Neurobiology of Aging 36 (2015) 157e168

Contents lists available at ScienceDirect

Neurobiology of Aging journal homepage: www.elsevier.com/locate/neuaging

Beta amyloid-induced upregulation of death receptor 6 accelerates the toxic effect of N-terminal fragment of amyloid precursor protein Yuxia Xu a,1, Dandan Wang a,1, Ying Luo b, Wei Li b, Ye Shan a, Xiangshi Tan b, Cuiqing Zhu a, * a State Key Laboratory of Medical Neurobiology, Department of Neurobiology and Institutes of Brain Science, School of Basic Medical Science, Fudan University, Shanghai, China b Department of Chemistry and Institute of Biomedical Sciences, Fudan University, Shanghai, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 23 October 2013 Received in revised form 29 June 2014 Accepted 21 July 2014 Available online 24 July 2014

Amyloid precursor protein (APP) plays essential roles in the development of the Alzheimer’s disease. Although full-length APP has been thoroughly studied, the role of the cleavage fragments especially the N-terminal fragments (N-APPs) in Alzheimer’s disease pathogenesis was still elusive. In this study, we demonstrated that application of recombinant APP18-286 could enhance beta amyloid (Ab)-induced neuronal injuries which were related to the activation of apoptosis proteins. Ab treatment could induce a slight increase of N-APPs release. In addition, expression of death receptor 6 (DR6) was increased in Abtreated neurons and APP transgenic mice. Moreover, the effect of APP18-286 on Ab-induced injuries could be suppressed by the application of recombinant DR641-341 and DR6 antibody. Furthermore, pull-down assay revealed that APP18-286 could bind both exogenous and endogenous DR6. Ab promoted APP18-286 targeting to neuron which was accompanied with the increase of DR6 expression, whereas downregulation of DR6 by interference RNA could alleviate the binding of N-APPs to neuron and also suppressed Ab-dependent toxic effect with N-APPs. These results suggested that APP N-terminal fragments might play neurotoxic roles in Ab-induced neuronal injuries through cell surface DR6. Ó 2015 Elsevier Inc. All rights reserved.

Keywords: b-Amyloid N-terminal fragment of APP Death receptor 6 Apoptosis pathway

1. Introduction Alzheimer’s disease (AD) is a neurodegenerative disorder characterized by intraneuronal neurofibrillary tangles and extracellular senile plaques and progressive cognitive impairment including memory loss. The major constituent of senile plaques is beta amyloid (Ab), a 39-43 amino acid derivative of b-amyloid precursor protein (APP) metabolism (Hardy and Selkoe, 2002). Although Ab is considered as a critical element in pathologic mechanism of AD, the detail pathogenesis of disease has still not been entirely elucidated. APP can be processed by secretases generating Ab fragments and other derivatives like sAPP, a secreted form of APP which has a neuroprotective effect under certain conditions (Roch et al., 1994). An increasing number of researches have suggested that APP mediates various cellular activities such as axonal growth, vesicular trafficking, and synaptic plasticity (Turner et al., 2003). Moreover,

* Corresponding author at: State Key Laboratory of Medical Neurobiology and Department of Neurobiology, Fudan University, Shanghai 200032, China. Tel: þ86 21 542 37858; fax: þ86 21 641 74579. E-mail address: [email protected] (C. Zhu). 1 These authors contributed equally to this work. 0197-4580/$ e see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.neurobiolaging.2014.07.027

evidence also revealed that APP protein itself mediates pathologic changes in AD and contributes to the neuronal toxicity of Ab (Heredia et al., 2004; Masumura et al., 2000; Nishimura et al., 1998). Furthermore, recent study has demonstrated that nerve growth factor deprivation caused the release of N-terminal fragments of APP (N-APPs) from neurites of dorsal root ganglion (DRG) neurons, and N-APPs could induce axonal degeneration via death receptor 6 (DR6) (Nikolaev et al., 2009). In addition, different lengths of NAPPs have been detected in AD brain and cerebrospinal fluid (Portelius et al., 2010), which implies that N-APPs might be involved in AD pathogenesis. However, another report showed that APP cleavage and caspase-6 activation were not involved in axonal degeneration of DRG neuron induced by mechanical insults or toxic agent vincristine exposure which inferred that N-APPs might play roles in specific types of disease-associated neuronal degeneration (Vohra et al., 2010). Based on these previous reports, we put forward the following questions that whether N-APPs could potentiate Ab-induced neuronal injuries in primary cultured neurons through binding cell surface protein such as DR6 and then subsequently activate the downstream signaling pathway. Members of the tumor necrosis factor receptor (TNFR) family are crucial modulators in inflammatory and cellular immune responses

