km (mM)a
kcat (s−1 )a
Oxidative deamination NAD+ l-Trp
0.025 ± 0.0025 (0.10 ± 0.0048)b 0.031 ± 0.0013 (0.47 ± 0.063)
4.3 ± 0.050 (0.63 ± 0.015) 4.2 ± 0.10 (0.59 ± 0.036)
Reductive amination NADH 3-Indolepyruvate Ammonia
0.038 ± 0.00070 0.014 ± 0.011 130 ± 17
21 ± 5.0 16 ± 10 17 ± 4.8
kcat /Km (mM−1 s−1 )
KiI (mM)c
170 (6.3) 140 (1.3) 550 1100 0.13
0.014 ± 0.0018
a Assays were performed at 25 ◦ C, as described in Section 2. In these assays, the enzyme was mixed with various concentrations of substrate. Km and kcat were determined through nonlinear regression analysis of the assay data. b Values in parentheses represent the activity at pH 7.5. c KiI was determined through nonlinear regression analysis of double-reciprocal plots with the calculated Km and kcat values.
Fig. 6. Phylogenetic tree of putative TrpDHs from Cyanobacteria and other l-amino acid dehydrogenases. The phylogenetic tree was constructed using neighbor-joining methods with ClustalW [23] and NJplot [24]. The values given in parentheses denote the amino acid sequence identity with NpTrpDH. The numbers on the nodes are the bootstrap values for 1000 counts. The bar indicates a genetic distance of 0.05.
3.9. Stereospecificity of hydrogen transfer from NADH We used [4R-2 H]NADH to analyze the stereospecificity of NpTrpDH-catalyzed hydrogen transfer from NADH to 3indolepyruvate. When [4R-2 H]NADH was incubated with NpTrpDH, a doublet signal from the C4 proton of NAD+ at around 8.50 ppm was not observed in the 1 H-NMR spectrum (Fig. 5a), which indicates the 4R-2 H of NADH remained in the NAD+ , and the 4S-1 H was removed and transferred to 3-indolepyruvate. When NADH was used instead of 2 H-labeled NADH as the control, a resonance signal at around 8.50 ppm reflecting the C4 proton of NAD+ was observed in the 1 H-NMR spectrum (data not shown). In addition, when [4R-2 H]NADH was incubated with AfAspDH (Atype stereospecific enzyme), a resonance doublet was observed at around 8.65 ppm in the 1 H-NMR spectrum (Fig. 5b). These results indicate that NpTrpDH has a B-type stereospecificity for hydrogen transfer from NADH; it thus differs from A-type stereospecific AfAspDH. 4. Discussion In the present study, we succeeded in expressing the Npun R1275 homologous gene from N. punctiforme NIES-2108 in E. coli and purifying the product. Characterization of the purified enzyme using a spectrophotometric assay showed that the enzyme catalyzes the reversible deamination of l-Trp to 3-indolepyruvate in the presence of NAD+ . The enzyme was not affected by the presence of metal ions or EDTA, though TrpDHs from both P. sativum and S. oleracea are reportedly activated by Ca2+ and Mn2+ and inhibited by EDTA [15,16]. Thus unlike TrpDHs from higher plants, NpTrpDH does not require metal ion for activity. In addition, the enzyme
retains more than 80% of its activity after incubation for 30 min at pH 5.0–11.5 and does not lose activity at temperatures below 40 ◦ C, but nearly half its activity is lost with incubation for 10 min at 45 ◦ C. This suggests NpTrpDH is potentially useful for applications such as spectrophotometric sensing of l-Trp. Cyanobacterial TrpDH genes are reportedly located within the gene cluster for scytonemin biosynthesis, and their products catalyze the deamination of l-Trp as an initial step in the biosynthetic pathway [18]. We postulate that like other cyanobacterial TrpDHs, NpTrpDH functions physiologically in the deamination of l-Trp as the initial step in scytonemin biosynthesis. In the web database, Npun R1275 homologous proteins are annotated as “Glu/Leu/Phe/Val dehydrogenase, C terminal” or “Leu dehydrogenase.” However, the phylogenetic tree shows that Npun R1275 homologous proteins, whose genes are located in the gene cluster for biosynthesis of scytonemin or aromatic amino acids, have high sequence identity to one another and have the same node (Fig. 6). By contrast, their clusters are distant from those of other l-amino acid dehydrogenases, such as l-Glu dehydrogenase, l-Leu dehydrogenase and l-Phe dehydrogenase. In addition, we showed here that NpTrpDH is highly susceptible to inhibition by its substrate, 3-indolepyruvate. This suggests that NpTrpDH functions in the degradation of l-Trp but not its formation from 3-indolepyruvate and ammonia, though more detailed experimental examination of the mechanisms underlying 3-indolepyruvate inhibition, the enzyme’s induction and its physiological function are needed. Our findings indicate that the NpTrpDH-catalyzed transfer of a C4-hydrogen from the pyridine ring of NADH is Pro-S-specific. This means that TrpDH belongs a group of enzymes catalyzing B-stereospecific hydrogen transfer, which also includes l-Glu dehydrogenase, l-Leu dehydrogenase, l-Phe dehydrogenase and
46
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
l-Val dehydrogenase, but not l-Ala dehydrogenase, l-Asp dehydrogenase [3,4] or meso-diaminopimelate dehydrogenase [25]. When we compared the amino acid sequences of NpTrpDH with those of other l-amino acid dehydrogenases, NpTrpDH showed higher sequence homology with B-stereospecific amino acid dehydrogenases than A-stereospecific ones (Fig. 6). For example, the multiple alignment in Fig. 1 shows the high sequence homology of NpTrpDH with NAD+ dependent l-Leu dehydrogenase from Lysinibacillus sphaericus (PDB ID: 1LEH) [6] and NAD+ dependent l-Phe dehydrogenase from Rhodococcus sp. (PDB ID: 1C1D) [8], whose crystal structures have been determined. This alignment indicates that residues that may be involved in the recognition of NAD+ are highly conserved among NpTrpDH and the other two enzymes. In addition, multiple alignment and site-directed mutagenesis analyses have shown that, as B-stereospecific enzymes, Glu/Leu/Phe/Val dehydrogenases stereospecifically recognize their substrates based on the shape and hydrophobicity of their substrate recognition pockets [26–28]. Given that l-Trp is relatively bulky and is one of the most hydrophobic amino acids, we suggest that the substraterecognition site of NpTrpDH likely contains a particularly large hydrophobic pocket comprised of amino acids specifically well suited to bind l-Trp and differing from other similar enzymes. For example, we predict it will differ from the recognition site for the phenyl group in l-Phe dehydrogenase from Rhodococcus sp. (PDB ID: 1C1D) [8], which also forms a hydrophobic pocket. We are now performing an X-ray crystallographic analysis of NpTrpDH to learn the details of the substrate-recognition, coenzyme-recognition and catalytic mechanisms. Acknowledgements This work was supported in part by Grant-in-Aid for Scientific Research 22248010 (to T.O.) from the Ministry of Education, Science, Sports and Culture of Japan. We thank Ms. Keiko Ideta for assisting with the NMR data collection. References [1] Ohshima T, Soda K. Biochemistry and biotechnology of amino acid dehydrogenases. Adv Biochem Eng Biotechnol 1990;42:187–209. [2] Brunhuber NM, Blanchard JS. The biochemistry and enzymology of amino acid dehydrogenases. Crit Rev Biochem Mol Biol 1994;29:415–67. [3] Li Y, Ogola HJ, Sawa Y. l-Aspartate dehydrogenase: features and applications. Appl Microbiol Biotechnol 2012;93:503–16. [4] Ohshima T, Soda K. Amino acid dehydrogenases and their applications. In: Patel RN, editor. Stereoselective Biocatalysis. New York: Marcel Dekker Inc; 2000. p. 877–902. [5] Ohshima T. Structural characteristics of active and inactive glutamate dehydrogenases from the hyperthermophile Pyrobaculum islandicum. Biosci Biotechnol Biochem 2012;76:1601–10. [6] Baker PJ, Turnbull AP, Sedelnikova SE, Stillman TJ, Rice DW. A role for quaternary structure in the substrate specificity of leucine dehydrogenase. Structure 1995;3:693–705.
