Nanoscale View Article Online

Published on 08 November 2013. Downloaded by St. Petersburg State University on 23/12/2013 10:16:59.

PAPER

Cite this: Nanoscale, 2014, 6, 1099

View Journal | View Issue

Binding-induced autonomous disassembly of aptamer–DNAzyme supersandwich nanostructures for sensitive electrochemiluminescence turn-on detection of ochratoxin A Ying Chen, Mengli Yang, Yun Xiang,* Ruo Yuan* and Yaqin Chai The self-assembled DNA nanostructure has been one of the most interesting research areas in the field of nanoscience, and the application of the DNA self-assembled nanostructures in biosensing is still in the early stage. In this work, based on the target-induced autonomous disassembly of the aptamer–DNAzyme supersandwich nanostructures, we demonstrated a highly sensitive strategy for electrochemiluminescent (ECL) detection of ochratoxin A (OTA). The aptamer–DNAzyme supersandwich nanostructures, which exhibited significant ECL quenching effect toward the oxygen/persulfate (O2/S2O82
) system, were selfassembled on the gold electrode surface. The presence of the target OTA and the exonuclease (RecJf) resulted in autonomous disassembly of the nanostructures and cyclic reuse of OTA, leading to efficient

Received 16th October 2013 Accepted 6th November 2013

recovery of the ECL emission and highly sensitive detection of OTA. Our developed method also showed high selectivity against other interference molecules and can be applied for the detection of OTA in real

DOI: 10.1039/c3nr05499c

red wine samples, which offers the proposed method opportunities for designing new DNA-based

www.rsc.org/nanoscale

nanostructures for biosensing applications.

Introduction DNA nanostructures are nanoscale molecular structures constructed primarily from synthetic DNA.1–4 Compared to other conventional nanostructures (e.g., nanoparticles, nanowires, and nanotubes), DNA nanostructures have some unique advantages such as being easy to design, and predictable in their geometric structures, which makes them one of the most interesting areas in the eld of nanoscience.5,6 DNA nanostructures are commonly formed by self-assembly of DNA driven by entropy.7,8 With the aid of computer design and simulation, different engineered DNA nanostructures have been enabled with various capabilities including execution of molecular-scale computation, use as scaffolds or templates for further assembly of other nanomaterials, and exquisitely sensitive molecular detection and amplication of molecular recognition events.9 For example, Dirks and Pierce10 introduced the concept of a target-initiated hybridization chain reaction (HCR) formation of DNA copolymers for amplied DNA detection, the Yan group11 developed a multiplexed DNA detection method by using twodimensional DNA nano-arrays self-assembled from combinatorial DNA nanotiles and the Fan lab12,13 designed a DNA Key Laboratory on Luminescence and Real-Time Analysis, Ministry of Education, School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, P. R. China. E-mail: [email protected]; [email protected]; Fax: +86-23-68252277; Tel: +86-23-68253172

This journal is © The Royal Society of Chemistry 2014

tetrahedron structure with pendant probe DNA at one vertex for improved probe–target recognition properties in DNA detection. Indeed, these demonstrations really advanced the application of DNA nanostructures in specic nucleic acid detections. However, questions arise: can we expand the capability of the DNA nanostructures for detecting targets beyond nucleic acids, for instance small molecules and proteins? Herein, by integrating an aptamer and functional nucleic acids (DNAzymes) into the self-assembled nanostructures, we exploit the demonstration of an aptamer–DNAzyme supersandwich nanostructure for sensitive electrochemiluminescent (ECL) detection of ochratoxin A (OTA), a widespread potent toxin causing carcinogenic, nephrotoxic, hepatotoxic, teratogenic and immunotoxic effects to humans.14 Aptamers are SELEX (systematic evolution of ligands by exponential enrichment)-produced short synthetic oligonucleotides, which can bind a variety of target molecules (e.g., peptides, amino acids, proteins, organic/inorganic molecules) with high affinity and specicity,15–21 while DNAzymes are single stranded DNA molecules that exhibit catalytic activity toward specic substrates.22–25 In our approach, the OTA binding aptamer and the DNAzymes are self-assembled on a gold electrode surface to form aptamer–DNAzyme supersandwich nanostructures, which efficiently quench the ECL emission of the dissolved O2. The addition of OTA and the RecJf exonuclease leads to targetrecycling disassembly of the nanostructures and signicant ECL recovery for highly sensitive OTA detection.