158

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

and mediate a variety of biological functions ranging from cell proliferation, differentiation, and apoptosis to cell survival (Baud and Karin, 2001; Wajant et al., 2003). TNFRs are activated by different ligands, such as TNF-a, Fas ligand, or TRAIL, which leads to oligomerization of the receptors and subsequent recruitment of death domain, then activate diverse downstream targets (Lavrik et al., 2005; Nagata, 1997; Siegel, 2006). There are increasing evidences showing that DR6, one member of TNFR superfamily (Nagata,1997; Pan et al.,1998), plays an important role in neuronal cell death. As reported, overexpression of DR6 in some cell lines could lead to apoptosis (Bridgham et al., 2001; Eimon et al., 2006; Kasof and Gomes, 2001; Kasof et al., 2001). In contrast, DR6 deficiency attenuated stimulation-induced cell death (Cheng et al., 2002; Mi et al., 2011). Moreover, recent research has showed that DR6 expression is upregulated in AD cortex and correlated with elevated neuronal death, implying the role of DR6 in neurodegeneration (Hu et al., 2013). DR6 had been regarded as an orphan receptor previously. However, the finding that cleaved extracellular fragment of APP could function as a DR6 ligand (Nikolaev et al., 2009) raises the question whether Ab could induce the expression of DR6 and production of N-APP fragments which subsequently deteriorate Ab caused neuronal injury. To elucidate this question, we first analyzed the effects of Ab on DR6 expression and N-APP release. Then, we evaluated the cooperative effects of N-APPs and Ab on neurodegeneration of cortical neurons with or without interfering DR6/N-APP system. Our results show that Ab could induce DR6 expression; moreover, N-APPs could potentiate Ab-induced neurotoxicity and the effect of N-APPs on cortical neurons might through DR6. 2. Methods 2.1. Animals APP Swedish/PS1delta E9 transgenic mice were obtained from Shanghai Research Center for Model Organism and housed in Individually Ventilated Cage. Animal experiment protocols conformed to the Animal Care and Use Committee of Fudan University, and all efforts were made to minimize the number of animals used and their suffering. 2.2. Antibodies and reagents The following primary and secondary antibodies were used: Bax and Bcl-2 (Cell Signal Technology); His-tag and p75 (Bioworld); active caspase-3, MAP-2 and Ab (Millipore); active caspase-6 (BioVision); DR6 (human DR6 extracellular domain, R&D); APP polyclonal antibody (recognized 1-305aa, Proteintech-10524-1-AP; recognized 46-60aa, Sigma-A8967; recognized 676-695aa, SigmaA8717); APP mononal antibody (recognized 66-81aa, Millpore 22C11); Alexa Fluor-594 or Alexa Fluor-488 labeled secondary antibodies (Invitrogen); IRDye labeled secondary antibodies (LI-COR Corporation); and HRP-conjugated secondary antibodies (Abcam). MTT was purchased from Sigma. CytoTox96 Non-Radioactive Cytotoxicity Assay Kit was purchased from Promega. Nickelnitrilotriacetic acid (Ni-NTA) agarose was purchased from Invitrogen. Superdex 200Hi-Load 16/60 gel filtration column was from Pharmacia. AffiGel 10 was purchased from Bio-Rad. The nitrocellulose membrane was purchased from PALL. ECL detection kit was purchased from Amersham. All the other chemicals were of high grade and available commercially. 2.3. Vectors The MBPHT-mCherry2 vector was a kind gift from Dr Yu Ding (Fudan University). The TEV protease expression vector pRK1043,

the prokaryotic expression vector pET28 b (þ), the Escherichia coli strain XL10-Gold and Rosetta (DE3) pLysS were purchased from Novagen. The eukaryotic expression vector pcDNA3.1(þ) was purchased from Invitrogen. The shRNA vector pMagic 6.1 was obtained from Sbo-Bio Co Ltd. The packaging plasmid psPAX2 and envelope plasmid pMD2.G were obtained from Addgene. 2.4. Preparation of aged Ab1-42 Ab1-42 peptide was purchased from GL Biochem (China) for fibrils preparations. Ab1-42 was solubilized in distilled water at a concentration of 5 mM and incubated in a capped vial at 37  C for 7 days to form aggregated form (Feng and Zhang, 2004). The aged Ab1-42 was analyzed by electromicroscope and were previously described (Xing et al., 2012) showing that it was composed of fibrillar Ab and some spherical and amorphous aggregated species (Supplementary Fig. 1). Aged Ab1-42 was stored frozen at 20  C until use. 2.5. Preparation of N-terminal APP18-286 fragment and N-terminal DR641-341 fragment Human APP18-286 and DR641-341 sequences were amplified by reverse transcription polymerase chain reaction and cloned into vector MBPHT-mCherry2. The recombinant plasmids were transfected into Escherichia coli Rosetta (DE3) pLysS competent cells and induced by Isopropyl b-D-thiogalactoside. Then the expressed fusion proteins were separated by affinity column of amylose and eluted. Fused MBP proteins were cleaved with TEV protease. Target proteins were finally separated by Superdex 200 HiLoad 16/60 gel filtration column and equilibrated. For His-tagged APP18-286, APP18286 was subcloned to pET28 b(þ) vector and expressed as previously mentioned. All proteins were stored frozen at 80  C until use. 2.6. DR6 interference RNA lentivirus construction and infection DR6 gene knockdown was conducted in primary neurons by lentivirus infection. Briefly, a 21-nucleotide sequence (AGCCATCTTCCTGACCTATTG) for targeting DR6 gene was selected. Then synthetic oligonucleotides for hairpin siRNA were annealed and ligated into pMagic 6.1 shRNA vector. The packaging system used for LV production with psPAX2 and pMD2G was described in detailed previously (Kutner et al., 2009). Viral production was concentrated and stored at 80  C. For efficient knockdown, cells were infected 3 days before use. 2.7. DR6 expression plasmid construction and transfection Full length of DR6 sequence was amplified by reverse transcription polymerase chain reaction and ligated into pcDNA3.1(þ) vector. For efficient overexpression, cells were transfected with Lipofectamine 2000 reagent (Invitrogen) as the standard procedure. 2.8. Cell culture The neurons were cultured as previously reported. Briefly, on embryonic day 17 rats were anesthetized. Cortices of fetal rats were dissected and digested with trypsin. Cell suspensions were filtered and centrifuged. The cell pellet was resuspended in DMEM with 10% FBS and plated onto poly-L-lysine-coated plates or dishes. About 4 hours later, the medium was replaced with neurobasal medium supplemented with B27. Cultures were maintained at 37  C in a 5% CO2 incubator until 12 days for use. The astrocytes of fetal rat brain were cultured as mentioned in the previous report (Kaech and Banker, 2006). Briefly, cell suspensions were collected as mentioned previously and resuspended in glia medium (DMEM

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

159

Fig. 1. APP18-286 fragment enhanced Ab-induced neurotoxicity through activation of apoptosis pathway. The coomassie blue and immunoblotting verification for the recombinant APP18-286 fragment was shown in (A). Cortical cultured neurons were exposed to the indicated concentration of APP18-286 fragment for 12 hours, and then cell viability was evaluated by LDH assay (B). Cell viabilities were also analyzed by LDH after cotreatment with 25 mM Ab1-42 and different concentration of APP18-286 fragment (mg/mL) for 12 hours (C). In addition, immunoblots results showed the level of active caspase-3 (D and E), active caspase-6 (D and F), Bax (D and G), and Bcl-2 (D and H) in a control culture, a culture exposed to 25 mM Ab1-42, a culture exposed to 5 mg/mL APP18-286 fragment alone and a culture exposed to 25 mM Ab1-42 plus 5 mg/mL APP18-286 fragment for 12 hours Similar results were obtained in 3 independent experiments. Actin was used as a loading control. Results were mean  SEM, n ¼ 3.* p < 0.05; ** p < 0.01 compared with normal control (CON); # p < 0.05; ## p < 0.01 compared with group treated with Ab alone. Abbreviations: Ab, beta amyloid; APP, amyloid precursor protein; SEM, standard error of the mean.

