Biochem Genet (2016) 54:61–72 DOI 10.1007/s10528-015-9701-1 ORIGINAL ARTICLE
Biochemical and Behavioral Evaluation of Human MAPT Mutations in Transgenic Drosophila melanogaster Mohammad Haddadi1 • Upendra Nongthomba2 S. R. Ramesh3
•
Received: 5 September 2014 / Accepted: 30 October 2015 / Published online: 18 November 2015 Ó Springer Science+Business Media New York 2015
Abstract Mutations in the human microtubule-associated protein tau (hMAPT) gene including R406W and V337M result in autosomal dominant neurodegenerative disorder. These mutations lead to hyperphosphorylation and aggregation of Tau protein which is a known genetic factor underlying development of Alzheimer’s disease (AD). In the present study, transgenic Drosophila models of AD expressing wild-type and mutant forms of hMAPT exhibit a progressive neurodegeneration which was manifested in the form of early death and impairment of cognitive ability. Moreover, they were also found to have significantly decreased activity of neurotransmitter enzymes accompanied by decreased cellular endogenous antioxidant profile. The extent of neurodegeneration, memory impairment, and biochemical profiles was different in the tau transgenic strains which indicate multiple molecular and cellular responses underlie each particular form of hMAPT. Keywords
hMAPT Neurodegeneration Memory impairment Oxidative stress
Introduction The R406W and V337M mutations in the human microtubule-associated protein tau (hMAPT) result in hyperphosphorylation and thus aggregation of Tau protein which is a well-known neuropathogenic factor for development of Alzheimer’s disease (AD) (Spillantini et al. 1998; Hutton 2000). In Drosophila model of tauopathies, & S. R. Ramesh [email protected] 1
Department of Biology, Faculty of Science, University of Zabol, Zabol, Iran
2
Department of Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore, India
3
Department of Studies in Zoology, University of Mysore, Manasagangotri, Mysore, India
123
62
Biochem Genet (2016) 54:61–72
hyperphosphorylation and neurodegeneration of tau in the brain of the transgenic flies have been demonstrated following over-expression of both wild-type and mutant copies of hMAPT (Wittmann et al. 2001). Mershin et al. (2004) studied tauinduced learning and memory deficit by expressing wild-type tau gene from different species including Drosophila and bovine and have reported that accumulation of Tau in MBs of Drosophila brain causes memory impairment. The causative role of oxidative stress (OS) and tau toxicity in Drosophila was investigated by Dias-Santagata et al. (2007) who were able to show that genetic and pharmacologic manipulation of antioxidant defense system causes tau-induced neurodegeneration to different degrees. However, an integrated study employing wild-type and mutant forms of hMAPT in the induction of AD-like symptoms in Drosophila to understand the relationship between tau toxicity, memory impairment, and OS has not been undertaken so far. Hence, in the present study wild-type and two mutant forms of hMAPT were over-expressed in the neurons of Drosophila brain in order to induce neurodegeneration and to investigate the tau-mediated pathogenesis with special attention to each genotype. To ensure that the levels of hMAPT expressed from each transgenic line are equal, their relative expression was quantified. Longevity, olfactory memory, and oxidative status of the transgenic lines were the parameters considered to understand the extent of pathogenesis induced by different forms of hMAPT gene which may provide a basis for understanding molecular interaction between human Tau proteins and neuronal components.
Materials and Methods Chemicals Benzaldehyde, 3-Octanol, Pyrogallol, Acetylthiocholine iodide, Butyrylthiocholine iodide, Osmium tetroxide, Propylene oxide, Araldite resin, Thiobarbituric acid (TBA), Dichloro-dihydrofluorescein diacetate (DCFH-DA), Acetylthiocholine Iodide (ATCI), Butyrylthiocholine iodide (BTCI), Ethylenediaminetetraacetic acid (EDTA), Tetramethoxypropane (TMP), and 5, 50 -dithiobis 2-nitrobenzoic acid (DTNB) were purchased from Sigma Chemical Co. St Louis, CA, USA. All other chemicals used were purchased from Sisco Research Laboratories, Mumbai, India, which were of the highest purity grade. Drosophila Stocks and Maintenance All the Drosophila stocks were raised and maintained on standard wheat cream agar media supplemented with dry yeast granules at 22 ± 1°C, 70–80% relative humidity, and 12-h light/12-h dark in a vivarium. Bloomington stock w1118 was used as a control genotype, and elav-Gal4C155 and c739-Gal4 stocks were used to drive neuronal over-expression of the tau. The UAS-MAPTWT, UAS-MAPTR406W, and UAS-MAPTV337M transgenics were used to induce tauopathies (Wittmann et al. 2001). All the stocks were normalized by out-crossing to an isogenic w1118 stock at least for six generations.