Nanoscale, 2014, 6, 1099–1104 | 1099

View Article Online

Nanoscale

Experimental

Published on 08 November 2013. Downloaded by St. Petersburg State University on 23/12/2013 10:16:59.

Materials and reagents Tris–HCl, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), hemin, tris(2-carboxyethyl)phosphine hydrochloride (TCEP) and 6-mercapto-1-hexanol (MCH) were purchased from Sigma-Aldrich (St. Louis, MO). OTA was from Bioaustralis (Shanghai BioSun Sci & Tech Co., Ltd). RecJf exonuclease and 10 NEBuffer 2 (500 mM NaCl, 100 mM Tris–HCl, 100 mM MgCl2, 10 mM DTT, pH 7.9) were obtained from New England Biolabs (Ipswich, MA, USA). Potassium persulfate, sodium phosphate monobasic, sodium phosphate dibasic, potassium chloride and magnesium chloride were obtained from Kelong Chemical Inc. (Chengdu, China). The following buffer solutions were prepared in our laboratory. Immobilization buffer (IB) was made of 10 mM Tris–HCl, 1 mM EDTA, 10 mM TCEP, and 0.1 M NaCl (pH 7.4). The hybridization buffer (HB) was 10 mM Tris–HCl buffer solution containing 500 mM NaCl and 1 mM MgCl2 (pH 7.4). The 0.1 M PBS containing 0.1 M K2S2O8 and 0.1 M KCl (pH 7.4) was used as the ECL detection buffer. A hemin stock solution was prepared by dissolving 2 mg of hemin in 3 mL of DMSO and stored in the dark at
20  C. The HPLC-puried synthetic oligonucleotides were all ordered from Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China), and the sequences were listed as below: Thiolated capture probe (SH-CP): 50 -SH-C6-TGTCCGATGCT CCCTTTACGCCAC-30 ; Hairpin probe 1 (H1): 50 -ATGCTCCCTTTACGCCAC GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-30 (the italic letters represent the sequence of the OTA aptamer); Hairpin probe 2 (H2): 50 -CCACACCCGATCGTGGCGTAAA GGGAGCATGGGTTGGGCGGGATGGGTTTGTCCGATGCTCCCTT TACGCCAC-30 (the bold letters indicate the sequence of the G-quadruplex); All reagents were of analytical grade and solutions were prepared using ultrapure water (specic resistance of 18 MU cm). Gel electrophoresis Polyacrylamide gel was prepared by mixing 9.6 mL ultrapure water, 4.8 mL 5 TBE, 9.6 mL 40% bis-acrylamide, 10 mL N,N,N0 ,N0 -tetramethylethylenediamine (TEMED) and 200 mL freshly prepared 10% ammonium persulfate with stirring to a nal concentration of 16% polyacrylamide gel in 1 TBE. The freshly prepared gel was then transferred to the electrophoretic system and gelated for 30 min. Aer the introduction of the samples, electrophoresis was performed at 100 V for 90 min in 1 TBE buffer and the gel was dyed with ethidium bromide (EB). Finally, the electrophoresis image was taken using a digital camera under a UV light. OTA sensing protocol First of all, the gold electrodes (AuEs) were pretreated according to our previous method.26 Then, a droplet of 10 mL SH-CP (2 mM) in IB was placed onto the pretreated electrode and incubated