with 10% horse serum). After 1 day, the culture dish was swirled to remove loosely attached cells, then aspirated off the medium, and replaced with fresh glia medium. Cultures were maintained at 37  C in a 5% CO2 incubator and fed every 2e3 days. SH-SY5Y and 293FT cells were obtained from the American Tissue Culture Collection. All cells were cultured in DMEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin at 37  C and 5% CO2. 2.9. Treatment of conditioned medium The proteins in the conditioned medium were precipitated with 10% trichloroacetic acid. Samples were centrifuged and washed with ice-cold methanol. The pellets were resuspended in SDS sample buffer for analysis. 2.10. Cell viability assay Cell viability was assessed using conventional MTT reduction assay and LDH assay. All the procedures were according to the manufacturer’s instructions. 2.11. Immunocytochemistry and immunohistochemistry For immunocytochemistry assay, cells were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100 in PBS and

blocked in 5% FBS in PBS. Primary antibodies including DR6 antibody (1:200), His antibody (1:200), APP antibody (1:200), and MAP-2 antibody (1:200) were diluted and incubated overnight at 4  C. After washing with PBS, cultures were incubated with Alexa Fluor-594 or Alexa Fluor-488 conjugated secondary antibodies (1:200) at room temperature for 1 hour. For immunohistochemistry, mice were anaesthetized with sodium pentobarbital and perfused through aorta with 0.9% NaCl followed by 4% paraformaldehyde. Brains were removed and cut coronally at 30 mm with a freezing microtome. Free-floating slices were incubated at 4  C overnight with anti-DR6 antibody (1:200) and anti-Ab antibody (1:200). Then, the immunoreactivity of DR6 and Ab was probed using Alexa Fluor-594 or Alexa Fluor-488 conjugated IgG, respectively. 2.12. Ni-NTA pull-down assay First, Ni-NTA agarose beads slurry was balanced in binding buffer (50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazole, and 1 mM PMSF, pH 8.0). His-tagged APP18-286 fragment was incubated with the beads and gently shaken for 2 hours. The APP-His-tag-Ni-NTA agarose beads were recovered and be ready for use. Cells or brain tissue were lysed and centrifugated. The supernatant was pretreated with agarose beads and incubated with APP-His-tag-Ni-NTA agarose beads overnight. The beads were collected by centrifugation and washed with washing buffer (50 mM HEPES, pH 7.5, 10 mM MgCl2,

160

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

Fig. 2. The effect of Ab on N-APPs release in cultured neuron and astrocyte. (A) Domain structure of APP, indicating antibody binding sites. Adapted from Nikolaev et al. (2009). (B) Conditioned media from neuronal and astrocyte cultures were precipitated with trichloroacetic acid and analyzed with 3 different antibodies all of which recognize N-terminal region of APP. (C) Neuronal cultures were treated with or without Ab1-42. The conditioned media were collected and analyzed with N-APP antibodies. (D) Conditioned media from neuronal cultures were used to culture astrocyte with or without Ab treatment. Then the media were collected and probed with APP antibodies. Arrowheads indicated the higher molecular weight bands. Arrows indicated the N-APP fragment bands with lower molecular weight * in C indicated the special main band for 22C11 antibody detecting. In D, * labeled band showed a significant decrease intensity after incubating in astrocyte culture with Ab treatment, whereas the intensity of # labeled band mildly decreased. Abbreviations: Ab, beta amyloid; APP, amyloid precursor protein; N-APPs, N-terminal fragments.

200 mM NaCl, 0.1 mM EDTA, 20 mM imidazole, 10% glycerol, and 1% Triton X-100). The beads were mixed and boiled for 5 minutes in SDS sample buffer for analysis. The input represents 50% of the supernatant that was incubated with Ni-NTA or Ni-NTA-binding protein.

2.13. Western blotting analysis Western blotting analysis was performed as previously described (Bauer et al., 2009). In brief, cells were washed in ice-cold

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

161

Fig. 3. DR6 expression was increased in Ab-treated primary cultured neurons and AD transgenic mice brain. Primary cultured cortical neurons were exposed to the indicated concentration of Ab1-42 for 12 hours, and cell viability was assayed by MTT (A). Representative blots showed the expression of DR6 (B) and p75 (C) in neurons treated with different concentration of Ab1-42 for 12 hours, and also DR6 expression after 25 mM Ab1-42 treatment for different time phases (D). Immunofluorescence images (E) showed the immunostaining for MAP2 (green), DR6 (red), and DAPI (blue) after 25 mM Ab1-42 treatment for 12 hours. The arrow indicated the condensed nucleus. In addition, representative blots showed the expression of DR6 in hippocampus (Hip) and cortex (Cor) of 6 months and 12 months AD transgenic mice (F). Actin was reprobed to normalize protein loading. Moreover, immunofluorescent images showed the immunostaining for DR6 (green), Ab (red), and DAPI (blue) in cortex, CA3 regions (CA3) and dentate gyrus (DG) of 6 months (G) and 12 months (H) age-matched wild type (Wt) control and AD transgenic mice (Tg). Inserted image represented a glia cell as arrow indicated. The results were expressed as arbitrary units and were normalized to the respective control. Results were mean  SEM from 5 independent experiments. * p < 0.05; ** p < 0.01 compared with normal control (CON); # p < 0.05; ## p < 0.01 compared with Wt group. Abbreviations: Ab, beta amyloid; AD, Alzheimer’s disease; DR6, death receptor 6; SEM, standard error of the mean. (For interpretation of the references to color in this figure, the reader is referred to the web version of this article.)