123
Biochem Genet (2016) 54:61–72
63
Semi-q-RT PCR To quantify the expression levels of hMAPT protein in tau transgenic flies, semiquantitative RT PCR amplification was performed. Total RNA was extracted from the head homogenates using TRIzol reagent. The primers were designed using Gene Runner, version 3.05. The sequences of the primers were as follows: forward 50 GGAAGACGTTCTCACTGATCTG and reverse 50 AGGAGTCTGGCTTCAG TCTCTC. House-keeping gene rp49 was used as control using following primers: forward 50 TTCTACCAGCTTCAAGATGAC and reverse 50 GTGTATTCCGAC CACGTTACA. Using the affinity Script QPCR cDNA synthesis kit, 1 lg of DNasetreated RNA was reverse transcribed to get 50 ng/ll of cDNA. PCR amplification of hMAPT gene region was performed using ExTaq (TaKaRa). The resultant PCR products were analyzed through agarose gel electrophoresis and documented using Alpha DigiDoc RT2 (JH BIO Innovations, India). Each sample was run in triplicate for each genotype using 50 ng input per reaction. PCR consisted of initial denaturation at 95°C for 3 min followed by 30 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s. The relative expression levels of the target gene were determined after normalizing with rp49 as the reference gene by quantification of band intensity using ImageJ software 1.47 (Schneider et al. 2012). For this measurement, the region of interest (ROI) was selected using selection tools, and the given values for area, integrated density, and gray value were noted. Then a region next to the selected area which does not have color was selected, and the same value was taken and considered as background. The background area was threefold larger than ROI. All the data were transferred to an excel sheet, and corrected total band density was calculated using the following formula: image density = integrated density - (Area of ROI) 9 mean intensity of background readings. Longevity Assay Lifespan of adult flies was determined at 22°C according to standard protocol described by Fergestad et al. (2006) with minor modifications. Newly eclosed adults from synchronously reared culture of flies were collected and separated by sex, and about twenty flies were put into fresh media vial. Every 3 days, these flies were transferred to fresh media vial. The survival of adults was recorded by subtracting the number of dead flies from the total population, and the result is expressed in percentage. Eight replicates of each genotype were maintained for the purpose of lifespan determination. Olfactory Conditioning Olfactory learning assay was performed by employing classical olfactory conditioning, wherein for calculation of performance index (PI) a naı¨ve group of flies corresponding to each conditioned group was used (Yu et al. 2004). One training cycle consisted of 60-s presentation of 3-octanol (OCT) as the conditioned stimulus (CS?) which was paired with twelve 1.5-s pulses of 90 V DC electric shock [unconditioned stimulus (US)] followed by 45 s fresh air as intertrial interval and
123
64
Biochem Genet (2016) 54:61–72
then 60-s presentation of benzaldehyde (BEN) without electric shock (CS-). Soon after training, the flies were transferred back to the fresh food vials and kept at 25 °C until start of testing. The middle-term memory (MTM) was measured at 0–3 h after one training cycle. To evaluate protein-synthesis-dependent long-term memory (LTM), 10 spaced training cycles with 15-min intervals were used (Quinn and Dudai 1976) in which memory test on trained flies was conducted 24 h after the last training cycle. Memory retention tests were carried out only once using a Plexiglas T-maze in which both CS? and CS- were introduced simultaneously to opposite arms with the same concentration of chemicals as provided in training step. Each group of trained flies was introduced at the choice point and was allowed to choose between CS? and CS- over a 120-s time period. To obtain a distribution score, the number of flies in CS- arm was quantified and subtracted from the total number of flies presented in T-maze. A naı¨ve control group, corresponding to each trained fly group, was introduced at T-maze choice point without previous exposure to CS?, CS-, or electric shock and allowed to make choice between the two given odors (CS? and CS-). Memory performance indices were calculated by subtracting the naı¨ve score from the trained score and expressed as DPI. In the present study, the given DPI score for each group of flies is the mean of DPI scores obtained from eight replicates. Biochemical Assays Samples were prepared by homogenizing the heads of 100 flies in ice-cold sodium phosphate buffer (0.1 M; pH 8.0), centrifuged at 30009g for 10 min at 4°C. The supernatant was filtered before using it as a sample for assays. Catalase and SOD To measure the activity of catalase, 50 ll of sample was added to 1 ml reaction mixture containing 3% H2O2 (8.8 mM) and sodium phosphate buffer (pH 7.4). Absorbance was monitored at 240 nm for 3 min. Enzyme activity was determined by reduction in H2O2 and expressed as lmol of H2O2/min/mg protein (e-H2O2 44.1 mM-1 cm-1) (Aebi 1984). SOD activity was measured following the method of Marklund and Marklund (1974) by monitoring the inhibition of pyrogallol autoxidation in a reaction mixture containing 200 ll of sample and Tris–HCl buffer (0.1 M; pH 8.2). The reaction was initiated by adding 0.5 ml of pyrogallol (2 mM) and monitored for 3 min at 412 nm. Activity of the enzyme was expressed as the amount of protein required to inhibit 50% of pyrogallol autoxidation. Lipid Peroxidation (LPO) Lipid peroxidation assay was carried out following the method of Buege and Aust (1978). In this assay, 5% sucrose solution was used as a homogenizing buffer. 200 ll of sample was added into cuvette containing 200 ll of 8.1% SDS, 1.5 ml of 20% acetic acid, 1.5 ml of 0.8% TBA, and 0.6 ml of distilled water. The resulting solution was thoroughly mixed and incubated for 1 h at 95°C. These samples were
123
Biochem Genet (2016) 54:61–72
65
cooled under running tap water until a yellowish color appeared, and then 3 ml of butanol was added and centrifuged at 80009g for 5 min. Unnecessary shaking of centrifuge tube should be avoided. One ml of the yellowish supernatant was carefully pipetted out and the absorbance was read at 532 nm. Blank solution was prepared by mixing all the reagents except sample homogenate. Using molar extinction coefficient value for tetramethoxypropane which is 15,600 M-1 cm-1, the MDA contents of samples was quantified. Reactive Oxygen Species (ROS) ROS levels were measured by means of fluorimetric method described by Black and Brand (1974). The sample was prepared by homogenizing the heads of 50 flies in 1 ml ice-cold Tris–HCl buffer (0.4 M; pH 7.4) and centrifuged for 10 min with 20009g at 4°C. 100 ll of filtered supernatant was added to each well of the microplate containing 15 ll of 5 lM dichloro-dihydrofluorescein diacetate (DCFHDA), and the total volume was made up to 200 ll by adding homogenizing buffer. After incubation at room temperature for an hour, the microplate was read in a spectrofluorometer. The conversion of DCFH-DA to DCF was measured at 489 nm excitation and 525 nm emission wavelengths. ChE Enzymes Acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) activities were determined by the method of Ellman et al. (1961). To 1 ml of reaction mixture containing sodium phosphate buffer (0.1 M; pH 8.0), DTNB (10 mM), and 30 ll of head homogenate sample, ACTI or BTCI (78 mM) was added. Changes in the absorbance at 412 nm were monitored for 3 min and expressed as nmoles of substrate hydrolyzed/min/mg protein. Estimation of Protein Content Total protein in the aliquot of sample homogenates was determined following the method of Lowry et al. (1951). For this experiment, an aliquot of sample was added to the reaction mixture containing alkaline cooper solution, mixed well, and incubated for 10 min at room temperature in dark. In the next step, 0.1 ml Folin– Ciocalteu reagent was added and the mixture was incubated for 20 min at room temperature in dark. The absorbance was read at 750 nm. The concentration of protein presented in the sample was determined using BSA standard curve. Statistical Analysis The data (mean ± SE) were analyzed by t test and one-way and two-way ANOVA followed by ‘Bonferroni’ post hoc comparisons using SPAW (predictive analytics software) version 19.0. The p value of 0.05 was considered as the minimum level of significance.