1100 | Nanoscale, 2014, 6, 1099–1104

Paper

overnight at room temperature in humidity. Aer being rinsed with deionized water, the CP-assembled electrode was blocked with 1 mM MCH for 2 h to obtain the MCH/CP/AuE. Followed by washing and drying, the electrode was then incubated with a mixture of 5 mL hairpin probe H1 (1 mM) and 5 mL H2 (1 mM) in HB for 2 h. Aer being thoroughly washed with 1 PBS, the resulting electrode was incubated with 0.2 mM hemin in 10 mM HEPES buffer (pH 8.0, 50 mM KCl, 1% DMSO) for 1 h to induce the formation of G-quadruplex/hemin complexes. Next, the sensor surface was soaked in 10 mL 1 NEBuffer 2 solution containing 6 U RecJf exonuclease and different concentrations of the target OTA at 37  C for 1 h, followed by rinsing with 1 PBS. Finally, the ECL intensity of the resulting functionalized electrode was recorded in ECL detection buffer from 0 to
2.0 V (versus Ag/AgCl) at the scan rate of 50 mV s
1 with the voltage of the photomultiplier tube (PMT) set at 800 V. EC characterizations and ECL measurements Cyclic voltammograms were recorded on a CHI 852C electrochemistry workstation (CH Instruments Inc., Shanghai, China). A conventional three-electrode conguration with a modied gold working electrode (F ¼ 3, CH Instruments Inc., Shanghai, China), a Ag/AgCl (3 M KCl) reference electrode and a platinum wire counter electrode were used. The ECL emission was monitored using a MPI-A electrochemiluminescence analyzer (Xi'an Remax Electronic Science & Technology Co. Ltd., Xi'an, China) in 0.1 M pH 7.4 PBS containing 0.1 M K2S2O8 and 0.1 M KCl with the voltage of the photomultiplier tube (PMT) at 800 V. Gel electrophoresis was performed on a DYY-8C electrophoretic apparatus (Beijing WoDeLife Sciences Instrument Co., Ltd.).

Results and discussion In the present study, we proposed a highly sensitive sensing strategy for ECL determination of OTA by integrating the amplication capability of supersandwich DNA self-assemblies with the RecJf exonuclease-catalyzed target recycling. In our experimental design, two types of hairpin DNAs (H1 and H2) are involved. The rst one (H1) includes the OTA binding aptamer sequence at the 30 end and the second one (H2) has the G-quadruplex sequence integrated in the loop region, which can form the hemin/G-quadruplex DNAzyme upon association with hemin. Both hairpin DNAs have sticky ends at the stem regions, which are used to open the hairpin structures and to form the supersandwich assemblies. As depicted in Scheme 1, the new OTA assay protocol involves the immobilization of the SH-CP on the pretreated AuE via Au–S bonds, surface blocking with MCH, formation of the supersandwich self-assemblies through an cross-opening process of the two hairpin DNAs triggered by SH-CP, formation of the hemin/G-quadruplex DNAzyme nanostructures upon addition of hemin, incubation with the target OTA and RecJf exonuclease, and ECL measurements. In the absence of the target OTA, the self-assembled hemin/G-quadruplex DNAzyme nanostructures show a signicant ECL quenching effect toward the oxygen/persulfate (O2/S2O82
) system due to the consumption of the dissolved oxygen by the

This journal is © The Royal Society of Chemistry 2014

View Article Online

Paper

Nanoscale

Published on 08 November 2013. Downloaded by St. Petersburg State University on 23/12/2013 10:16:59.

studies,28,29 this comparison indicates that the dissolved O2 plays an important role in the ECL emission of the O2/S2O82
system. The detailed ECL route can be outlined in the equations as follows27,28

Illustration of the highly sensitive strategy for ECL detection of OTA based on target-induced autonomous disassembly of the aptamer–DNAzyme supersandwich nanostructures. Scheme 1