PBS, scraped into RIPA buffer with a mixture of protease and phosphatase inhibitors cocktail, and lysed for 30 minutes on ice. Samples were then centrifuged at 4  C, and the protein concentration of the supernatant was quantified by Bradford assay. Protein samples were resolved by 10% SDS-PAGE electrophoresis and

transferred to NC membranes, which were submerged in blocking buffer TBS containing 5% BSA for 2 hours at room temperature and incubated overnight at 4  C with primary antibody, then repeatedly washed in TBST and exposed to IRDye-labeled secondary antibody or HRP-conjugated secondary antibody for 1 hour at room

162

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

temperature. After 3 additional washes, blots were scanned by the Odyssey IR Imaging System (Li-COR, USA) or visualized by ECL. 2.14. Enzyme-linked immunosorbent assay-based binding assay Each well of a 96-hole microtiter plate (MaxiSorp; Nunc) was coated with DR6 protein of 5 mg/mL in sodium bicarbonate buffer and incubated overnight at 4  C. After washing 3 times with PBST, the plate was blocked with 10% FBS in PBS at 37  C for 1 hour, then the diluted His-tagged N-APP protein was added and incubated at 4  C overnight. After washing with PBST, His-tagged primary antibody was added and incubated at 37  C for 1 hour. The plate was washed 3 times again, and then incubated with 1:500 dilution of IRDye 680 labeled secondary antibody (Li-COR, USA) for 2 hours, at room temperature. Enzyme-linked immunosorbent assay (ELISA) signals were scanned by the Odyssey IR imaging system (Li-COR, USA). 2.15. Statistical analysis All the experiments described in this study were repeated at least 3 times with independent treatments, and all data were presented as the mean  standard error of the mean. The significance of the differences was analyzed via 1-way ANOVA. Mean values were considered to be statistically significant at p < 0.05. 3. Results 3.1. Effect of N-APPs on Ab-induced neurotoxicity To verify whether N-APPs participate in Ab-induced neurotoxicity, we first prepared the exogenous recombinant APP18-286 fragments and then evaluated the effect of N-APP fragments on Ab-induced neurotoxic effect. In this experiment, APP18-286 produced by prokaryotic expression system was purified and confirmed by immunoblotting assay which showed that the molecular weight was about 35 kD (Fig. 1A). First, the effect of different dilution (0.5, 1, 5, and 10 mg/mL) APP18-286 on cell viability was analyzed in primary cultured cortical neurons with LDH assays. Results showed that 5 mg/mL APP18-286 treatment for 12 hours appeared neurotoxicity on neurons (Fig. 1B). In consideration of the limited toxic effect, we then tested whether the N-APPs could strengthen the toxic effect of Ab. The cultured neurons were treated with 25 mM Ab alone or with different concentration of APP18-286 for 12 hours. LDH results demonstrated that neurotoxicity induced by Ab could be substantially enhanced by APP18-286 fragments (Fig. 1C). The analysis of activated apoptosis pathway proteins showed that treatment with 5 mg/mL APP18-286 alone could mildly induce the increase of active caspase-3 and 6. Cotreated with Ab and APP18-286 showed a higher level of active caspase-3 and -6 compared with Ab treatment alone (Fig. 1DeF). In addition, the synergistic effect of Ab/ APP18-286 on the increase expression of Bax (Fig. 1D and G) was significant but not on the expression of Bcl-2 (Fig.1D and H). In summary, our studies provide evidence that N-APPs could enhance Ab-induced neuronal injuries through activation of apoptosis-related proteins. 3.2. The effect of Ab on sAPPs and N-APP fragments production To explore whether Ab could induce N-APPs release, the conditioned media from primary cultured neurons or astrocytes were collected and probed with 3 different antibodies which all recognized the APP N-terminus (Fig. 2A). Immunoblotting analysis showed different patterns of immunopositive bands between the samples of conditioned media from cultured primary neurons and astrocytes (Fig. 2B). In conditioned media from neuronal culture, the level of N-APP fragment bands at about 35 kD, or lower

molecular weight was very less than that of higher molecular weight (sAPPs). Treatment with Ab for 12 hours induced a slight increase of the N-APPs recognized by 3 different antibodies (labeled by arrows in Fig. 2C). In contrast, for the neuronal conditioned media collected from astrocyte, a slight elevation of N-APPs at about 35 kD was only detected with antibody A8967 (Fig. 2D). sAPPs (secreted APP) production has been considered as a necessary step preceding 35 kD N-APP fragments formation (Nikolaev et al., 2009). With 2 polyclonal antibodies 10524-1-AP and A8967, respectively; immunoblotting results showed similar bands at higher molecular weight (Fig. 2C, indicated by arrowheads). Although the bands pattern revealed by monoclonal antibody 22C11 was different which showed a distinct main band (indicated by *). In addition, immunoblots with all 3 APP antibodies revealed the decrease of APP immunopositive bands at high molecular weight in the media sample from neurons treated with Ab. The conditioned media from astrocyte treated with Ab only significantly decreased 1 band labeled by 22C11 (indicated by * in Fig. 2D) compared with that of Ab absence. In addition, the secreted APP and the degradation fragments in conditioned media from astrocyte were not affected by Ab treatment (Supplementary Fig. 2). 3.3. Increased expression of DR6 in Ab-treated primary cultured neurons and in APP/PS1 transgenic mice To address whether Ab could induce the DR6 expression, primary cultured neurons were treated with Ab for 12 hours and then the DR6 expression was analyzed. Western blotting showed a significant increase of DR6 expression (Fig. 3B), which was consistent with a dramatic decrease of cell viability determined by MTT reduction assay (Fig. 3A). Moreover, p75, a membrane protein which could bind with DR6 (Hu et al., 2013) was also increased (Fig. 3C). In addition, the expression of DR6 following treatment with 25 mM Ab for different times revealed a time-dependent pattern that the expression of DR6 reached the highest level at 6 hours time point (Fig. 3D). Furthermore, immunostaining for DR6 and MAP2 in neurons also confirmed the increase in immunoreactivity of DR6 in neurites and cell bodies after treatment with Ab (Fig. 3E). It could also be observed that the cells with significant nuclei condensation and fragmentation were less DR6 immunopositive (as showed by arrow). To further elucidate the contribution of DR6 in AD pathology, we then detected the expression and distribution of DR6 in APP/PS1 transgenic mice. Immunoblotting results showed that DR6 expression was significantly increased in the cerebral cortex and hippocampus of APP/PS1 mice compared with the age-matched wild type mice both at the age of 6 months and 12 months age (Fig. 3F). The increase in expression of DR6 in cortex and hippocampus was also confirmed by immunofluorescent staining (Fig. 3G and H). It should be noted that in 6-monthold AD mice (Fig. 3G) which has few Ab positive plaques, DR6 was mainly distributed in neurons. In contrast, consistent with the increased Ab plaques at 12-month-old AD mice, DR6 was relatively less distributed in neurons but was deposited in Ab-positive plaques and also in some glial cells (Fig. 3H). The above results indicated that Ab could induce upregulation and aberrant distribution of DR6. 3.4. DR641-341 fragment and DR6 antibody modulated the effect of Ab/APP18-286 To further validate that the enhanced effect of APP18-286 on Abinduced toxicity was through DR6, we next blocked the DR6 system to interfere the interaction of N-APP with cell surface DR6. To achieve this purpose, we then constructed the DR641-341 fragment containing extracellular domain (Fig. 4A) of which the N-APPs