123
66
Biochem Genet (2016) 54:61–72
Results Expression Level of hMAPT Variants in the Neurons of Transgenic Flies Agarose gel analysis of semi-q-RT PCR products of all the three hMAPT variants viz., htauWT, htauR406W, and htauV337M over-expressed in Pan neuronal pattern in the brains of flies revealed no comparable difference in the expression level when compared (Fig. 1). Human Tau Neurotoxicity Caused Early Death in the Transgenic Flies Our results on longevity in tau-expressing flies (Fig. 2) revealed that elav-Gal4mediated Pan neuronal over-expression of tau resulted in noticeable shortened lifespan. The maximum and mean lifespan of elavC155 flies was 88 ± 2 and 76 ± 3 days, respectively, while htauWT-, htauR406W-, and htauV337M-expressing flies exhibited a noticeable reduced longevity and their maximum lifespan was equal to two-third of the observed longevity in control flies. A perusal of Fig. 2 revealed that the extent of reduction in longevity induced by htauWT and htauR406W forms of tau was significantly higher than that induced by htauV337M. Statistical analysis revealed that this level of difference in longevity is significant [F(4, 32) = 39.403, p \ 0.01, n = 8]. Bonferroni post hoc comparisons revealed that reduced lifespan of transgenic flies is significantly different than that of control flies (p \ 0.01). Human Tau Neurotoxicity Resulted in Memory Impairment in Transgenic Flies The olfactory memory performance of tau transgenic flies was assayed following confined over-expression of hMAPT in mushroom bodies (MBs) employing c739-
Fig. 1 Quantification of hMAPT expression level. a Agarose gel analysis of q-RT PCR products of the hMAPT expression level in the brain tissues of transgenic flies wherein w1118 served as a negative control. b Quantification of color density which is expressed as dot per inch (dpi) unit corresponding to each band revealed equal expression level of human tau in the experimental transgenic flies. One-way ANOVA showed no significant differences among the expression level of the three tau genotypes (p = 0.082)
123
Biochem Genet (2016) 54:61–72
67
Fig. 2 Tau neurotoxicity and early death in AD model flies. The hMAPT transgenic flies die prematurely. At least 360 flies of each strain were collected 1 day after adult eclosion and assayed for longevity. Control genotypes: UAS-tauR406W and elavC155. Experimental genotypes: hMAPTWT;elav, hMAPTR406W;elav, and hMAPTV337M;elav. p values were calculated applying Mantel–Cox log-rank test, and multiple comparisons were corrected using Bonferroni test, n = 360 for all the groups. Statistical analysis revealed a significant decline in longevity of transgenic flies expressing human MAPT variants compared to that of the control groups (p \ 0.001)
Gal4 driver. The MTM and long-term memory (LTM) of flies were assayed following five training cycles, and the results of which are shown in Figs. 3 and 4, respectively. Tau transgenic flies showed a significant impairment in MTM as well as LTM performance compared to that of control group. The htauR406W-expressing flies were the most defective genotype in all types of memory tests. In case of 3-h MTM and 24-h LTM, the htauWT was found to exhibit more neurotoxic effect than htauV337M but has then induced the second most defective phenotype after htauR406W. Statistical analysis revealed that differences in MTM levels of tau transgenic flies are significant [F(5, 48) = 395.247, p \ 0.001, n = 8]. Likewise, variation in LTM performance of the transgenic flies was statistically significant [F(6, 56) = 644.354, p \ 0.001, n = 8]. Bonferroni post hoc test revealed that
Fig. 3 Middle-term olfactory memory is impaired in flies expressing human MAPT. Over-expression of wild-type and mutant forms of human tau in a and b lobes of MBs results in significant impairment of MTM performance in transgenic flies after one training cycle when compared to that of control stocks [F(5, 48) = 395.247, p \ 0.001, n = 8]
123
68
Biochem Genet (2016) 54:61–72
Fig. 4 Long-term olfactory memory impairment in MAPT transgenic flies. Over-expression of wild-type and mutant forms of human tau in a and b lobes of MBs results in significant impairment of LTM performance in transgenic flies after one training cycle when compared to that of control stocks [F(6, 56) = 644.354, p \ 0.001, n = 8]. Bonferroni post hoc test revealed that reduction in memory performance of transgenic flies is significant when compared to control flies (p \ 0.01). Bars indicate mean ± SEM
Fig. 5 Mean ± SE of endogenous antioxidant enzyme activity, and oxidative markers in human tau transgenic flies. Biochemical analysis of antioxidant enzymes and oxidative markers in tau transgenic flies: a catalase activity, b SOD activity, c LPO level, and d ROS level revealed that PAN neuronal overexpression of hMAPTWT, hMAPTR406W, and hMAPTV337M caused a significant reduction in both CAT and SOD activities and a noticeable increase of LPO and ROS levels. Statistical analysis followed by Bonferroni post hoc comparison revealed that these differences observed between control and human tau transgenics are significant [F(7, 24) = 44.203, p \ 0.001, n = 3]. Bars indicate mean ± SEM
123
Biochem Genet (2016) 54:61–72
69
reduction in memory performance of transgenic flies is significant when compared to control flies (p \ 0.01). As all the genotypes produce 0 h memory performances which were not statistically different, it is concluded that neuronal over-expression of hMAPT does not induce changes in odor perception and electric shock responses of the flies. Human Tau Over-expression Led to Reduced Efficacy of Neuronal Antioxidant Defenses The results of biochemical investigations are shown in Fig. 5. An analysis of these results revealed that pan neuronal over-expression of htauWT, htauR406W, and htauV337M caused a significant reduction in the activity of endogenous antioxidant enzymes, CAT and SOD, increased level of LPO, and elevated ROS generation. These biochemical alterations were not constant among tau forms. htauWT was found to reduce CAT and SOD activities into an extent greater than htauV337M and htauR406W. LPO levels were increased upon tau over-expression, but the results obtained showed that htauV337M was not neurotoxic as other tau forms. The same situation was seen to prevail in wild-type tau in ROS generation. Statistical analysis followed by Bonferroni post hoc comparison revealed that these differences observed between control and tau transgenic flies are significant [F(7, 24) = 44.203, p \ 0.001, n = 3]. Tau Transgenic Flies Exhibited Lower Activity of Neurotransmitter Enzymes Neurotransmitter enzymes, viz., AChE and BChE, were also analyzed to investigate tau-induced alteration in the activity of these enzymes if any. Pan neuronal overexpression of htauWT, tauR406W, and tauV337M was carried out, and the activities of ChE enzymes were determined. The results of these assays are also shown in Fig. 6. Both the AChE and BChE enzyme activities showed a significant decrease in tau
Fig. 6 Mean ± SE of neurotransmitter enzyme activities in human tau transgenic flies. Biochemical analysis of neurotransmitter enzymes in human tau transgenic flies showed that activities of a AChE b BChE enzymes are remarkably reduced upon neuronal over-expression of wild-type and mutant forms of human Tau. [F(7, 24) = 623.43, p \ 0.001, n = 3]. Bars indicate mean ± SEM
123
70
Biochem Genet (2016) 54:61–72
transgenic flies [F(7, 24) = 623.43, p \ 0.001, n = 3]. Maximum level of reduction in neurotransmitter enzymes was found to be induced by htauV337M form, whereas the degree of the decline in wild-type and htauR406W-expressing flies was significantly lower. Surprisingly, htauR406W mutant form of tau was even lower than htauWT.