[7] Zhao Y, Wakamatsu T, Doi K, Sakuraba H, Ohshima T. A psychrophilic leucine dehydrogenase from Sporosarcina psychrophila: purification, characterization, gene sequencing and crystal structure analysis. J Mol Catal B Enzyme 2012;83:65–72. [8] Brunhuber NM, Thoden JB, Blanchard JS, Vanhooke JL. Rhodococcus lphenylalanine dehydrogenase: kinetics, mechanism, and structural basis for catalytic specificity. Biochemistry 2000;39:9174–87. [9] Ohshima T, Soda K. Thermostable amino acid dehydrogenases: applications and gene cloning. Trends Biotechnol 1989;7:210–4. [10] Pasquo A, Britton KL, Baker PJ, Brearley G, Hinton RJ, Moir AJ, et al. Crystallization of NAD+ -dependent phenylalanine dehydrogenase from Nocardia sp 239. Acta Crystallogr D Biol Crystallogr 1998;54:269–72. [11] Kravos M, Malesic I. Glutamate dehydrogenase as a marker of alcohol dependence. Alcohol Alcohol 2010;45:39–44. [12] Akita H, Suzuki H, Doi K, Ohshima T. Efficient synthesis of d-branched-chain amino acids and their labeled compounds with stable isotopes using d-amino acid dehydrogenase. Appl Microbiol Biotechnol 2013 [Epub ahead of print]. ˇ [13] Minh TH, Kutáˇcek M, Sebánek J. Growth-correlative effect of the root on the apical part of the epicotyl in pea seedlings regarding the IAA content and ltryptophan aminotransferase and l-tryptophan dehydrogenase activities. Biol Plant 1984;26:342–8. [14] Ebeid MM, Dimova S, Kutacek M. Substrate specificity of l-tryptophan dehydrogenase and its distribution in plants. Biol Plant 1985;27:413–6. [15] Kutacek M. Auxin biosynthesis and its regulation on the molecular level. Biol Plant 1985;27:145–53. [16] Vackova K, Mehta A, Kutacek M. Tryptophan aminotransferase and tryptophan dehydrogenase activities in some cell compartments of spinach leaves: the effect of calcium ions on tryptophan dehydrogenase. Biol Plant 1985;27: 154–8. [17] Bahr MKE, Kutacek M, Opatrny Z. l-Tryptophan aminotransferase and ltryptophan dehydrogenase, enzymes of IAA synthesis, in normal and tumorous tobacco tissue cultures. Biochem Physiol Pflanz 1987;182:213–22. [18] Balskus EP, Walsh CT. Investigating the initial steps in the biosynthesis of cyanobacterial sunscreen scytonemin. J Am Chem Soc 2008;130:15260–1. [19] Kaper JM, Gebhard O, Van den Berg CJ, Veldstra H. Studies on indolepyruvic acid: II. Ultraviolet spectrophotometry. Arch Biochem Biophys 1963;103:475–87. [20] Grimshaw CE, Cleland WW. Kinetic mechanism of Bacillus subtilis l-alanine dehydrogenase. Biochemistry 1981;20:5650–5. [21] Gassner G, Wang L, Batie C, Ballou DP. Reaction of phthalate dioxygenase reductase with NADH and NAD: kinetic and spectral characterization of intermediates. Biochemistry 1994;33:12184–93. [22] Yoneda K, Kawakami R, Tagashira Y, Sakuraba H, Goda S, Ohshima T. The first archaeal l-aspartate dehydrogenase from the hyperthermophile Archaeoglobus fulgidus: gene cloning and enzymological characterization. Biochim Biophys Acta 2006;1764:1087–93. [23] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673–80. [24] Perrière G, Gouy M. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 1996;78:364–9. [25] Scapin G, Reddy SG, Blanchard JS. Three-dimensional structure of mesodiaminopimelic acid dehydrogenase from Corynebacterium glutamicum. Biochemistry 1996;35:13540–51. [26] Britton KL, Baker PJ, Engel PC, Rice DW, Stillman TJ. Evolution of substrate diversity in the superfamily of amino acid dehydrogenases, prospects for rational chiral synthesis. J Mol Biol 1993;234:938–45. [27] Baker PJ, Waugh ML, Wang XG, Stillman TJ, Turnbull AP, Engel PC, et al. Determinants of substrate specificity in the superfamily of amino acid dehydrogenases. Biochemistry 1997;36:16109–15. [28] Seah SY, Britton KL, Rice DW, Asano Y, Engel PC. Single amino acid substitution in Bacillus sphaericus phenylalanine dehydrogenase dramatically increases its discrimination between phenylalanine and tyrosine substrates. Biochemistry 2002;41:11390–7.