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

binding sites were included (Kuester et al., 2011). The in vitro binding assay showed that DR641-341 could be detected in the APP18286-His-Ni-NTA agarose pull-down fraction (Fig. 4B). Meanwhile, the assay based on ELISA method also indicated an interaction between APP18-286 and DR641-341 (Fig. 4C). In the following studies, we then further analyzed the blocking effect of DR641-341 fragment on Ab/N-APP-induced cytotoxicity. Results showed that administration of DR641-341 could significantly inhibit the activation of caspase-3 (Fig. 5A) and caspase-6 (Fig. 5B), which were activated by Ab/APP18-286 cotreatment. DR641-341 fragment also suppressed the upregulation of Bax (Fig. 5C) and the downregulation of Bcl-2 induced by Ab/APP18-286 (Fig. 5D). Moreover, DR641-341 fragment also could inhibit Ab-induced activation of caspase-3 and 6 and upregulation of Bcl-2. Previous studies had shown that DR6 antibody could be used to block the toxic effect of N-APPs on DRG neurons (Nikolaev et al., 2009). In this study, as shown in Fig. 5EeH, preadministration of DR6 antibody (20 mg/mL) could attenuate the activation of caspase-3 and 6 and the upregulation of Bax expression induced by Ab/APP18-286. Meanwhile, the DR6 antibody could dramatically increase the expression of Bcl-2 under Ab/APP18-286 cotreatment conditions, which was even more than that of control group. These

163

results further suggested that N-APPs might enhance the cytotoxicity of Ab through DR6 receptor. 3.5. APP18-286 fragment bound with endogenous DR6 To analyze the binding ability of the APP18-286 fragment to the endogenous DR6, a Ni-NTA agarose pull-down assay was conducted with His-tagged APP18-286 fragment. Supernatants of cell lysate were extracted from cultured SH-SY5Y cells which had been treated without or with 25 mM Ab for 12 hours or from cells which had been transiently transfected with DR6 plasmid, and then the lyses were incubated with His-tagged APP18-286 coupled with Ni-NTA agarose beads. Immunoblotting analysis showed that DR6 present in captured APP18-286-associated proteins (Fig. 4D). Moreover, the increased DR6 in the cell lyses from the samples with Ab treatment or transfection of DR6 plasmid could be pulled down by His-tagged APP18-286. As reported that DR6 could bind with p75 (Hu et al., 2013), the p75 level in the pull-down fraction in this study was also analyzed. Results showed that no significantly increased p75 level was detected in pull-down samples from either Ab treated or DR6 transfected cells. In APP/PS1 mice, which have an upregulation expression of DR6, the pull-down assay also showed an increase

Fig. 4. APP18-286 fragment binded with DR641-341 fragment and endogenous DR6. Western blotting verification for the recombinant DR641-341 fragment was shown in A. B showed the pull-down analysis of the interaction between APP18-286-His and DR641-341 fragment. The affinity of the interaction of DR6 and APP18-286-His was assessed by ELISA in the plate coated with DR641-341 (C). The binding APP18-286-His was labeled by anti-His-tag antibody and IRDye 680 secondary antibody. The Hill analysis showed APP18-286-His interaction with wells coated with DR641-341 (Kd ¼ 5.168 nM and h value ¼ 1.772). Cultured SH-SY5Y cells were treated with 25 mM Ab1-42 for 12 hours or transiently transfected with DR6 plasmid (DR6 overexpression, DR6 OE). The supernatants of cell lysate extract were incubated with Ni-NTA and APP18-286-His coupled Ni-NTA agarose beads. The bound proteins were analyzed by Western blotting using antibodies specific for DR6, p75, and His-tag (D). The cortex samples from APP/PS1 transgenic mice also were analyzed by pull-down assay with APP18-286-His coupled Ni-NTA agarose beads (E). Abbreviations: APP, amyloid precursor protein; DR6, death receptor 6; ELISA, enzyme-linked immunosorbent assay; Ni-NTA, nickelnitrilotriacetic acid.