numerous hemin/G-quadruplex DNAzymes during the cathodic scan. When the target OTA is present, the H1 containing the OTA binding aptamer sequence associates with OTA to form the aptamer/OTA complex (Scheme 1c), which leads to the disassembly of the hemin/G-quadruplex DNAzyme supersandwich nanostructures. Meanwhile, the RecJf exonuclease, which shows specic activity for catalytic degradation of single-stranded DNA in the 50 –30 direction, selectively digests the OTA-bound H1 from the 50 termini to the 30 termini until the OTA-bound H1 is fully consumed.27 Upon the digestion of the OTA-bound H1, OTA is thus released (Scheme 1d) to bind with another H1 in the supersandwich nanostructures, resulting in cyclic digestion of H1 and autonomous disassembly of the hemin/G-quadruplex DNAzyme supersandwich nanostructures. Therefore, due to the OTA recycling, a small amount of the target OTA is expected to efficiently cause the disassembly of the supersandwich structures and to lead to signicant recovery of the quenched ECL (Scheme 1e) emission. The recovered ECL signal is related to the quantity of the target OTA, and thus a sensitive “signal-on” ECL aptasensor is established. The ECL emission of the O2/S2O82
system was rst examined by performing ECL measurements on the MCH/CP/AuE in O2-saturated/deaerated conditions. In the O2-saturated 0.1 M phosphate buffer (pH 7.4) containing 0.1 M K2S2O8, the MCH/CP/AuE shows a strong and stable ECL response (Fig. 1a) during the potential scan. However, aer purging the detection buffer with high purity nitrogen for at least 20 min (O2-deaerated solution), a sharp decrease (curve b vs. curve a) in the ECL response is observed. In accordance with previous

ECL intensity–time curves on the MCH/CP/AuE (a) in O2-saturated and (b) N2-saturated 0.1 M phosphate buffer (pH 7.4) containing 0.1 M K2S2O8 and 0.1 M KCl. Fig. 1

This journal is © The Royal Society of Chemistry 2014

S2O82
+ e
/ SO4_
+ SO42


(1)

SO4_
+ H2O / HO_ + HSO4


(2)

HO_ / HOO_ + H2O

(3)

O2 + H2O + e
/ HOO_ + HO


(4)

SO4_
+ HOO_ / HSO4
+ 1(O2)*2

(5)

1

(O2)*2 / 23O2 + hn

(6)

In such a mechanism, the light-emitting species, 1(O2)*2, is formed from the dissolved O2 by its interaction with water and the electrochemically reduced strong oxidant SO4_
. Moreover, according to a previously reported study,30 the hemin/G-quadruplex DNAzymes can cause the reduction of the dissolved O2, which serves as the supplying resources of light-emitting species 1(O2)*2 (eqn (4) and (5)). Therefore, once numerous hemin/G-quadruplex DNAzymes are generated on the sensing surface, the dissolved O2 can be consumed to prohibit the formation of the 1(O2)*2 (eqn (6)) and thus the quenching of the ECL emission is expected. Incubating the sensor with the target OTA leads to the disruption of the hemin/G-quadruplex DNAzymes through autonomous disassembly of the supersandwich structures and the recovery of the ECL emission can be employed as the quantitative signals. The formation of the supersandwich structures and the target-induced cyclic disassembly of the supersandwich nanostructures with the presence of RecJf exonuclease were veried by polyacrylamide gel electrophoresis. As shown in Fig. 2, the distinct bands from Lanes 1, 2 and 3 correspond to SH-CP, H1 and H2. The mixture of H1 and H2 shows two separate bands (Lane 6), indicating that the hairpin structures of H1 and H2 are stable even aer being mixed together. However, once the CP is introduced, it hybridizes with the sticky end of H1 to unfold the hairpin structure of H1 via the strand-displacement interaction and to expose a new terminus to hybridize with H2. This hybridization leads to further unfolding of the hairpin structure of H2 and exposure of the terminus to hybridize with H1, which results in HCR between the two hairpins and the generation of long double-stranded DNA assemblies. With this regard, a UV band located at a closer place from the notch as well as a tailing phenomenon is observed (Lane 7 in Fig. 2), suggesting a highmolecular weight of the product and the successful formation of the supersandwich assemblies. The effect of RecJf toward H1 and the formed supersandwich was also studied. Aer 1 h of exonuclease incubation (37  C) and 10 min exonuclease inactivation (heating at 65  C), the digested products were obtained, transferred to gel electrophoresis and imaged under UV-light as well. The mixture of H1 and RecJf (incubated at 37  C for 1 h and 65  C for 10 min) displays a band (Lane 4) located at the same

Nanoscale, 2014, 6, 1099–1104 | 1101

View Article Online

Published on 08 November 2013. Downloaded by St. Petersburg State University on 23/12/2013 10:16:59.