Conclusion The aim of our study was to make a comparative examination on hMAPT-mediated neurodegeneration, memory impairment, and OS in the CNS of transgenic Drosophila models of AD expressing different forms of hMAPT. Since the expression levels of human Tau in the brain of fly models were found to be equal, the observed variation in the behavioral and chemical investigation of htau transgenic flies is solely due to different mechanisms of neurotoxicity for each allele of htau. We have shown that pan neuronal over-expression of both wild-type (htauWT) and mutant forms (htauR406W and htauV337M) of MAPT gene caused significantly shortened lifespan. A perusal of the findings has revealed that htauR406W induced the most severe toxicity compared to other alleles of htau which is in agreement with scientific report of Wittmann et al. (2001). A confined over-expression of tau in a and b lobes of MBs resulted in a significant impairment in MTM and LTM of flies. As per Mershin et al. (2004), over-expression and accumulation of human Tau in Drosophila mushroom body neurons inhibit memory stability and retention. In another study, it has been shown that over-expression of wild-type and mutant (R406W) human Tau in Drosophila central nervous system results in age-dependent memory deficits and the mutant form is more toxic than the wild-type one (Ali et al. 2012). The present investigation has confirmed the higher neurotoxicity potential of htauR406W over the wild type and htauV337M in terms of memory impairment. Further, it is evident in the present study that htau transgenic flies exhibit weakened cellular antioxidant defense system and deficit in neurotransmitter enzymes compared to control genotype. Choline esterase (ChE) enzymes are contributing in membrane integrity and permeability required for synaptic transmission and conduction (Schmatz et al. 2009). It has been reported that there is a slight but significant decline in AChE activity of AD patient’s brain when compared to healthy control individuals (Rinne et al. 2003). Therefore, reduction in ChE activity impairs neuronal signal transmission and leads to memory defects. The present biochemical analyses have revealed that htauV337M caused the maximum decline in ChE enzymes’ activity of transgenic Drosophila models. On the other hand, OS is a very well-established factor in onset as well as exacerbation of neurodegenerative disorders (Marcus et al. 1998; Rojo et al. 2008). Dias-Santagata et al. (2007) have reported that induction of OS by means of either down-regulation of antioxidant enzyme or chemical OS inducer causes a noticeable reduction in memory performance and increased mortality in Drosophila models expressing htauR406W gene. We also showed that Pan neuronal over-expression of human Tau in neurons of Drosophila leads to reduced activity of antioxidant
123
Biochem Genet (2016) 54:61–72
71
enzymes and a remarkable enhancement of oxidative markers. In the present research report, we showed that tau toxicity is accompanied by cellular OS wherein htauR406W was found to be the most effective htau form in OS induction. Altogether, it is concluded that human Tau protein when expressed in Drosophila model system could successfully induce neural toxicity but the extent of which exhibits distinguished variations. Although the wild-type and mutant forms of tau were able to induce defective phenotypes in the transgenic flies, there might be remarkable variations in cellular and molecular events following tau-induced neurodegeneration. Multiple responses to tau forms may result from various signaling pathways that underlie interaction of each genotype with neuronal components. However, these preliminary results can form the basis for future studies on unraveling specific cellular and molecular events underlying neurotoxicity induced by each tau form which has essential application toward development of personalized medicine for AD patients. Acknowledgments We thank the Chairman, Department of Studies in Zoology, University of Mysore, Mysore, for the facilities.
References Aebi H (1984) Catalase in vitro. Methods Enzymol 105:121–126 Ali YO, Ruan K, Zhai RG (2012) NMNAT suppresses tau-induced neurodegeneration by promoting clearance of hyperphosphorylated tau oligomers in a Drosophila model of tauopathy. Hum Mol Genet 21:237–250 Black MJ, Brand RB (1974) Spectrofluorometric analysis of hydrogen peroxide. Anal Biochem 58:246–254 Buege J, Aust SD (1978) Microsomal lipid peroxidation. Methods Enzymol 52:302–310 Dias-Santagata D, Fulga TA, Duttaroy A, Feany MB (2007) Oxidative stress mediates tau-induced neurodegeneration in Drosophila. J Clin Investig 117:236–245 Ellman GL, Courtney KD, Andres V, Featherstone RM (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 7:88–95 Fergestad T, Ganetzky B, Palladino MJ (2006) Neuropathology in Drosophila membrane excitability mutants. Genetics 172:1031–1042 Hutton M (2000) Molecular genetics of chromosome 17 tauopathies. Ann NY Acad Sci 920:63–73 Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265–275 Marcus DL, Thomas C, Rodriguez C, Simberkoff K, Tsai JS et al (1998) Increased peroxidation and reduced antioxidant enzyme activity in Alzheimer’s disease. Exp Neurol 150:40–44 Marklund S, Marklund G (1974) Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 47:469–474 Mershin A, Pavlopoulos E, Fitch O, Braden BC, Nanopoulos DV, Skoulakis EM (2004) Learning and memory deficits upon TAU accumulation in Drosophila mushroom body neurons. Learn Mem 11:277–287 Quinn WG, Dudai Y (1976) Memory phases in Drosophila. Nature 262:576–577 Rinne JO, Kaasinen V, Ja¨rvenpa¨a¨ T, Na˚gren K, Roivainen A, Yu M et al (2003) Brain acetylcholinesterase activity in mild cognitive impairment and early Alzheimer’s disease. J Neurol Neurosurg Psychiatry 74:113–115 Rojo AI, Sagarra MR, Cuadrado A (2008) GSK-3b down-regulates the transcription factor Nrf2 after oxidant damage: relevance to exposure of neuronal cells to oxidative stress. J Neurochem 105:192–205 Schmatz R, Mazzanti CM, Spanevello R, Stefanello N, Gutierres J, Correˆa M et al (2009) Resveratrol prevents memory deficits and the increase in acetylcholinesterase activity in streptozotocin-induced diabetic rats. Eu J Pharmacol 610:42–48
123
72
Biochem Genet (2016) 54:61–72
Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9:671–675 Spillantini MG, Murrell JR, Goedert M, Farlow MR, Klug A, Ghetti B (1998) Mutation in the tau gene in familial multiple system tauopathy with presenile dementia. Proc Natl Acad Sci USA 95:7737–7741 Wittmann CW et al (2001) Tauopathy in Drosophila: neurodegeneration without neurofibrillary tangles. Science 293:711–714 Yu D, Ponomarev A, Davis RL (2004) Altered representation of the spatial code for odors after olfactory classical conditioning; memory trace formation by synaptic recruitment. Neuron 42:437–449