164

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

Fig. 5. DR641-341 fragment and DR6 antibody pretreatment attenuated cell injuries induced by Ab/APP18-286 cotreatment. The effect of DR641-341 fragment (20 mg/mL) on neuronal apoptosis induced by Ab (25 mM) or Ab (25 mM)/APP18-286 (5 mg/mL) fragment cotreatment was analyzed by immunoblots with antibodies which recognize active caspase-3 (A), active caspase-6 (B), Bax (C), and Bcl-2 (D). * p < 0.05 compared with treated with Ab alone. # p < 0.05 and ## p < 0.01 compared with group cotreatment with Ab and APP18-286 fragment. The effect of DR6 antibody (20 mg/mL) on Ab/APP18-286 fragment-induced neuronal apoptosis was also analyzed by immunoblots detecting active caspase-3 (E), active caspase-6 (F), Bax (G), and Bcl-2 (H). Similar results were obtained in 3 independent experiments. Results were mean  SEM, n ¼ 3. Actin was used as a loading control. * p < 0.05 and ** p < 0.01 compared with normal control group. # p < 0.05 and ## p < 0.01 compared with group cotreatment with Ab/APP18-286 and control antibody. Abbreviations: Ab, beta amyloid; APP, amyloid precursor protein; DR6, death receptor 6; SEM, standard error of the mean.

of DR6 but not of p75 in captured APP18-286-associated proteins (Fig. 4E). These findings, together with the above blocking assays, indicated that the recombinant APP18-286 fragment in this study exerted DR6 binding ability. Furthermore, upregulated DR6 expression might offer N-APPs binding sites. 3.6. Ab regulated the interaction of APP18-286 fragment with neurons To directly assess whether the interaction of APP18-286 fragment with neuron is specifically affected by Ab, we then investigated the distribution of the exogenously introduced His-tagged APP18-286 in cultured cortical neurons. Neurons were treated with or without 25 mM Ab for 12 hours followed by washing and then incubating with 5 mg/mL His-tagged APP18-286 for additional 4 hours. The distribution of His-tagged APP18-286 and endogenous APP in neurons was analyzed by immunostaining with antibodies against His-tag or Cterminal of APP, respectively. Immunofluorescence results showed a different distribution of APP18-286-His and endogenous APP on neurites and cell bodies in control neurons. For neurons treated with Ab, His-tag and APP immunoreactivity were significantly enhanced both in cell bodies and neurites. His-tag staining showed that APP18-286His was especially confluent in injured neurites as indicated by arrowheads (Fig. 6A). However, it should be noted that the neurons with apparently condensed nucleus appeared with less His-tag immunoreactivity. These results indicated that exogenous APP18-286 could interact with neuron; furthermore, Ab treatment could induce the aggregation of APP18-286 at cell bodies and also the degenerating neurites. To further confirm the inductive effect of Ab on the

distribution of APP18-286-His, we then explored the level of APP18-286His in cell lysis. Results showed an increased level of APP18-286-His in Ab-treated neuron (Fig. 6B and C), which was consistent with the increase expression of DR6 (Fig. 6B and D). These results indicated that Ab promote the N-APPs targeting to neurons through increasing the expression of DR6. 3.7. Knockdown of DR6 reduced the interaction of N-APP with neuron and inhibited apoptosis protein activation Primary cultured neurons were infected with lentivirus carrying DR6 interference RNA (RNAi) or a scrambled control sequence and then were treated with or without 25 mM Ab followed by incubating with 5 mg/mL APP18-286-His fragment for 4 hours. Immunoblotting results showed that downregulation of DR6 expression could significantly decrease the level of APP18-286-His in neuron (Fig. 7A and B). Moreover, DR6 RNAi could also suppress the increase of APP18-286-His in neurons induced by Ab treatment. Besides, consistent with the Western blotting results, immunostaining results using anti-His-tag antibody also showed the decrease in immunoreactivity of APP18-286 on neurons. As shown in Fig. 7C, in Ab-treated neurons, APP18-286-His was distributed not only in cell bodies but also in degenerative neurites which appeared as aggregated-like structures (arrows). However, in DR6 RNAi neurons, the immunostaining for His-tagged APP18-286 was mainly distributed at cell bodies but less in neurites of which MAP2 immunostainning was positive (arrowheads). Together, these data revealed that knockdown of DR6 could inhibit the interaction of NAPPs with neuron.

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

165

Fig. 6. Ab affected the distribution of His-tagged APP18-286 in primary cultured neurons. Primary cultured neurons were treated with or without 25 mM Ab1-42 for 12 hours and then incubated with 5 mg/mL His-tagged APP18-286 fragment for additional 4 hours. Cells were immunostained with anti c-termial region of APP (red) and His-tag (green) antibodies and counterstained with DAPI (blue) for nuclei to elucidate the effect of Ab1-42 on the distribution of APP18-286 and also the endogenous APP in neurons. A showed the Ab-induced aberrant accumulation of His-tagged APP18-286 fragment on abnormal neurites (indicated by arrows) compared with the uniformly punctate distribution of APP on cell bodies and neurites (indicated by arrowheads) in control group. In addition, levels of His-tagged APP18-286 (B and C) and DR6 (B and D) in cell lysis were analyzed by immunoblots. ## p < 0.01 compared with the cells without Ab treatment. Abbreviations: Ab, beta amyloid; APP, amyloid precursor protein. (For interpretation of the references to color in this figure, the reader is referred to the web version of this article.)

To further elucidate the effect of DR6 downregulation on Ab/APPinduced apoptosis pathway activation, we examined the expression and activation of apoptotic proteins in cultured neurons. In DR6 RNAi condition, immunoblotting showed that Ab treatment alone for 12 hours could still significantly induce the activation of caspase-3 (Fig. 7D and E) and caspase-6 (Fig. 7D and F), as well as the increase expression of Bax (Fig. 7D and G) and decrease expression of Bcl-2 (Fig. 7D and H). Moreover, compared with treatment with Ab alone, cotreatment with Ab and APP18-286 on DR6 RNAi neurons for 12 hours could not accelerate Ab-induced neuronal injury but inversely attenuated the activation of caspase-3 and 6 and promoted the expression of Bcl-2. These results further indicated that upregulation of DR6 was necessary for N-APPs fragment to promote Abinduced neuronal injuries. With DR6 knockdown, the toxic effect of N-APPs on Ab-induced cell injury could be significantly inhibited and N-APPs fragment itself could even exert some protective effect. 4. Discussion Although plaques formation containing Ab are considered to be an important event in the development of AD, and Ab is believed to cause neuronal dysfunction and neuronal degeneration (Busciglio et al., 1992; Yankner et al., 1990). The mechanisms of AD pathogenesis still remain unclear. DR6 is a member of the TNFR superfamily (Bossen et al., 2006; Pan et al., 1998). Overexpression of DR6 in some cell lines leads to activation of caspase-3 and NF-kB and stress kinases of the JNK/SAPK family (Bridgham et al., 2001; Eimon et al., 2006; Kasof and Gomes, 2001; Kasof et al., 2001; Pan et al., 1998). Recently, DR6/N-APP pathway has been supposed in AD neuropathologic mechanism, for the N-terminal fragment of AD-related protein APP has been found to be a ligand for DR6 receptor (Nikolaev et al., 2009), which