Contents lists available at ScienceDirect
Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt
Biochemical characterization of an l-tryptophan dehydrogenase from the photoautotrophic cyanobacterium Nostoc punctiforme Ryutaro Ogura 1,2 , Taisuke Wakamatsu ∗ , Yuta Mutaguchi 4 , Katsumi Doi, Toshihisa Ohshima 1,3 Microbial Genetics Division, Institute of Genetic Resources, Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan
a r t i c l e
i n f o
Article history: Received 25 February 2014 Received in revised form 27 March 2014 Accepted 2 April 2014 Available online 13 April 2014 Keywords: l-Tryptophan dehydrogenase NAD+ Nostoc punctiforme Amino acid dehydrogenase B-type stereospecificity
a b s t r a c t An NAD+ -dependent l-tryptophan dehydrogenase from Nostoc punctiforme NIES-2108 (NpTrpDH) was cloned and overexpressed in Escherichia coli. The recombinant NpTrpDH with a C-terminal His6 -tag was purified to homogeneity using a Ni-NTA agarose column, and was found to be a homodimer with a molecular mass of 76.1 kDa. The enzyme required NAD+ and NADH as cofactors for oxidative deamination and reductive amination, respectively, but not NADP+ or NADPH. l-Trp was the preferred substrate for deamination, though l-Phe was deaminated at a much lower rate. The enzyme exclusively aminated 3indolepyruvate; phenylpyruvate was inert. The pH optima for the deamination of l-Trp and amination of 3-indolpyruvate were 11.0 and 7.5, respectively. For deamination of l-Trp, maximum enzymatic activity was observed at 45 ◦ C. NpTrpDH retained more than 80% of its activity after incubation for 30 min at pHs ranging from 5.0 to 11.5 or incubation for 10 min at temperatures up to 40 ◦ C. Unlike l-Trp dehydrogenases from higher plants, NpTrpDH activity was not activated by metal ions. Typical Michaelis–Menten kinetics were observed for NAD+ and l-Trp for oxidative deamination, but with reductive amination there was marked substrate inhibition by 3-indolepyruvate. NMR analysis of the hydrogen transfer from the C4 position of the nicotinamide moiety of NADH showed that NpTrpDH has a pro-S (B-type) stereospecificity similar to the Glu/Leu/Phe/Val dehydrogenase family. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Amino acid dehydrogenases (EC 1.4.1.X) catalyze the reversible NAD(P)+ -dependent oxidative deamination of amino acids to their corresponding 2-oxoacids and ammonia [1–3]. More than fifteen kinds of amino acid dehydrogenases, including those acting on lGlu, l-Ala, l-Ser, l-Val, l-Leu, l-Gly, l-Lys, l-Phe and l-Asp, have
Abbreviations: TrpDH, l-Trp dehydrogenase; NpTrpDH, NAD+ -dependent ltryptophan dehydrogenase from Nostoc punctiforme NIES-2108. ∗ Corresponding author. Present address: Agricultural Science, Graduate School of Integrated Arts and Sciences, Kochi University, 200 Otsu, Monobe, Nankoku, Kochi 783-8502, Japan. Tel.: +81 88 864 5191; fax: +81 88 864 5191. E-mail address: [email protected] (T. Wakamatsu). 1 These authors contributed equally to this work. 2 Present address: Institute for Chemical Research, Kyoto University, Gokasho, Uji, Kyoto 611-0011, Japan. 3 Present address: Department of Biomedical Engineering, Osaka Institute of Technology, 5-16-1 Ohmiya, Asahi-ku, Osaka 535-8585, Japan. 4 Present address: Department of Biotechnology, Faculty of Bioresource Sciences, Akita Prefectural University, 241-438 Shimoshinjo-Nakano, Akita 010-0195, Japan. http://dx.doi.org/10.1016/j.enzmictec.2014.04.002 0141-0229/© 2014 Elsevier Inc. All rights reserved.
been identified in various organisms [1,4,5], and detailed analyses of the structures and functions of l-Glu dehydrogenase [5], l-Leu dehydrogenase [6,7] and l-Phe dehydrogenase [8] have been reported. In addition, several amino acid dehydrogenases have been applied for use in biosensors for l-amino acid, 2-oxoacid and ammonia assays [1,9], disease diagnosis [10,11], and amino acids synthesis [9,12]. As compared to other amino acid dehydrogenases, l-Trp dehydrogenase (EC 1.4.1.19, TrpDH), which catalyzes the reversible oxidative deamination of l-Trp to 3-indolepyruvate in the presence of NAD(P)+ , has not been extensively investigated from the viewpoint of it biochemical or biotechnological potential due in large part to its extremely limited distribution. The enzyme was first identified in several higher plants (e.g., Pisum sativum, Spinacia oleracea and Zea mays, etc.) in the mid 1980s [13], and was partially characterized at that time [14–17]. There was then no further investigation of the enzyme until the product of the Npun R1275 gene (npun r1275) from the cyanobacterium Nostoc punctiforme ATCC 29133 was found to exhibit NAD+ -dependent oxidative deamination activity toward l-Trp [18]. This was the first microbial TrpDH known, and its gene (npun r1275) was located
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
in the gene cluster for biosynthesis of scytonemin, a cyanobacterial radiation-absorbing pigment. The authors suggested that Npun R1275 plays an important role in scytonemin biosynthesis by catalyzing the oxidative deamination of l-Trp, but no detailed analysis of the enzyme’s biochemical properties were reported. In the present study, we cloned a TrpDH homologous gene from N. punctiforme NIES-2108 (nptrpdh) in Escherichia coli and examined in detail the biochemical properties of the expressed product (NpTrpDH) from the viewpoint of its practical application.
41
2. Materials and methods
Gly-NaOH and 1% (v/v) DMSO, pH 11.0), we considered the effect of absorbance by 3-indolepyruvate on absorbance by NADH to calculate the initial velocity. One unit (U) of enzyme was defined as the amount of enzyme catalyzing the formation of 1 mol of NADH from NAD+ per minute under the standard conditions for oxidative deamination. We measured the reductive amination activity of NpTrpDH using a reaction mixture (pH 7.5, 1 ml) containing 200 mM Tris–HCl, 6.25 M 3-indolepyruvate (dissolved in 1% (v/v) DMSO), 400 mM NH4 Cl, 0.2 mM NADH and 15 nM NpTrpDH as the standard assay mixture. Just before the assay, 3-indolepyruvate was dissolved in DMSO, and added to the reaction mixture lacking NADH and NpTrpDH and incubated for 30 min at 25 ◦ C. It was then assumed that the majority of 3-indolepyruvate was in its keto form [19]. The assay for reductive amination was then performed using assay procedures similar to those for oxidative deamination.
2.1. Materials
2.5. Kinetic analyses
A pellet of N. punctiforme NIES-2108 was obtained from the Japan Society for Culture Collections. Enzymes that act on DNA, including restriction enzymes and KOD Plus Neo polymerase, were obtained from Takara Bio Inc. (Otsu, Japan) and TOYOBO (Osaka, Japan). DNA oligomers were synthesized by Hokkaido System Science (Sapporo, Japan). All other reagents used were of the highest commercially available grade.