123
Biochemical and Behavioral Evaluation of Human MAPT Mutations in Transgenic Drosophila melanogaster Mohammad Haddadi1 • Upendra Nongthomba2 S. R. Ramesh3
•
Received: 5 September 2014 / Accepted: 30 October 2015 / Published online: 18 November 2015 Ó Springer Science+Business Media New York 2015
Abstract Mutations in the human microtubule-associated protein tau (hMAPT) gene including R406W and V337M result in autosomal dominant neurodegenerative disorder. These mutations lead to hyperphosphorylation and aggregation of Tau protein which is a known genetic factor underlying development of Alzheimer’s disease (AD). In the present study, transgenic Drosophila models of AD expressing wild-type and mutant forms of hMAPT exhibit a progressive neurodegeneration which was manifested in the form of early death and impairment of cognitive ability. Moreover, they were also found to have significantly decreased activity of neurotransmitter enzymes accompanied by decreased cellular endogenous antioxidant profile. The extent of neurodegeneration, memory impairment, and biochemical profiles was different in the tau transgenic strains which indicate multiple molecular and cellular responses underlie each particular form of hMAPT. Keywords
hMAPT Neurodegeneration Memory impairment Oxidative stress
Introduction The R406W and V337M mutations in the human microtubule-associated protein tau (hMAPT) result in hyperphosphorylation and thus aggregation of Tau protein which is a well-known neuropathogenic factor for development of Alzheimer’s disease (AD) (Spillantini et al. 1998; Hutton 2000). In Drosophila model of tauopathies, & S. R. Ramesh [email protected] 1
Department of Biology, Faculty of Science, University of Zabol, Zabol, Iran
2
Department of Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore, India
3
Department of Studies in Zoology, University of Mysore, Manasagangotri, Mysore, India
123
62
Biochem Genet (2016) 54:61–72
hyperphosphorylation and neurodegeneration of tau in the brain of the transgenic flies have been demonstrated following over-expression of both wild-type and mutant copies of hMAPT (Wittmann et al. 2001). Mershin et al. (2004) studied tauinduced learning and memory deficit by expressing wild-type tau gene from different species including Drosophila and bovine and have reported that accumulation of Tau in MBs of Drosophila brain causes memory impairment. The causative role of oxidative stress (OS) and tau toxicity in Drosophila was investigated by Dias-Santagata et al. (2007) who were able to show that genetic and pharmacologic manipulation of antioxidant defense system causes tau-induced neurodegeneration to different degrees. However, an integrated study employing wild-type and mutant forms of hMAPT in the induction of AD-like symptoms in Drosophila to understand the relationship between tau toxicity, memory impairment, and OS has not been undertaken so far. Hence, in the present study wild-type and two mutant forms of hMAPT were over-expressed in the neurons of Drosophila brain in order to induce neurodegeneration and to investigate the tau-mediated pathogenesis with special attention to each genotype. To ensure that the levels of hMAPT expressed from each transgenic line are equal, their relative expression was quantified. Longevity, olfactory memory, and oxidative status of the transgenic lines were the parameters considered to understand the extent of pathogenesis induced by different forms of hMAPT gene which may provide a basis for understanding molecular interaction between human Tau proteins and neuronal components.
Materials and Methods Chemicals Benzaldehyde, 3-Octanol, Pyrogallol, Acetylthiocholine iodide, Butyrylthiocholine iodide, Osmium tetroxide, Propylene oxide, Araldite resin, Thiobarbituric acid (TBA), Dichloro-dihydrofluorescein diacetate (DCFH-DA), Acetylthiocholine Iodide (ATCI), Butyrylthiocholine iodide (BTCI), Ethylenediaminetetraacetic acid (EDTA), Tetramethoxypropane (TMP), and 5, 50 -dithiobis 2-nitrobenzoic acid (DTNB) were purchased from Sigma Chemical Co. St Louis, CA, USA. All other chemicals used were purchased from Sisco Research Laboratories, Mumbai, India, which were of the highest purity grade. Drosophila Stocks and Maintenance All the Drosophila stocks were raised and maintained on standard wheat cream agar media supplemented with dry yeast granules at 22 ± 1°C, 70–80% relative humidity, and 12-h light/12-h dark in a vivarium. Bloomington stock w1118 was used as a control genotype, and elav-Gal4C155 and c739-Gal4 stocks were used to drive neuronal over-expression of the tau. The UAS-MAPTWT, UAS-MAPTR406W, and UAS-MAPTV337M transgenics were used to induce tauopathies (Wittmann et al. 2001). All the stocks were normalized by out-crossing to an isogenic w1118 stock at least for six generations.
123
Biochem Genet (2016) 54:61–72
63
Semi-q-RT PCR To quantify the expression levels of hMAPT protein in tau transgenic flies, semiquantitative RT PCR amplification was performed. Total RNA was extracted from the head homogenates using TRIzol reagent. The primers were designed using Gene Runner, version 3.05. The sequences of the primers were as follows: forward 50 GGAAGACGTTCTCACTGATCTG and reverse 50 AGGAGTCTGGCTTCAG TCTCTC. House-keeping gene rp49 was used as control using following primers: forward 50 TTCTACCAGCTTCAAGATGAC and reverse 50 GTGTATTCCGAC CACGTTACA. Using the affinity Script QPCR cDNA synthesis kit, 1 lg of DNasetreated RNA was reverse transcribed to get 50 ng/ll of cDNA. PCR amplification of hMAPT gene region was performed using ExTaq (TaKaRa). The resultant PCR products were analyzed through agarose gel electrophoresis and documented using Alpha DigiDoc RT2 (JH BIO Innovations, India). Each sample was run in triplicate for each genotype using 50 ng input per reaction. PCR consisted of initial denaturation at 95°C for 3 min followed by 30 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s. The relative expression levels of the target gene were determined after normalizing with rp49 as the reference gene by quantification of band intensity using ImageJ software 1.47 (Schneider et al. 2012). For this measurement, the region of interest (ROI) was selected using selection tools, and the given values for area, integrated density, and gray value were noted. Then a region next to the selected area which does not have color was selected, and the same value was taken and considered as background. The background area was threefold larger than ROI. All the data were transferred to an excel sheet, and corrected total band density was