Nanoscale

Fig. 2 Polyacrylamide gel electrophoresis demonstration of different samples. Lane 1: 2.5 mM CP; Lane 2: 2.5 mM H1; Lane 3: 2.5 mM H2; Lane 4: mixture of 2.5 mM H1 and RecJf; Lane 5: mixture of 2.5 mM H1, 50 ng mL
1 OTA and 0.6 U mL
1 RecJf; Lane 6: mixture of 2.5 mM H1 and 2.5 mM H2; Lane 7: mixture of 2.5 mM CP, 2.5 mM H1 and 2.5 mM H2; Lane 8: mixture of 2.5 mM CP, 2.5 mM H1, 2.5 mM H2 and RecJf; and Lane 9: mixture of 2.5 mM CP, 2.5 mM H1, 2.5 mM H2, 50 ng mL
1 OTA and 0.6 U mL
1 RecJf.

position as Lane 2, indicating that H1 can be protected from cleavage by RecJf in the form of hairpin structure stabilized by Mg2+. When the target OTA is introduced, the band of H1 becomes barely noticeable (Lane 5), indicating the disappearance of H1 due to the digestion by RecJf as discussed previously. Moreover, the addition of RecJf (without OTA) dose not cause obvious variation (Lane 8 vs. Lane 7) to the supersandwich assemblies, which veries that the assemblies can avoid digestion by RecJf. However, when the target OTA is added, the band of the supersandwich assemblies disappears and two bands at the H1 (barely visible) and H2 locations are observed (Lane 9), indicating the denaturation of the supersandwich due to the association of OTA with H1 and RecJf digestion of H1. The fabrication process for the ECL sensor was monitored by cyclic voltammetry (CV) and differential pulse voltammetry (DPV). The sensitive redox couple, [Fe(CN)6]3
/4
, was employed for CV measurements toward the sensing electrodes at different stages. As shown in Fig. 3A, a couple of quasi-reversible, welldened redox peaks of [Fe(CN)6]3
/4
are observed on the pretreated bare AuE (curve a). Aer the construction of the sensing

Fig. 3 (A) Typical cyclic voltammograms at the (a) bare AuE, (b) supersandwich/MCH/CP/AuE, and (c) (b) incubated with 50 ng mL
1 OTA in 0.1 M KCl containing 1 mM [Fe(CN)6]3
/4
by scanning the potential from
0.1 V to 0.6 V at a scan rate of 50 mV s
1. (B) Differential pulse voltammograms recorded in 20 mM HEPES buffer (pH 8.0, 20 mM KCl) on (a) bare AuE, (b) supersandwich/MCH/CP/AuE, and (c) (b) incubated with 50 ng mL
1 OTA.

1102 | Nanoscale, 2014, 6, 1099–1104

Paper

surface (immobilization of CPs, surface blocking with MCH, formation of the supersandwich assemblies and interaction with hemin), the current responses suffer sharp decreases (curve b) due to the repellence of [Fe(CN)6]3
/4
from approaching the electrode by the abundant negatively charged DNA backbones, which suggests the successful formation of the supersandwich DNA layer on the electrode surface. With the presence of the target OTA (50 ng mL
1), H1 binds with OTA to form the aptamer/OTA complexes, leading to the disassembly of the supersandwich structures and the recovery of the current responses (curve c). Accordingly, the assembly/disassembly of the supersandwich structures on the AuE was also characterized by testing direct electrochemistry of hemin/G-quadruplex DNAzyme with DPV. The DPV measurements were recorded in 20 mM HEPES buffer (pH 8.0, 20 mM KCl) by scanning the potential from 0 to
0.6 V (the solution was purged with N2 to eliminate the interference from EC reduction of O2). As can be seen from Fig. 2B, no peaks are observed on the pretreated bare AuE (curve a). Aer the assembly of the supersandwich structure and incubation with hemin to form the hemin/G-quadruplex DNAzymes, a well-dened DPV peak at around
0.32 V (curve b), which can be ascribed to direct EC reduction of hemin incorporated in the hemin/G-quadruplex DNAzymes, is obtained.31–33 However, once the sensing surface is incubated with OTA, a considerable decrease in current response (curve c vs. b) is observed, suggesting the removal of the hemin/ G-quadruplex DNAzymes from the electrode surface by the formation of the aptamer/OTA complexes. These characterizations clearly show the successful preparation of the sensor. The signal amplication capability of our protocol was evaluated by comparing the ECL recovery efficiency for 1 ng mL
1 target OTA with/without the presence of RecJf. Curve a in Fig. 4 represents the background signal (incubation with 0 ng mL
1 OTA), which is caused by the signicant suppression of the ECL emission by the assembled hemin/G-quadruplex DNAzymes (consumption of the dissolved O2). However, when the target OTA (1 ng mL
1) is introduced (without RecJf), 195% increase of the ECL intensity (curve b vs. a) is observed due to the formation of the aptamer/OTA complexes and the release of the hemin/G-quadruplex DNAzymes from the electrode surface. Importantly, when OTA (1 ng mL
1) and RecJf (6 U) are