The initial velocity for oxidative deamination was analyzed using the standard assay condition and the reaction mixture (pH 7.5, 1 ml) containing 200 mM Tris–HCl instead of 200 mM Gly-NaOH. To determine the kinetic constants for lTrp and NAD+ , several different concentrations of l-Trp (0.0100–5.00 mM) or NAD+ (0.0125–2.50 mM) were used. The initial velocity was then plotted against the substrate concentration, and the Km and kcat values were determined by curve fitting using Igor Pro ver. 3.14 software (WaveMetrics, Tigard, OR, USA). The Km and kcat values for 3-indolepyruvate in the reductive amination were determined using various 3-indolepyruvate concentrations (0.00313–1.25 mM) in the presence of 400 mM NH4 Cl and 0.2 mM NADH. Because marked substrate inhibition by 3-indolepyruvate was observed, even when the concentration was relatively low, the reciprocal initial velocities were plotted against the reciprocals of the 3indolepyruvate concentration, and the plots were fitted to the Haldane equation (Eq. (1)) using Igor Pro ver. 3.14 to obtain the Km and kcat values and the inhibition constant for 3-indolepyruvate (KiI ) [8,20].
2.2. Purification of NpTrpDH N. punctiforme NIES-2108 cells were collected from the pellet and initially treated with lysozyme and proteinase K for 1 h at 37 ◦ C. Thereafter, acetyl trimethyl ammonium bromide was added to the mixture (final concentration: 1% (w/v)), which was then incubated for 10 min at 65 ◦ C. After removing the cellular debris by centrifugation, the genomic DNA was isolated from the solution using the phenol/chloroform extraction method, and the nptrpdh coding sequence was amplified by PCR using genomic DNA as the template with primers 5 TATACATATGCTGCTATTTGAAACTGTTAGAGAAATGGGTCACGAACAAGTTCTTTTTTG3 (forward) and 5 -TATACTCGAGAGCTGCGATCGCTTTAGA CTTGCTGCGCTTACTATTG-3 (reverse). These two primers were constructed based on the sequence of npun r1275, with the forward primer containing a NdeI recognition site and the reverse primer containing a XhoI recognition site (underlined). The amplified gene fragments were ligated into plasmid pET-29b (Merck, Darmstadt, Germany) at the NdeI and XhoI sites, yielding an expression vector encoding NpTrpDH with a C-terminal His6 -tag, after which the sequence of the vector was confirmed. E. coli BL21(DE3) (Merck) cells were then transformed with the plasmid and cultured in 2.5 l of LB medium containing 20 g kanamycin/ml at 37 ◦ C until the OD600 = 0.8. Expression was then induced by addition of 0.6 mM IPTG, and the incubation was continued for an additional 3 h at 37 ◦ C. The cells (wet weight: ∼10 g) were then harvested by centrifugation and stored at −20 ◦ C. The following procedures were carried out at 4 ◦ C unless stated otherwise. Frozen cells (wet weight: ∼10 g) were thawed, suspended in 50 ml of buffer I (pH 8.0) [50 mM Tris–HCl, 300 mM NaCl, 5 mM -mercaptoethanol, 10 mM imidazole, 20% glycerol and a protease inhibitor cocktail tablet (EDTA-free; Roche, Basel, Switzerland)], disrupted by sonication on ice, and centrifuged (24,000 × g) for 30 min. The resultant supernatant was loaded onto a Ni-NTA agarose column (bed volume, 4 ml; QIAGEN, Hilden, Germany) equilibrated with buffer II (pH 8.0) [50 mM Tris–HCl, 300 mM NaCl, 5 mM -mercaptoethanol, 10 mM imidazole and 20% glycerol], and the proteins were eluted with a linear gradient of 0.06–1 M imidazole (total volume, 60 ml). Fractions containing NpTrpDH were dialyzed against buffer III (pH 8.0) [50 mM Tris–HCl, 300 mM NaCl, 1 mM DTT, and 20% glycerol]. The C-terminal Leu-Glu-His-His-His-His-His-His tag was retained.
v=
Vmax [S] 2
Km + [S] + [S] /KiI
Kinetic constants for ammonia were determined using different NH4 Cl concentrations (50.0–400 mM) in the presence of 4.17, 5.00 or 6.25 M 3-indolepyruvate and 0.2 mM NADH. Determination of the Km and kcat values for ammonia was carried out using a relatively low concentration of 3-indolepyruvate to avoid substrate inhibition. The reciprocal initial velocities (1/v) were then plotted against the reciprocal NH4 Cl concentrations (1/[NH4 Cl]) at each 3-indolepyruvate concentration and analyzed using linear regression. These data were then fitted to the following equation (Eq. (2)) to calculate the Km and kcat values for ammonia [8].
v=
Vmax [NH4 Cl][3 − indolepyruvate] KmA [3 − indolepyruvate] + KmI [NH4 Cl] + [NH4 Cl][3 − indolepyruvate] + KiA KmI (2)
where KmA and KmI are the Km s for ammonia and 3-indolepyruvate, respectively. KiA then indicates the dissociation constant for the NpTrpDH–ammonia complex. Kinetic constants for NADH were calculated by varying the NADH concentration (0.00267–0.200 mM) in the presence of 4.17, 5.00 or 6.25 M 3-indolepyruvate and 400 mM NH4 Cl. The reciprocal initial velocities (1/v) were then plotted against the reciprocal NADH concentrations (1/[NADH]) at each 3-indolepyruvate concentration and analyzed using linear regression. These data were then fitted to the following equation (Eq. (3)) to calculate the Km and kcat values for NADH [8].
v=
Vmax [NADH][3 − indolepyruvate] KmN [3 − indolepyruvate] + KmI [NADH] + [NADH][3 − indolepyruvate]
2.3. Size exclusion chromatography
where KmN and KmI are Km s for NADH and 3-indolepyruvate, respectively.
NpTrpDH was applied to a Superdex 200 10/300 GL column (1.0 cm × 30 cm, GE Healthcare, Little Chalfont, UK) and eluted with buffer IV (pH 7.5) [50 mM Tris–HCl, 100 mM KCl, and 1 mM DTT] at a flow rate of 0.5 ml/min using an ÄKTA Explorer System (GE Healthcare). The apparent molecular mass was estimated by comparing the protein’s retention time with those of molecular mass markers (MWGF1000-1KT; Sigma–Aldrich, St. Louis, MO, USA).