calculated using the following formula: image density = integrated density - (Area of ROI) 9 mean intensity of background readings. Longevity Assay Lifespan of adult flies was determined at 22°C according to standard protocol described by Fergestad et al. (2006) with minor modifications. Newly eclosed adults from synchronously reared culture of flies were collected and separated by sex, and about twenty flies were put into fresh media vial. Every 3 days, these flies were transferred to fresh media vial. The survival of adults was recorded by subtracting the number of dead flies from the total population, and the result is expressed in percentage. Eight replicates of each genotype were maintained for the purpose of lifespan determination. Olfactory Conditioning Olfactory learning assay was performed by employing classical olfactory conditioning, wherein for calculation of performance index (PI) a naı¨ve group of flies corresponding to each conditioned group was used (Yu et al. 2004). One training cycle consisted of 60-s presentation of 3-octanol (OCT) as the conditioned stimulus (CS?) which was paired with twelve 1.5-s pulses of 90 V DC electric shock [unconditioned stimulus (US)] followed by 45 s fresh air as intertrial interval and
123
64
Biochem Genet (2016) 54:61–72
then 60-s presentation of benzaldehyde (BEN) without electric shock (CS-). Soon after training, the flies were transferred back to the fresh food vials and kept at 25 °C until start of testing. The middle-term memory (MTM) was measured at 0–3 h after one training cycle. To evaluate protein-synthesis-dependent long-term memory (LTM), 10 spaced training cycles with 15-min intervals were used (Quinn and Dudai 1976) in which memory test on trained flies was conducted 24 h after the last training cycle. Memory retention tests were carried out only once using a Plexiglas T-maze in which both CS? and CS- were introduced simultaneously to opposite arms with the same concentration of chemicals as provided in training step. Each group of trained flies was introduced at the choice point and was allowed to choose between CS? and CS- over a 120-s time period. To obtain a distribution score, the number of flies in CS- arm was quantified and subtracted from the total number of flies presented in T-maze. A naı¨ve control group, corresponding to each trained fly group, was introduced at T-maze choice point without previous exposure to CS?, CS-, or electric shock and allowed to make choice between the two given odors (CS? and CS-). Memory performance indices were calculated by subtracting the naı¨ve score from the trained score and expressed as DPI. In the present study, the given DPI score for each group of flies is the mean of DPI scores obtained from eight replicates. Biochemical Assays Samples were prepared by homogenizing the heads of 100 flies in ice-cold sodium phosphate buffer (0.1 M; pH 8.0), centrifuged at 30009g for 10 min at 4°C. The supernatant was filtered before using it as a sample for assays. Catalase and SOD To measure the activity of catalase, 50 ll of sample was added to 1 ml reaction mixture containing 3% H2O2 (8.8 mM) and sodium phosphate buffer (pH 7.4). Absorbance was monitored at 240 nm for 3 min. Enzyme activity was determined by reduction in H2O2 and expressed as lmol of H2O2/min/mg protein (e-H2O2 44.1 mM-1 cm-1) (Aebi 1984). SOD activity was measured following the method of Marklund and Marklund (1974) by monitoring the inhibition of pyrogallol autoxidation in a reaction mixture containing 200 ll of sample and Tris–HCl buffer (0.1 M; pH 8.2). The reaction was initiated by adding 0.5 ml of pyrogallol (2 mM) and monitored for 3 min at 412 nm. Activity of the enzyme was expressed as the amount of protein required to inhibit 50% of pyrogallol autoxidation. Lipid Peroxidation (LPO) Lipid peroxidation assay was carried out following the method of Buege and Aust (1978). In this assay, 5% sucrose solution was used as a homogenizing buffer. 200 ll of sample was added into cuvette containing 200 ll of 8.1% SDS, 1.5 ml of 20% acetic acid, 1.5 ml of 0.8% TBA, and 0.6 ml of distilled water. The resulting solution was thoroughly mixed and incubated for 1 h at 95°C. These samples were
123
Biochem Genet (2016) 54:61–72
65
cooled under running tap water until a yellowish color appeared, and then 3 ml of butanol was added and centrifuged at 80009g for 5 min. Unnecessary shaking of centrifuge tube should be avoided. One ml of the yellowish supernatant was carefully pipetted out and the absorbance was read at 532 nm. Blank solution was prepared by mixing all the reagents except sample homogenate. Using molar extinction coefficient value for tetramethoxypropane which is 15,600 M-1 cm-1, the MDA contents of samples was quantified. Reactive Oxygen Species (ROS) ROS levels were measured by means of fluorimetric method described by Black and Brand (1974). The sample was prepared by homogenizing the heads of 50 flies in 1 ml ice-cold Tris–HCl buffer (0.4 M; pH 7.4) and centrifuged for 10 min with 20009g at 4°C. 100 ll of filtered supernatant was added to each well of the microplate containing 15 ll of 5 lM dichloro-dihydrofluorescein diacetate (DCFHDA), and the total volume was made up to 200 ll by adding homogenizing buffer. After incubation at room temperature for an hour, the microplate was read in a spectrofluorometer. The conversion of DCFH-DA to DCF was measured at 489 nm excitation and 525 nm emission wavelengths. ChE Enzymes Acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) activities were determined by the method of Ellman et al. (1961). To 1 ml of reaction mixture containing sodium phosphate buffer (0.1 M; pH 8.0), DTNB (10 mM), and 30 ll of head homogenate sample, ACTI or BTCI (78 mM) was added. Changes in the absorbance at 412 nm were monitored for 3 min and expressed as nmoles of substrate hydrolyzed/min/mg protein. Estimation of Protein Content Total protein in the aliquot of sample homogenates was determined following the method of Lowry et al. (1951). For this experiment, an aliquot of sample was added to the reaction mixture containing alkaline cooper solution, mixed well, and incubated for 10 min at room temperature in dark. In the next step, 0.1 ml Folin– Ciocalteu reagent was added and the mixture was incubated for 20 min at room temperature in dark. The absorbance was read at 750 nm. The concentration of protein presented in the sample was determined using BSA standard curve. Statistical Analysis The data (mean ± SE) were analyzed by t test and one-way and two-way ANOVA followed by ‘Bonferroni’ post hoc comparisons using SPAW (predictive analytics software) version 19.0. The p value of 0.05 was considered as the minimum level of significance.