ECL intensity–potential curves for OTA detection: (a) 0 ng mL
1 OTA (background signal), (b) 1 ng mL
1 OTA without RecJf and (c) 1 ng mL
1 OTA with 6 U RecJf. ECL measurements were performed in 0.1 M phosphate buffer (pH 7.4) containing 0.1 M K2S2O8 and 0.1 M KCl. Fig. 4

This journal is © The Royal Society of Chemistry 2014

View Article Online

Published on 08 November 2013. Downloaded by St. Petersburg State University on 23/12/2013 10:16:59.

Paper

incubated with the sensing electrode, the aptamer-containing sequence (H1) can be digested by RecJf and the target OTA is reused, leading to efficient disassembly of the supersandwich structures (elimination of the hemin/G-quadruplex DNAzymes) and signicant increase (515%) in the ECL intensity (curve c vs. a). The results shown here reveal the signicant signal amplication nature of the proposed method for OTA detection due to the target recycling disruption of the hemin/G-quadruplex DNAzyme supersandwich nanostructures. The sensitivity of our proposed sensor was investigated by varying the target OTA concentration and recording the corresponding ECL responses. As depicted in Fig. 5, when the concentration of the target OTA is elevated from 0 to 1 ng mL
1, increasing recovery of the ECL intensity is obtained (a to h). According to the calibration plot in the inset of Fig. 5, the recovered ECL intensity is proportional to the concentration of the target OTA ranging from 0.2 pg mL
1 to 1 ng mL
1 and an estimated detection limit of 75 fg mL
1 (3s) can be obtained, which shows signicant improvement compared with that of other reported methods for OTA detection.27,34–38 Moreover, our proposed protocol is also coupled with good reproducibility, as both the intra-assay and inter-assay (6 measurements) for detecting 0.4 ng mL
1 OTA yielded a relative standard deviation of 9.1% and 6.0%, respectively. To evaluate the selectivity of our method for OTA determination, three other control molecules including cocaine, aatoxin B1 (AFB1) and ochratoxin B (OTB) were used for interference tests. As can be seen from Fig. 6, no obvious changes in ECL intensity are obtained at the same concentrations (2 ng mL
1) of cocaine and AFB1 in contrast to the blank test without any target (Fig. 6b, c vs. a). However, the ECL response signal for OTB shows slight increase than that of the blank test, which may be attributed to the fact that OTB is a structural analog of OTA and possesses certain combination ability with the OTA aptamer.39 Despite the increase in the ECL intensity with the presence of OTB, the presence of a lower (10-fold) concentration of the target OTA (0.2 ng mL
1) yields a signicantly higher ECL signal compared to the blank test,

Nanoscale

Fig. 6 ECL responses of the proposed sensor after incubation with different targets: (a) blank solution (0 ng mL
1 target), (b) 2 ng mL
1 cocaine, (c) 2 ng mL
1 AFB1, (d) 2 ng mL
1 OTB, and (e) 0.2 ng mL
1 OTA.