2.6. Effects of pH and temperature on enzyme activity
2.4. Enzyme assays NpTrpDH-catalyzed reduction of NAD(P)+ or oxidation of NAD(P)H was followed at 340 nm using a UV-1600 UV–visible Spectrophotometer (Shimadzu, Kyoto, Japan) equipped with a temperature-controlled cuvette holder. Three independent experiments were performed for all enzyme assays. The standard assay mixture (pH 11.0, 1 ml) for oxidative deamination contained 200 mM Gly-NaOH, 5 mM l-Trp, 1.25 mM NAD+ and 100 nM NpTrpDH. The mixture (900 l) without NpTrpDH was first incubated for 3 min at 25 ◦ C before the enzyme reaction was started by addition of NpTrpDH solution (100 l, dissolved in buffer III) to the mixture. In each assay, the initial velocity was determined by measuring the linear increase in the absorbance at 340 nm. Because of the measurable absorbance of 3-indolepyruvate at 340 nm (extinction coefficient at 340 nm for 3-indolepyruvate: 680 M−1 cm−1 in 200 mM
(1)
(3)
The pH dependences for oxidative deamination and reductive amination catalyzed by NpTrpDH were determined at 25 ◦ C using 200 mM concentrations of the following buffers: MES-NaOH (pH 6.5 and 7.0), HEPES-NaOH (pH 7.0–8.0), TAPSNaOH (pH 8.0–9.0), Gly-NaOH (pH 9.0–11.0), and Na2 HPO4 -Na3 PO4 (pH 11.0–12.0). The temperature dependence was evaluated by measuring the oxidative deamination activity at temperatures ranging from 20 ◦ C to 60 ◦ C. These assays were monitored for 1 min. 2.7. Effects of pH and temperature on enzyme stability The effect of pH on enzyme stability was evaluated by incubating 0.332 M NpTrpDH for 30 min at 4 ◦ C with 100 mM concentrations of the following buffers: Na-citrate (pH 3.0–6.0), MES-NaOH (pH 6.0–7.0), Tris–HCl (pH 7.0–8.0), TAPS-NaOH (pH 8.0–9.0), Gly-NaOH (pH 9.0–11.0) and Na2 HPO4 -Na3 PO4 (pH 11.0–12.0). The enzyme solution was then rapidly cooled on ice, and the remaining activity was determined using the standard oxidative deamination assay. The thermal stability was determined by incubating 1.66 М NpTrpDH in 50 mM HEPES-NaOH (pH 7.5) for 10 min at various temperatures (20–50 ◦ C). The enzyme solution was then
42
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
rapidly cooled on ice, and the remaining activity was determined using the standard oxidative deamination assay. 2.8. Effect of various compounds on enzyme activity The effect adding various compounds, including 1 mM concentrations of MgCl2 , MnCl2 , ZnCl2 , CaCl2 and CoCl2 ; 10 mM EDTA; 100 mM KCl or 1% DMSO was examined using the standard assay mixture for oxidative deamination. 2.9. Stereospecificity of NpTrpDH-catalyzed hydrogen transfer from NADH to 3-indolepyruvate The stereospecificity of NpTrpDH-catalyzed hydrogen transfer from NADH was analyzed using 1 H-NMR analysis. [4R-2 H]NADH was first prepared as described previously [21] with minor modifications. Briefly, 0.6 ml of deuterated ethanol (CD3 CD2 OD; Merck) were incubated with 150 U of alcohol dehydrogenase (Astereospecific) from Saccharomyces cerevisiae (Sigma–Aldrich) and 75 mol of NAD+ in 10 ml of 100 mM NH4 HCO3 buffer (pH 7.5) for 15 min at 25 ◦ C. The formation of [4R-2 H]NADH was monitored using a UV-1600 UV–visible spectrophotometer at a wavelength of 340 nm. The mixture was then passed through a centrifugal filter (10,000 molecular weight cutoff; Amicon Ultra, Millipore, Billerica, MA, USA) to remove the alcohol dehydrogenase. The filtrate was then diluted 5-fold with distilled water and applied to a 10-ml Toyopearl DEAE-650 M column (Tosoh, Shunanshi, Japan), and [4R-2 H]NADH was eluted using a linear gradient of 10–200 mM NH4 HCO3 buffer (pH 7.5, total 80 ml). The fractions containing [4R-2 H]NADH were collected as those that showed strong absorbance at 340 nm. They were then lyophilized, yielding 9 mg of [4R-2 H]NADH. To determine the hydrogen transfer stereospecificity for NADH in the NpTrpDH reaction, the mixture contained 0.10 M NpTrpDH (activity: 4.0 mol/min), 2.5 mM 3-indolepyruvate, 200 mM NH4 Cl, 2.9 mg of [4R-2 H] NADH and 100 mM NH4 HCO3
buffer (pH 7.5) in a final volume of 5.0 ml. As a reference for A-stereospecific (pro-R specific) hydrogen transfer by an amino acid dehydrogenase, we used NAD+ dependent l-Asp dehydrogenase from Archaeoglobus fulgidus (AfAspDH) [22]. This mixture contained 4.0 U of AfAspDH (a unit was defined as the amount of enzyme producing 1.0 mol of NADH per minute at 50 ◦ C under the standard assay conditions), 2.5 mM oxaloacetate, 200 mM NH4 Cl, 2.9 mg of [4R-2 H]NADH and 100 mM NH4 HCO3 buffer (pH 7.5) in a final volume of 5.0 ml. After incubating for 1 h at 25 ◦ C (NpTrpDH) or 50 ◦ C (AfAspDH), the reaction solution was passed through a centrifugal filter (10,000 molecular weight cutoff; Amicon Ultra). The 1 H-NMR spectra for the C4 position on the nicotinamide ring of NAD+ produced from [4R-2 H]NADH were then analyzed using a 400-MHz 1 H-NMR instrument (JEOL, Akishima, Japan).
3. Results 3.1. DNA and amino acid sequences of TrpDH from N. punctiforme NIES-2108 Although the sequence of the N. punctiforme ATCC 29133 (PCC 73102) (NC 010628.1) genome is known, the N. punctiforme NIES-2108 genome has not yet been sequenced. We therefore determined the DNA sequence of NpTrpDH and submitted it to GenBank (BankIt1608548). The amino acid sequence was then determined on the basis of the DNA sequence and the codon usage table for Nostoc sp. PCC 7120 (http://www.kazusa.or.jp/) (Fig. 1). The amino acid sequence of NpTrpDH shows 95% identity and 98% similarity to that of Npun R1275.
Fig. 1. Alignment of the amino acid sequences of NpTrpDH and Npun R1275 from N. punctiforme ATCC 29133, NAD+ -dependent l-Leu dehydrogenase from Lysinibacillus sphaericus (LsLeuDH, PDB ID: 1LEH) and NAD+ -dependent l-Phe dehydrogenase from Rhodococcus sp. (RsPheDH, PDB ID: 1C1D). The sequence alignment was prepared using ClustalW [23]. Residues that interact with NAD+ are boxed. Residues that form a hydrophobic pocket in the crystal structure (PDB ID: 1C1D) are indicated by arrows.