123
66
Biochem Genet (2016) 54:61–72
Results Expression Level of hMAPT Variants in the Neurons of Transgenic Flies Agarose gel analysis of semi-q-RT PCR products of all the three hMAPT variants viz., htauWT, htauR406W, and htauV337M over-expressed in Pan neuronal pattern in the brains of flies revealed no comparable difference in the expression level when compared (Fig. 1). Human Tau Neurotoxicity Caused Early Death in the Transgenic Flies Our results on longevity in tau-expressing flies (Fig. 2) revealed that elav-Gal4mediated Pan neuronal over-expression of tau resulted in noticeable shortened lifespan. The maximum and mean lifespan of elavC155 flies was 88 ± 2 and 76 ± 3 days, respectively, while htauWT-, htauR406W-, and htauV337M-expressing flies exhibited a noticeable reduced longevity and their maximum lifespan was equal to two-third of the observed longevity in control flies. A perusal of Fig. 2 revealed that the extent of reduction in longevity induced by htauWT and htauR406W forms of tau was significantly higher than that induced by htauV337M. Statistical analysis revealed that this level of difference in longevity is significant [F(4, 32) = 39.403, p \ 0.01, n = 8]. Bonferroni post hoc comparisons revealed that reduced lifespan of transgenic flies is significantly different than that of control flies (p \ 0.01). Human Tau Neurotoxicity Resulted in Memory Impairment in Transgenic Flies The olfactory memory performance of tau transgenic flies was assayed following confined over-expression of hMAPT in mushroom bodies (MBs) employing c739-
Fig. 1 Quantification of hMAPT expression level. a Agarose gel analysis of q-RT PCR products of the hMAPT expression level in the brain tissues of transgenic flies wherein w1118 served as a negative control. b Quantification of color density which is expressed as dot per inch (dpi) unit corresponding to each band revealed equal expression level of human tau in the experimental transgenic flies. One-way ANOVA showed no significant differences among the expression level of the three tau genotypes (p = 0.082)
123
Biochem Genet (2016) 54:61–72
67
Fig. 2 Tau neurotoxicity and early death in AD model flies. The hMAPT transgenic flies die prematurely. At least 360 flies of each strain were collected 1 day after adult eclosion and assayed for longevity. Control genotypes: UAS-tauR406W and elavC155. Experimental genotypes: hMAPTWT;elav, hMAPTR406W;elav, and hMAPTV337M;elav. p values were calculated applying Mantel–Cox log-rank test, and multiple comparisons were corrected using Bonferroni test, n = 360 for all the groups. Statistical analysis revealed a significant decline in longevity of transgenic flies expressing human MAPT variants compared to that of the control groups (p \ 0.001)
Gal4 driver. The MTM and long-term memory (LTM) of flies were assayed following five training cycles, and the results of which are shown in Figs. 3 and 4, respectively. Tau transgenic flies showed a significant impairment in MTM as well as LTM performance compared to that of control group. The htauR406W-expressing flies were the most defective genotype in all types of memory tests. In case of 3-h MTM and 24-h LTM, the htauWT was found to exhibit more neurotoxic effect than htauV337M but has then induced the second most defective phenotype after htauR406W. Statistical analysis revealed that differences in MTM levels of tau transgenic flies are significant [F(5, 48) = 395.247, p \ 0.001, n = 8]. Likewise, variation in LTM performance of the transgenic flies was statistically significant [F(6, 56) = 644.354, p \ 0.001, n = 8]. Bonferroni post hoc test revealed that
Fig. 3 Middle-term olfactory memory is impaired in flies expressing human MAPT. Over-expression of wild-type and mutant forms of human tau in a and b lobes of MBs results in significant impairment of MTM performance in transgenic flies after one training cycle when compared to that of control stocks [F(5, 48) = 395.247, p \ 0.001, n = 8]
123
68
Biochem Genet (2016) 54:61–72
Fig. 4 Long-term olfactory memory impairment in MAPT transgenic flies. Over-expression of wild-type and mutant forms of human tau in a and b lobes of MBs results in significant impairment of LTM performance in transgenic flies after one training cycle when compared to that of control stocks [F(6, 56) = 644.354, p \ 0.001, n = 8]. Bonferroni post hoc test revealed that reduction in memory performance of transgenic flies is significant when compared to control flies (p \ 0.01). Bars indicate mean ± SEM
Fig. 5 Mean ± SE of endogenous antioxidant enzyme activity, and oxidative markers in human tau transgenic flies. Biochemical analysis of antioxidant enzymes and oxidative markers in tau transgenic flies: a catalase activity, b SOD activity, c LPO level, and d ROS level revealed that PAN neuronal overexpression of hMAPTWT, hMAPTR406W, and hMAPTV337M caused a significant reduction in both CAT and SOD activities and a noticeable increase of LPO and ROS levels. Statistical analysis followed by Bonferroni post hoc comparison revealed that these differences observed between control and human tau transgenics are significant [F(7, 24) = 44.203, p \ 0.001, n = 3]. Bars indicate mean ± SEM
123
Biochem Genet (2016) 54:61–72
69
reduction in memory performance of transgenic flies is significant when compared to control flies (p \ 0.01). As all the genotypes produce 0 h memory performances which were not statistically different, it is concluded that neuronal over-expression of hMAPT does not induce changes in odor perception and electric shock responses of the flies. Human Tau Over-expression Led to Reduced Efficacy of Neuronal Antioxidant Defenses The results of biochemical investigations are shown in Fig. 5. An analysis of these results revealed that pan neuronal over-expression of htauWT, htauR406W, and htauV337M caused a significant reduction in the activity of endogenous antioxidant enzymes, CAT and SOD, increased level of LPO, and elevated ROS generation. These biochemical alterations were not constant among tau forms. htauWT was found to reduce CAT and SOD activities into an extent greater than htauV337M and htauR406W. LPO levels were increased upon tau over-expression, but the results obtained showed that htauV337M was not neurotoxic as other tau forms. The same situation was seen to prevail in wild-type tau in ROS generation. Statistical analysis followed by Bonferroni post hoc comparison revealed that these differences observed between control and tau transgenic flies are significant [F(7, 24) = 44.203, p \ 0.001, n = 3]. Tau Transgenic Flies Exhibited Lower Activity of Neurotransmitter Enzymes Neurotransmitter enzymes, viz., AChE and BChE, were also analyzed to investigate tau-induced alteration in the activity of these enzymes if any. Pan neuronal overexpression of htauWT, tauR406W, and tauV337M was carried out, and the activities of ChE enzymes were determined. The results of these assays are also shown in Fig. 6. Both the AChE and BChE enzyme activities showed a significant decrease in tau
Fig. 6 Mean ± SE of neurotransmitter enzyme activities in human tau transgenic flies. Biochemical analysis of neurotransmitter enzymes in human tau transgenic flies showed that activities of a AChE b BChE enzymes are remarkably reduced upon neuronal over-expression of wild-type and mutant forms of human Tau. [F(7, 24) = 623.43, p \ 0.001, n = 3]. Bars indicate mean ± SEM
123
70
Biochem Genet (2016) 54:61–72
transgenic flies [F(7, 24) = 623.43, p \ 0.001, n = 3]. Maximum level of reduction in neurotransmitter enzymes was found to be induced by htauV337M form, whereas the degree of the decline in wild-type and htauR406W-expressing flies was significantly lower. Surprisingly, htauR406W mutant form of tau was even lower than htauWT.