Table 1 Recovery of OTA from wine samples obtained by the proposed method and a commercial ELISA kit

Method (mean  SD, ng mL
1) and recovery (%) Samples

Dose of spiked OTA (ng mL
1)

Our method

ELISA

1 2 3 4

0 0.10 0.25 0.50

0.45  0.025 (—) 0.56  0.027 (110%) 0.69  0.031 (96%) 0.96  0.056 (102%)

0.48  0.018 (—) 0.58  0.020 (100%) 0.74  0.015 (104%) 1.01  0.021 (106%)

indicating the high selectivity of the OTA sensor, which is associated with the high specicity of the aptamer toward OTA. OTA in red wine samples were also monitored with our method and further compared with a commercial ELISA kit to test the applicability of the developed sensor for real samples. The recoveries were obtained by spiking three different concentrations of the target OTA into the wine samples and calculating the found amount/added amount ratio, which could be served as the parameters for evaluating the accuracy and reliability of this sensor. As shown in Table 1, the data obtained by our method exhibit high agreement with the commercially available ELISA method, suggesting the reliability of our proposed strategy for monitoring OTA in real samples.

Conclusions

ECL responses of the sensor for different concentrations of the target OTA (a) 0 pg mL
1, (b) 0.2 pg mL
1, (c) 60 pg mL
1, (d) 0.1 ng mL
1, (e) 0.2 ng mL
1, (f) 0.4 ng mL
1, (g) 0.6 ng mL
1, and (h) 1 ng mL
1. Inset: the resulting calibration plot of the concentration of OTA vs. ECL intensity (error bars: SD, n ¼ 3). ECL measurement conditions, as in Fig. 4. Fig. 5

This journal is © The Royal Society of Chemistry 2014

In summary, based on RecJf exonuclease-catalyzed target recycling for autonomous disassembly of the aptamer–DNAzyme supersandwich nanostructures, a highly sensitive sensing strategy for ECL determination of OTA has been demonstrated. The developed method not only avoids extra labeling steps but also achieves signicant signal amplication and a considerably low detection limit of 75 fg mL
1 for OTA detection. Besides, the developed method can also be applied for monitoring OTA in real red wine samples and shows comparable results with those from the commercial ELISA method, providing a promising screening platform for OTA analysis in other real samples.

Nanoscale, 2014, 6, 1099–1104 | 1103

View Article Online

Nanoscale

Acknowledgements

Published on 08 November 2013. Downloaded by St. Petersburg State University on 23/12/2013 10:16:59.

This work was supported by NSFC (no. 21275004, 20905062, 21075100 and 21275119), Ministry of Education of China (Project 708073), the New Century Excellent Talent Program of MOE (NCET-12-0932) and Fundamental Research Funds for the Central Universities (XDJK2012A004 and XDJK2013D016).

Notes and references 1 N. Seeman, Sci. Am., 2004, 290, 64–75. 2 B. Robinson and N. Seeman, Protein Eng., 1987, 1, 295–300. 3 E. Winfree, F. Liu, L. Wenzler and N. C. Seeman, Nature, 1998, 394, 539–544. 4 P. W. Rothemund, Nature, 2006, 440, 297–302. 5 J. Bath and A. Turbereld, Nat. Nanotechnol., 2007, 2, 275– 284. 6 T. LaBean and H. Li, Nano Today, 2007, 2, 26–35. 7 D. Zhang, A. Turbereld, B. Yurke and E. Winfree, Science, 2007, 318, 1121–1125. 8 P. Yin, H. Choi, C. Calvert and N. Pierce, Nature, 2008, 451, 318–322. 9 Z. Deng, Y. Chen, Y. Tian and C. Mao, Nanotechnology: Science and Computation, Natural Computing Series, ed. G. Rozenberg, Springer, Berlin Heidelberg, 2006, pp. 23–34. 10 R. M. Dirks and N. A. Pierce, Proc. Natl. Acad. Sci. U. S. A., 2004, 101, 15275–15278. 11 C. Lin, Y. Liu and H. Yan, Nano Lett., 2007, 7, 507–512. 12 H. Pei, N. Lu, Y. Wen, S. Song, Y. Liu, H. Yan and C. Fan, Adv. Mater., 2010, 22, 4754–4758. 13 Y. Wen, H. Pei, Y. Shen, J. Xi, M. Lin, N. Lu, X. Shen, J. Li and C. Fan, Sci. Rep., 2012, 2, DOI: 10.1038/srep00867. 14 A. L¨ uhe, H. Hildebr, U. Bach, T. Dingermann and H. J. Ahr, Toxicol. Sci., 2003, 73, 315–328. 15 G. Tuerk and L. Gold, Science, 1990, 249, 505–510. 16 A. D. Ellington and J. W. Szostak, Nature, 1990, 346, 818–822. 17 M. Minunni, S. Tombelli, A. Gullotto, E. Luzi and M. Mascini, Biosens. Bioelectron., 2004, 20, 1149–1156. 18 A. B. Iliuk, L. H. Hu and W. A. Tao, Anal. Chem., 2011, 83, 4440–4452.