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46 Table 1 Coenzyme specificity of TrpDH activity. Coenzyme
43
Table 2 Substrate specificity.a Relative activity (%)
Oxidative deaminationa NAD+ NADP+
100b 0c
Reductive aminationa NADH NADPH
100b 3.0 ± 0.26
Assays were performed at 25 ◦ C, as described in Section 2. A value of 100% denotes activities of 6.6 U/mg and 7.2 mol/min mg for oxidative deamination and reductive amination, respectively. c A value of 0% indicates that activity was not detected, even with a 10 times molar excess of enzyme, as compared to the activity with NAD+ . a
b
3.2. Purification of NpTrpDH Recombinant E. coli expressed NpTrpDH in both the soluble and insoluble protein fractions, and the soluble fraction exhibited NAD+ -dependent oxidative deamination activity toward l-Trp. NpTrpDH was purified from the cell extract of recombinant E. coli using a Ni-NTA agarose column. Approximately 40 mg of purified NpTrpDH was obtained with a 68% yield from the cell extract (10 g of cells (wet weight) from 2.5 l of culture medium). The purity was at least 95%, as judged from SDS-PAGE (data not shown). 3.3. Molecular mass determination The apparent molecular mass of the native protein was determined to be 76.1 kDa using HPLC with a Superdex 200 column (data not shown). The molecular mass of the monomer with the retained C-terminal His6 -tag was calculated to be 39.5 kDa from the amino acid sequences (Fig. 1). The native protein thus appears to exist as a homodimer. 3.4. Coenzyme and substrate specificity NpTrpDH exhibited NAD+ -dependent oxidative deamination activity toward l-Trp, whereas no NADP+ -dependent activity was detected, even when the assay was run with a 10 times higher concentration of NpTrpDH (1 M) (Table 1). In the reductive amination of 3-indolepyruvate, NpTrpDH showed much less activity with NADPH (relative activity: 3%) than with NADH. The activity for oxidative deamination of l-Trp with NAD+ was 6.6 ± 0.3 U/mg, and for reductive amination of 3-indolepyruvate with NADH it was 7.2 ± 0.4 mol (of NAD+ formed)/min mg.
Substrate
Relative activity (%)
Oxidative deaminationb l-Trp d-Trp l-Phe l-Tyr l-Ala l-Val l-Leu l-Ile l-Pro l-Cys l-Met l-Asp l-Glu l-Asn l-Gln l-Ser l-Thr l-His l-Arg l-Lys Gly
100d 0e 23 ± 0.46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Reductive aminationc 3-Indolepyruvate Phenylpyruvate
100d 0
a NAD+ and NADH were used as the coenzymes for oxidative deamination and reductive amination, respectively. b Assays were performed at 25 ◦ C in a mixture (pH 11.0) containing 200 mM GlyNaOH, 5 mM substrate, 1.25 mM NAD+ and 100 nM NpTrpDH. c Assays were performed at 25 ◦ C in a mixture (pH 7.5) containing 200 mM Tris–HCl, 6.25 M substrate, 400 mM NH4 Cl, 0.2 mM NADH and 15 nM NpTrpDH. d A value of 100% denotes activities of 6.6 U/mg and 7.2 mol/min mg for oxidative deamination and reductive amination, respectively. e A value of 0% indicates that activity was not detected under this condition.
NpTrpDH used l-Trp as its preferred electron donor for oxidative deamination and showed much less activity with l-Phe (relative activity: 23%) (Table 2). Other l-amino acids and D-Trp were inert as electron donors for NpTrpDH in the presence of NAD+ . For reductive amination, 3-indolepyruvate was preferentially aminated in the presence of ammonia and NADH. Phenylpyruvate was inert. 3.5. Effects of pH and temperature on enzyme activity NpTrpDH-catalyzed oxidative deamination increased with increasing pH, and maximum activity was observed at around pH 11.0 (Fig. 2a). For reductive amination, maximum activity was
Fig. 2. Effects of pH (a) and temperature (b) on TrpDH activity. (a) Effect of pH on oxidative deamination (open symbols) and reductive amination (filled symbols) by NpTrpDH. A value of 100% denotes activities of 6.6 U/mg and 7.2 mol/min mg for oxidative deamination and reductive amination, respectively. (b) Effect of temperature on oxidative deamination by NpTrpDH. The enzyme activity was measured at various temperatures between 20 ◦ C and 60 ◦ C. A value of 100% denotes a specific activity of 30.1 mol/min mg at 45 ◦ C.
44
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
Fig. 3. Effects of pH (a) and temperature (b) on enzyme stability. (a) Oxidative deamination by NpTrpDH after incubation for 30 min at 4 ◦ C in buffer solutions of various pH. A value of 100% denotes an activity of 6.6 U/mg. (b) Oxidative deamination by NpTrpDH after incubation for 10 min at various temperatures in 50 mM HEPES-NaOH buffer (pH 7.5). A value of 100% denotes an activity of 6.6 U/mg.
observed around pH 7.5 (Fig. 2a). In addition, maximum activity for oxidative deamination at pH 11.0 was observed at 45 ◦ C (Fig. 2b). 3.6. Effects of pH and temperature on enzyme stability NpTrpDH retained more than 80% of its activity after incubation for 30 min at pH 5.0–11.5 (Fig. 3a). Similarly, no enzyme activity was lost after incubation for 10 min at up to 40 ◦ C (Fig. 3b). On the other hand, there was a complete loss of activity when the enzyme was incubated at temperatures above 50 ◦ C. 3.7. Kinetic constants Initial velocity plots versus l-Trp or NAD+ concentrations showed typical Michaelis–Menten type kinetics (data not shown), which suggests NpTrpDH exhibits no homotropic cooperativity with l-Trp and NAD+ . The kinetic constants determined using Igor Pro ver. 3.14 are listed in Table 3. NpTrpDH also showed significant deamination activity, even at pH 7.5, which may be near physiological pH. For reductive amination, however, marked substrate inhibition by 3-indolepyruvate was observed (Fig. 4, Table 3). The reciprocal initial velocities (1/v) plotted against
Fig. 4. Substrate inhibition by 3-indolepyruvate. Double reciprocal plots of initialvelocity/mg-NpTrpDH versus 3-indolepyruvate concentration. The solid line was drawn by curve fitting to the Haldane equation (Eq. (1)) using Igor Pro ver. 3.14. The broken line was drawn based on the initial-velocity/mg data for 3.13–6.25 M 3-indolepyruvate and shows the hypothetical initial-velocity/mg pattern without substrate inhibition by 3-indolepyruvate.
1/[NH4 Cl] and 1/[NADH] in the presence of constant concentration or several concentrations of 3-indolepyruvate gave an intersectingand a parallel-initial velocity pattern, respectively, without substrate inhibition (data not shown). This suggests that, unlike 3-indolepyruvate, ammonia and NADH do not mediate substrate inhibition. The kinetic constants determined with Igor Pro ver. 3.14 are also listed in Table 3.
3.8. Effect of various compounds on the enzyme activity None of the metal ions tested (1 mM) or EDTA (10 mM), KCl (100 mM) or DMSO (1%) had a large effect on NpTrpDH activity (remaining activity: 92–107%).