Conclusion The aim of our study was to make a comparative examination on hMAPT-mediated neurodegeneration, memory impairment, and OS in the CNS of transgenic Drosophila models of AD expressing different forms of hMAPT. Since the expression levels of human Tau in the brain of fly models were found to be equal, the observed variation in the behavioral and chemical investigation of htau transgenic flies is solely due to different mechanisms of neurotoxicity for each allele of htau. We have shown that pan neuronal over-expression of both wild-type (htauWT) and mutant forms (htauR406W and htauV337M) of MAPT gene caused significantly shortened lifespan. A perusal of the findings has revealed that htauR406W induced the most severe toxicity compared to other alleles of htau which is in agreement with scientific report of Wittmann et al. (2001). A confined over-expression of tau in a and b lobes of MBs resulted in a significant impairment in MTM and LTM of flies. As per Mershin et al. (2004), over-expression and accumulation of human Tau in Drosophila mushroom body neurons inhibit memory stability and retention. In another study, it has been shown that over-expression of wild-type and mutant (R406W) human Tau in Drosophila central nervous system results in age-dependent memory deficits and the mutant form is more toxic than the wild-type one (Ali et al. 2012). The present investigation has confirmed the higher neurotoxicity potential of htauR406W over the wild type and htauV337M in terms of memory impairment. Further, it is evident in the present study that htau transgenic flies exhibit weakened cellular antioxidant defense system and deficit in neurotransmitter enzymes compared to control genotype. Choline esterase (ChE) enzymes are contributing in membrane integrity and permeability required for synaptic transmission and conduction (Schmatz et al. 2009). It has been reported that there is a slight but significant decline in AChE activity of AD patient’s brain when compared to healthy control individuals (Rinne et al. 2003). Therefore, reduction in ChE activity impairs neuronal signal transmission and leads to memory defects. The present biochemical analyses have revealed that htauV337M caused the maximum decline in ChE enzymes’ activity of transgenic Drosophila models. On the other hand, OS is a very well-established factor in onset as well as exacerbation of neurodegenerative disorders (Marcus et al. 1998; Rojo et al. 2008). Dias-Santagata et al. (2007) have reported that induction of OS by means of either down-regulation of antioxidant enzyme or chemical OS inducer causes a noticeable reduction in memory performance and increased mortality in Drosophila models expressing htauR406W gene. We also showed that Pan neuronal over-expression of human Tau in neurons of Drosophila leads to reduced activity of antioxidant
123
Biochem Genet (2016) 54:61–72
71
enzymes and a remarkable enhancement of oxidative markers. In the present research report, we showed that tau toxicity is accompanied by cellular OS wherein htauR406W was found to be the most effective htau form in OS induction. Altogether, it is concluded that human Tau protein when expressed in Drosophila model system could successfully induce neural toxicity but the extent of which exhibits distinguished variations. Although the wild-type and mutant forms of tau were able to induce defective phenotypes in the transgenic flies, there might be remarkable variations in cellular and molecular events following tau-induced neurodegeneration. Multiple responses to tau forms may result from various signaling pathways that underlie interaction of each genotype with neuronal components. However, these preliminary results can form the basis for future studies on unraveling specific cellular and molecular events underlying neurotoxicity induced by each tau form which has essential application toward development of personalized medicine for AD patients. Acknowledgments We thank the Chairman, Department of Studies in Zoology, University of Mysore, Mysore, for the facilities.
References Aebi H (1984) Catalase in vitro. Methods Enzymol 105:121–126 Ali YO, Ruan K, Zhai RG (2012) NMNAT suppresses tau-induced neurodegeneration by promoting clearance of hyperphosphorylated tau oligomers in a Drosophila model of tauopathy. Hum Mol Genet 21:237–250 Black MJ, Brand RB (1974) Spectrofluorometric analysis of hydrogen peroxide. Anal Biochem 58:246–254 Buege J, Aust SD (1978) Microsomal lipid peroxidation. Methods Enzymol 52:302–310 Dias-Santagata D, Fulga TA, Duttaroy A, Feany MB (2007) Oxidative stress mediates tau-induced neurodegeneration in Drosophila. J Clin Investig 117:236–245 Ellman GL, Courtney KD, Andres V, Featherstone RM (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 7:88–95 Fergestad T, Ganetzky B, Palladino MJ (2006) Neuropathology in Drosophila membrane excitability mutants. Genetics 172:1031–1042 Hutton M (2000) Molecular genetics of chromosome 17 tauopathies. Ann NY Acad Sci 920:63–73 Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265–275 Marcus DL, Thomas C, Rodriguez C, Simberkoff K, Tsai JS et al (1998) Increased peroxidation and reduced antioxidant enzyme activity in Alzheimer’s disease. Exp Neurol 150:40–44 Marklund S, Marklund G (1974) Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 47:469–474 Mershin A, Pavlopoulos E, Fitch O, Braden BC, Nanopoulos DV, Skoulakis EM (2004) Learning and memory deficits upon TAU accumulation in Drosophila mushroom body neurons. Learn Mem 11:277–287 Quinn WG, Dudai Y (1976) Memory phases in Drosophila. Nature 262:576–577 Rinne JO, Kaasinen V, Ja¨rvenpa¨a¨ T, Na˚gren K, Roivainen A, Yu M et al (2003) Brain acetylcholinesterase activity in mild cognitive impairment and early Alzheimer’s disease. J Neurol Neurosurg Psychiatry 74:113–115 Rojo AI, Sagarra MR, Cuadrado A (2008) GSK-3b down-regulates the transcription factor Nrf2 after oxidant damage: relevance to exposure of neuronal cells to oxidative stress. J Neurochem 105:192–205 Schmatz R, Mazzanti CM, Spanevello R, Stefanello N, Gutierres J, Correˆa M et al (2009) Resveratrol prevents memory deficits and the increase in acetylcholinesterase activity in streptozotocin-induced diabetic rats. Eu J Pharmacol 610:42–48
123
72
Biochem Genet (2016) 54:61–72
Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9:671–675 Spillantini MG, Murrell JR, Goedert M, Farlow MR, Klug A, Ghetti B (1998) Mutation in the tau gene in familial multiple system tauopathy with presenile dementia. Proc Natl Acad Sci USA 95:7737–7741 Wittmann CW et al (2001) Tauopathy in Drosophila: neurodegeneration without neurofibrillary tangles. Science 293:711–714 Yu D, Ponomarev A, Davis RL (2004) Altered representation of the spatial code for odors after olfactory classical conditioning; memory trace formation by synaptic recruitment. Neuron 42:437–449
123