could be upregulated in AD (Hu et al., 2013). On the other hand, DR6 gene maps to chromosome 6p12.2-21.1, where it is near a putative AD susceptibility locus (Bertram and Tanzi, 2004); the distribution of DR6 mRNA in adult brain correlates in an intriguing way with known sites of dysfunction in AD (Nikolaev et al., 2009). Therefore, it is of fundamental importance to elucidate the expression of DR6 in AD and also to explore the role of DR6 in AD pathogenesis. In this study, our results showed an increased expression of DR6 in primary cultured neurons after Ab treatment and in the brain of AD transgenic mice which indicated that DR6 might participate in Ab-induced neuronal injuries. This effect might be related to NF-kB signaling for Ab is able to activate NF-kB (Ghribi et al., 2001; Kuner et al., 1998), and NF-kB then further induces DR6 expression (Kasof et al., 2001). Upregulated DR6 expression was also found in neurons during program cell death in 3 apoptosis model of cultured cerebellum neuron (Chiang et al., 2001). Therefore, upregulation of DR6 might be a step at least in some type of neuronal death. In this study, the cells with significant nuclei condensation were less DR6 immunopositive (Fig. 1), implying that the increase in expression of DR6 might be a relative early event in neuronal death. In addition, the pathologic roles of upregulation of DR6 in glia cell and DR6 deposition in Ab plaques in aged APP/PS1 mice were still unknown. Although the DR6/NAPP (Nikolaev et al., 2009) and DR6/p75 (Hu et al., 2013) systems were considered in AD pathologic mechanism, APP transgenic models with genetic deletion of DR6 did not improve cognitive behavioral deficits and did not alter the formation of amyloid plaques and gliosis (Kallop et al., 2014). Therefore, the pathologic identities and characteristics between transgenic AD mice and AD patients still need to be studied further. APP, a type I transmembrane protein, undergoes regulated cleavage and shedding. An increasing number of reports suggests

166

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

Fig. 7. The effects of DR6 knockdown on the apoptosis activation induced by cotreatment with Ab/APP18-286 fragment. Primary cultured neurons with or without infection of DR6 lentivirus were treated with 25 mM Ab1-42 for 12 hours. Cells were then incubated with 5 mg/mL His-tagged APP18-286 fragment, and cell lysis was analyzed with anti-His antibody to reveal the targeting of APP18-286-His to neuron (A and B). C showed the immunostaining of His-tagged APP18-286 (red), MAP-2 (green), and DAPI (blue) in control and DR6 knockdown neurons after Ab1-42 treatment. Arrows indicated the His-tagged APP18-286 aggregation in abnormal neurites with less MAP2 staining. Arrowheads indicated the week distribution of APP18-286-His on normal neurites of DR6 knockdown neuron. In addition, the effects of 25 mM Ab, 5 mg/mL APP18-286 fragment, and Ab/APP18-286 cotreatment on apoptosis under DR6 knockdown conditions in primary cultured neurons were analyzed by detecting the level of active caspase-3 (D and E), active caspase-6 (D and F), Bax (D and G), and Bcl-2 (D and H). Results were mean  SEM. * p < 0.05 and ** p < 0.01 compared with normal control group. # p < 0.05 compared with group treated with Ab only. Abbreviations: Ab, beta amyloid; APP, amyloid precursor protein; DR6, death receptor 6; SEM, standard error of the mean. (For interpretation of the references to color in this figure, the reader is referred to the web version of this article.)

that APP controls various cellular activities (Turner et al., 2003). Of note, previous studies have shown that the immunoreactivity for the APP N-terminus was associated with Alzheimer’s plaques (Van Gool et al., 1995), which suggests a direct link between APP and pathologic change in AD. In addition, BACE cleavage of APP was related to neurodegeneration (Matrone et al., 2008a, 2008b) and is essential for generation of shorter N-terminal APP fragments which subsequently act as ligands of DR6 (Nikolaev et al., 2009; Vohra et al., 2010). Furthermore, a slightly elevated level of N-APP fragments has been detected in cerebrospinal fluid of AD (Portelius et al., 2010), which may be the result of the increase of BACE activity in AD brain (Ewers et al., 2008; Li et al., 2004). In this study, Ab treatment could slightly increase the N-APP fragments in neuronal culture media. Meanwhile, the higher molecular weight secreted APPs (sAPP) were decreased in neuronal culture media after Ab treatment, which had been reported by other studies (Mok et al., 2000). Because sAPP is highly stable in culture media (Guo et al., 2012), the decrease of sAPP in neuronal culture media after Ab treatment might be because of the decrease of sAPP releasing or

being uptaken by neurons. The degradation of sAPP might occur intracellularly and then release N-APP fragments through exocytosis process. On the other hand, the astrocyte might also be involved in degradation of sAPP, because conditioned media from neuronal culture treated with astrocyte induced a decrease of sAPP when detecting with antibody 22C11. These results preliminarily indicated that Ab treatment could mildly enhance N-APP fragments releasing by neurons. To explore whether N-APP fragments could participate in Abinduced cell injuries, we prepared recombinant N-APP terminal protein which includes the 18-286 amino acids of APP deletion the N-terminal signal peptide of APP with 17 amino acids (Lichtenthaler et al., 1999). As the DR6/N-APP pathway in neurodegeneration has already been defined (Nikolaev et al., 2009), this provided a basis to examine whether DR6/N-APP is related to the Ab-induced neuronal degeneration. In this experiment, we detected the activation of caspase-3 and 6, the expressions of Bcl2 and Bax in our experiment model. The results indicated that N-APP treatment could enhance Ab induced neurotoxicity.