Fig. 5. 1 H-NMR spectra for the C4 position on the nicotinamide ring of NAD+ . NAD+ was produced using NpTrpDH, 3-indolepyruvate, NH4 Cl and [4R-2 H]NADH (a) or using AfAspDH, oxaloacetate, NH4 Cl and [4R-2 H]NADH (b). The filled and open arrows show the proton signal at C4 of NAD+ and the peak for 3-indolepyruvate, respectively.
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
45
Table 3 Kinetic constants. Substrate
Km (mM)a
kcat (s−1 )a
Oxidative deamination NAD+ l-Trp
0.025 ± 0.0025 (0.10 ± 0.0048)b 0.031 ± 0.0013 (0.47 ± 0.063)
4.3 ± 0.050 (0.63 ± 0.015) 4.2 ± 0.10 (0.59 ± 0.036)
Reductive amination NADH 3-Indolepyruvate Ammonia
0.038 ± 0.00070 0.014 ± 0.011 130 ± 17
21 ± 5.0 16 ± 10 17 ± 4.8
kcat /Km (mM−1 s−1 )
KiI (mM)c
170 (6.3) 140 (1.3) 550 1100 0.13
0.014 ± 0.0018
a Assays were performed at 25 ◦ C, as described in Section 2. In these assays, the enzyme was mixed with various concentrations of substrate. Km and kcat were determined through nonlinear regression analysis of the assay data. b Values in parentheses represent the activity at pH 7.5. c KiI was determined through nonlinear regression analysis of double-reciprocal plots with the calculated Km and kcat values.
Fig. 6. Phylogenetic tree of putative TrpDHs from Cyanobacteria and other l-amino acid dehydrogenases. The phylogenetic tree was constructed using neighbor-joining methods with ClustalW [23] and NJplot [24]. The values given in parentheses denote the amino acid sequence identity with NpTrpDH. The numbers on the nodes are the bootstrap values for 1000 counts. The bar indicates a genetic distance of 0.05.
3.9. Stereospecificity of hydrogen transfer from NADH We used [4R-2 H]NADH to analyze the stereospecificity of NpTrpDH-catalyzed hydrogen transfer from NADH to 3indolepyruvate. When [4R-2 H]NADH was incubated with NpTrpDH, a doublet signal from the C4 proton of NAD+ at around 8.50 ppm was not observed in the 1 H-NMR spectrum (Fig. 5a), which indicates the 4R-2 H of NADH remained in the NAD+ , and the 4S-1 H was removed and transferred to 3-indolepyruvate. When NADH was used instead of 2 H-labeled NADH as the control, a resonance signal at around 8.50 ppm reflecting the C4 proton of NAD+ was observed in the 1 H-NMR spectrum (data not shown). In addition, when [4R-2 H]NADH was incubated with AfAspDH (Atype stereospecific enzyme), a resonance doublet was observed at around 8.65 ppm in the 1 H-NMR spectrum (Fig. 5b). These results indicate that NpTrpDH has a B-type stereospecificity for hydrogen transfer from NADH; it thus differs from A-type stereospecific AfAspDH. 4. Discussion In the present study, we succeeded in expressing the Npun R1275 homologous gene from N. punctiforme NIES-2108 in E. coli and purifying the product. Characterization of the purified enzyme using a spectrophotometric assay showed that the enzyme catalyzes the reversible deamination of l-Trp to 3-indolepyruvate in the presence of NAD+ . The enzyme was not affected by the presence of metal ions or EDTA, though TrpDHs from both P. sativum and S. oleracea are reportedly activated by Ca2+ and Mn2+ and inhibited by EDTA [15,16]. Thus unlike TrpDHs from higher plants, NpTrpDH does not require metal ion for activity. In addition, the enzyme
retains more than 80% of its activity after incubation for 30 min at pH 5.0–11.5 and does not lose activity at temperatures below 40 ◦ C, but nearly half its activity is lost with incubation for 10 min at 45 ◦ C. This suggests NpTrpDH is potentially useful for applications such as spectrophotometric sensing of l-Trp. Cyanobacterial TrpDH genes are reportedly located within the gene cluster for scytonemin biosynthesis, and their products catalyze the deamination of l-Trp as an initial step in the biosynthetic pathway [18]. We postulate that like other cyanobacterial TrpDHs, NpTrpDH functions physiologically in the deamination of l-Trp as the initial step in scytonemin biosynthesis. In the web database, Npun R1275 homologous proteins are annotated as “Glu/Leu/Phe/Val dehydrogenase, C terminal” or “Leu dehydrogenase.” However, the phylogenetic tree shows that Npun R1275 homologous proteins, whose genes are located in the gene cluster for biosynthesis of scytonemin or aromatic amino acids, have high sequence identity to one another and have the same node (Fig. 6). By contrast, their clusters are distant from those of other l-amino acid dehydrogenases, such as l-Glu dehydrogenase, l-Leu dehydrogenase and l-Phe dehydrogenase. In addition, we showed here that NpTrpDH is highly susceptible to inhibition by its substrate, 3-indolepyruvate. This suggests that NpTrpDH functions in the degradation of l-Trp but not its formation from 3-indolepyruvate and ammonia, though more detailed experimental examination of the mechanisms underlying 3-indolepyruvate inhibition, the enzyme’s induction and its physiological function are needed. Our findings indicate that the NpTrpDH-catalyzed transfer of a C4-hydrogen from the pyridine ring of NADH is Pro-S-specific. This means that TrpDH belongs a group of enzymes catalyzing B-stereospecific hydrogen transfer, which also includes l-Glu dehydrogenase, l-Leu dehydrogenase, l-Phe dehydrogenase and
46
R. Ogura et al. / Enzyme and Microbial Technology 60 (2014) 40–46