1104 | Nanoscale, 2014, 6, 1099–1104

Paper

19 I. Willner and M. Zayats, Angew. Chem., 2007, 119, 6528– 6538. 20 I. Willner and M. Zayats, Angew. Chem., Int. Ed., 2007, 46, 6408–6418. 21 M. Zhou and S. J. Dong, Acc. Chem. Res., 2011, 44, 1232– 1243. 22 R. R. Breaker and G. F. Joyce, Chem. Biol., 1994, 1, 223– 229. 23 J. Li, W. Zheng, A. H. Kwon and Y. Lu, Nucleic Acids Res., 2000, 28, 481–488. 24 B. Ceunoud and J. W. Szostak, Nature, 1995, 375, 611–614. 25 Y. Li and D. Sen, Nat. Struct. Biol., 1996, 3, 743–747. 26 Y. Chen, J. Xu, J. Su, Y. Xiang, R. Yuan and Y. Q. Chai, Anal. Chem., 2012, 84, 7750–7755. 27 P. Tong, L. Zhang, J. J. Xu and H. Y. Chen, Biosens. Bioelectron., 2011, 29, 97–101. 28 O. V. Reshetnyak and E. P. Koval'chuk, Electrochim. Acta, 1998, 32, 465–472. 29 W. Yao, L. Wang, H. Y. Wang and X. L. Zhang, Electrochim. Acta, 2008, 54, 733–737. 30 D. J. Lin, J. Wu, F. Yan, S. Y. Deng and H. X. Ju, Anal. Chem., 2011, 83, 5214–5221. 31 G. Pelossof, R. Tel-Vered and I. Willner, Anal. Chem., 2012, 84, 3703–3709. 32 G. Pelossof, R. Tel-Vered, J. Elbaz and I. Willner, Anal. Chem., 2010, 82, 4396–4402. 33 S. Liu, C. Wang, C. Zhang, Y. Wang and B. Tang, Anal. Chem., 2013, 85, 2282–2288. 34 J. Zhang, X. Zhang, G. Yang, J. Chen and S. Wang, Biosens. Bioelectron., 2013, 41, 704–709. 35 T. H. Li, E. Job and M. Kim, Chem. Commun., 2012, 48, 2304– 2306. 36 S. J. Wu, N. Duan, X. Y. Ma, Y. Xia, H. X. Wang, Z. P. Wang and Q. Zhang, Anal. Chem., 2012, 84, 6263–6270. 37 A. Hayat, W. Haider, M. Rollandd and J. Marty, Analyst, 2013, 138, 2951–2957. 38 Y. Xiang and Y. Lu, Anal. Chem., 2012, 84, 4174–4178. 39 H. Kuang, W. Chen, D. H. Xu, L. G. Xu, Y. Y. Zhu, L. Q. Liu, H. Q. Chu, C. F. Peng, C. L. Xu and S. F. Zhu, Biosens. Bioelectron., 2010, 26, 710–716.

This journal is © The Royal Society of Chemistry 2014