l-Val dehydrogenase, but not l-Ala dehydrogenase, l-Asp dehydrogenase [3,4] or meso-diaminopimelate dehydrogenase [25]. When we compared the amino acid sequences of NpTrpDH with those of other l-amino acid dehydrogenases, NpTrpDH showed higher sequence homology with B-stereospecific amino acid dehydrogenases than A-stereospecific ones (Fig. 6). For example, the multiple alignment in Fig. 1 shows the high sequence homology of NpTrpDH with NAD+ dependent l-Leu dehydrogenase from Lysinibacillus sphaericus (PDB ID: 1LEH) [6] and NAD+ dependent l-Phe dehydrogenase from Rhodococcus sp. (PDB ID: 1C1D) [8], whose crystal structures have been determined. This alignment indicates that residues that may be involved in the recognition of NAD+ are highly conserved among NpTrpDH and the other two enzymes. In addition, multiple alignment and site-directed mutagenesis analyses have shown that, as B-stereospecific enzymes, Glu/Leu/Phe/Val dehydrogenases stereospecifically recognize their substrates based on the shape and hydrophobicity of their substrate recognition pockets [26–28]. Given that l-Trp is relatively bulky and is one of the most hydrophobic amino acids, we suggest that the substraterecognition site of NpTrpDH likely contains a particularly large hydrophobic pocket comprised of amino acids specifically well suited to bind l-Trp and differing from other similar enzymes. For example, we predict it will differ from the recognition site for the phenyl group in l-Phe dehydrogenase from Rhodococcus sp. (PDB ID: 1C1D) [8], which also forms a hydrophobic pocket. We are now performing an X-ray crystallographic analysis of NpTrpDH to learn the details of the substrate-recognition, coenzyme-recognition and catalytic mechanisms. Acknowledgements This work was supported in part by Grant-in-Aid for Scientific Research 22248010 (to T.O.) from the Ministry of Education, Science, Sports and Culture of Japan. We thank Ms. Keiko Ideta for assisting with the NMR data collection. References [1] Ohshima T, Soda K. Biochemistry and biotechnology of amino acid dehydrogenases. Adv Biochem Eng Biotechnol 1990;42:187–209. [2] Brunhuber NM, Blanchard JS. The biochemistry and enzymology of amino acid dehydrogenases. Crit Rev Biochem Mol Biol 1994;29:415–67. [3] Li Y, Ogola HJ, Sawa Y. l-Aspartate dehydrogenase: features and applications. Appl Microbiol Biotechnol 2012;93:503–16. [4] Ohshima T, Soda K. Amino acid dehydrogenases and their applications. In: Patel RN, editor. Stereoselective Biocatalysis. New York: Marcel Dekker Inc; 2000. p. 877–902. [5] Ohshima T. Structural characteristics of active and inactive glutamate dehydrogenases from the hyperthermophile Pyrobaculum islandicum. Biosci Biotechnol Biochem 2012;76:1601–10. [6] Baker PJ, Turnbull AP, Sedelnikova SE, Stillman TJ, Rice DW. A role for quaternary structure in the substrate specificity of leucine dehydrogenase. Structure 1995;3:693–705.
[7] Zhao Y, Wakamatsu T, Doi K, Sakuraba H, Ohshima T. A psychrophilic leucine dehydrogenase from Sporosarcina psychrophila: purification, characterization, gene sequencing and crystal structure analysis. J Mol Catal B Enzyme 2012;83:65–72. [8] Brunhuber NM, Thoden JB, Blanchard JS, Vanhooke JL. Rhodococcus lphenylalanine dehydrogenase: kinetics, mechanism, and structural basis for catalytic specificity. Biochemistry 2000;39:9174–87. [9] Ohshima T, Soda K. Thermostable amino acid dehydrogenases: applications and gene cloning. Trends Biotechnol 1989;7:210–4. [10] Pasquo A, Britton KL, Baker PJ, Brearley G, Hinton RJ, Moir AJ, et al. Crystallization of NAD+ -dependent phenylalanine dehydrogenase from Nocardia sp 239. Acta Crystallogr D Biol Crystallogr 1998;54:269–72. [11] Kravos M, Malesic I. Glutamate dehydrogenase as a marker of alcohol dependence. Alcohol Alcohol 2010;45:39–44. [12] Akita H, Suzuki H, Doi K, Ohshima T. Efficient synthesis of d-branched-chain amino acids and their labeled compounds with stable isotopes using d-amino acid dehydrogenase. Appl Microbiol Biotechnol 2013 [Epub ahead of print]. ˇ [13] Minh TH, Kutáˇcek M, Sebánek J. Growth-correlative effect of the root on the apical part of the epicotyl in pea seedlings regarding the IAA content and ltryptophan aminotransferase and l-tryptophan dehydrogenase activities. Biol Plant 1984;26:342–8. [14] Ebeid MM, Dimova S, Kutacek M. Substrate specificity of l-tryptophan dehydrogenase and its distribution in plants. Biol Plant 1985;27:413–6. [15] Kutacek M. Auxin biosynthesis and its regulation on the molecular level. Biol Plant 1985;27:145–53. [16] Vackova K, Mehta A, Kutacek M. Tryptophan aminotransferase and tryptophan dehydrogenase activities in some cell compartments of spinach leaves: the effect of calcium ions on tryptophan dehydrogenase. Biol Plant 1985;27: 154–8. [17] Bahr MKE, Kutacek M, Opatrny Z. l-Tryptophan aminotransferase and ltryptophan dehydrogenase, enzymes of IAA synthesis, in normal and tumorous tobacco tissue cultures. Biochem Physiol Pflanz 1987;182:213–22. [18] Balskus EP, Walsh CT. Investigating the initial steps in the biosynthesis of cyanobacterial sunscreen scytonemin. J Am Chem Soc 2008;130:15260–1. [19] Kaper JM, Gebhard O, Van den Berg CJ, Veldstra H. Studies on indolepyruvic acid: II. Ultraviolet spectrophotometry. Arch Biochem Biophys 1963;103:475–87. [20] Grimshaw CE, Cleland WW. Kinetic mechanism of Bacillus subtilis l-alanine dehydrogenase. Biochemistry 1981;20:5650–5. [21] Gassner G, Wang L, Batie C, Ballou DP. Reaction of phthalate dioxygenase reductase with NADH and NAD: kinetic and spectral characterization of intermediates. Biochemistry 1994;33:12184–93. [22] Yoneda K, Kawakami R, Tagashira Y, Sakuraba H, Goda S, Ohshima T. The first archaeal l-aspartate dehydrogenase from the hyperthermophile Archaeoglobus fulgidus: gene cloning and enzymological characterization. Biochim Biophys Acta 2006;1764:1087–93. [23] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673–80. [24] Perrière G, Gouy M. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 1996;78:364–9. [25] Scapin G, Reddy SG, Blanchard JS. Three-dimensional structure of mesodiaminopimelic acid dehydrogenase from Corynebacterium glutamicum. Biochemistry 1996;35:13540–51. [26] Britton KL, Baker PJ, Engel PC, Rice DW, Stillman TJ. Evolution of substrate diversity in the superfamily of amino acid dehydrogenases, prospects for rational chiral synthesis. J Mol Biol 1993;234:938–45. [27] Baker PJ, Waugh ML, Wang XG, Stillman TJ, Turnbull AP, Engel PC, et al. Determinants of substrate specificity in the superfamily of amino acid dehydrogenases. Biochemistry 1997;36:16109–15. [28] Seah SY, Britton KL, Rice DW, Asano Y, Engel PC. Single amino acid substitution in Bacillus sphaericus phenylalanine dehydrogenase dramatically increases its discrimination between phenylalanine and tyrosine substrates. Biochemistry 2002;41:11390–7.