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

DR6 overexpression could trigger ligand-independent effects (Kasof et al., 2001), to further confirm the role of DR6 in Ab/N-APPinduced neuronal injury, we used extracellular fragment of DR641341 to neutralize APP18-286 fragment and also exployed DR6 antibody to block neuronal cell surface DR6 (Nikolaev et al., 2009). Our results showed that both treatments could inhibit the Ab/N-APPinduced activation of caspase-3, 6, and inhibit the upregulation expression of Bax and the downregulation expression of Bcl-2 as expected. Moreover, DR641-341 also decreased the toxicity of Ab alone. These results implied that the endogenous N-APP fragment might play roles in the mechanism of Ab toxicity; furthermore, the toxic effect of N-APP could be attenuated by exogenous DR6 fragment via neutralizing the release of N-APP. DR6-N-APP interaction has been revealed by biochemical and computational analysis (Nikolaev et al., 2009; Ponomarev and Audie, 2011). However, a recent study found monomer N-APP could not bind with DR6 (Olsen et al., 2014). Interestingly, the analysis with the crystal structure of DR6 has revealed a potential binding mode for APP and DR6 that 2 DR6 molecules bind 2 APP molecules (Kuester et al., 2011), and the structure and biochemical analysis of APP-E1 domain predicted the N-APP based signal transduction should depend on its dimerization (Dahms et al., 2010). In fact, the storage of N-APP would increase the N-APP dimerization in our experience. The ELISA based assay with Hill analysis showed that h valve is greater than 1.0, inferring that the interaction model of DR6-N-APP is not a simple monomer binding. In this study, we found that APP18-286 could not only bind with DR641-341 fragment, the extracellular domain of DR6, but also bind with endogenous DR6. Ab treatment could induce the increase interaction of APP18-286 with neuron. Moreover, downregulation of DR6 expression could significantly suppress this interaction and also abrogated the Ab dependent toxic effect of N-APP. These results further indicated that upregulation of DR6 is important for N-APP to promote Ab-induced neuronal injuries. Interestingly, there was still a substantial amount of APP18-286 interacting with neuron when DR6 expression was dramatically suppressed. Therefore, there should be other targets on neuronal surface for N-APP to interact with which is needed to be further confirmed. Besides, knock down of DR6 could not eliminate the toxic effect of Ab which indicated Ab containing other DR6-independent toxic effects on neurons. In summary, our studies demonstrated that DR6 play an essential role in the regulation of neuronal survival through a mechanism with N-APP involved. Furthermore, Ab could affect DR6/N-APP pathway by enhancing the expression of DR6. The interference of DR6/N-APP pathway in promoting cell survival may represent a potential approach for the treatment of AD. Disclosure statement All authors disclose no actual or potential conflicts of interest. Acknowledgements This work was supported by National Natural Science Foundation of China, China (grants 81200974, 81071017). Project was also supported by the Shanghai Foundation for Development of Science and Technology, China (Grant No. 10DZ1976000). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.neurobiolaging. 2014.07.027.

167

References Baud, V., Karin, M., 2001. Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol. 11, 372e377. Bauer, P.O., Wong, H.K., Oyama, F., Goswami, A., Okuno, M., Kino, Y., Miyazaki, H., Nukina, N., 2009. Inhibition of Rho kinases enhances the degradation of mutant huntingtin. J. Biol. Chem. 284, 13153e13164. Bertram, L., Tanzi, R.E., 2004. Alzheimer’s disease: one disorder, too many genes? Hum. Mol. Genet. 13 Spec No 1, R135eR141. Bossen, C., Ingold, K., Tardivel, A., Bodmer, J.L., Gaide, O., Hertig, S., Ambrose, C., Tschopp, J., Schneider, P., 2006. Interactions of tumor necrosis factor (TNF) and TNF receptor family members in the mouse and human. J. Biol. Chem. 281, 13964e13971. Bridgham, J.T., Bobe, J., Goetz, F.W., Johnson, A.L., 2001. Conservation of death receptor-6 in avian and piscine vertebrates. Biochem. Biophys. Res. Commun. 284, 1109e1115. Busciglio, J., Lorenzo, A., Yankner, B.A., 1992. Methodological variables in the assessment of beta amyloid neurotoxicity. Neurobiol. Aging 13, 609e612. Cheng, L.E., Ohlen, C., Nelson, B.H., Greenberg, P.D., 2002. Enhanced signaling through the IL-2 receptor in CD8(þ) T cells regulated by antigen recognition results in preferential proliferation and expansion of responding CD8(þ) T cells rather than promotion of cell death. Proc. Natl. Acad. Sci. U.S.A 99, 3001e3006. Chiang, L.W., Grenier, J.M., Ettwiller, L., Jenkins, L.P., Ficenec, D., Martin, J., Jin, F., DiStefano, P.S., Wood, A., 2001. An orchestrated gene expression component of neuronal programmed cell death revealed by cDNA array analysis. Proc. Natl. Acad. Sci. U.S.A 98, 2814e2819. Dahms, S.O., Hoefgen, S., Roeser, D., Schlott, B., Guhrs, K.H., Than, M.E., 2010. Structure and biochemical analysis of the heparin-induced E1 dimer of the amyloid precursor protein. Proc. Natl. Acad. Sci. U.S.A 107, 5381e5386. Eimon, P.M., Kratz, E., Varfolomeev, E., Hymowitz, S.G., Stern, H., Zha, J., Ashkenazi, A., 2006. Delineation of the cell-extrinsic apoptosis pathway in the zebrafish. Cell Death Differ. 13, 1619e1630. Ewers, M., Zhong, Z., Burger, K., Wallin, A., Blennow, K., Teipel, S.J., Shen, Y., Hampel, H., 2008. Increased CSF-BACE 1 activity is associated with ApoEepsilon 4 genotype in subjects with mild cognitive impairment and Alzheimer’s disease. Brain 131 (Pt 5), 1252e1258. Feng, Z., Zhang, J.T., 2004. Melatonin reduces amyloid beta-induced apoptosis in pheochromocytoma (PC12) cells. J. Pineal Res. 37, 257e266. Ghribi, O., Herman, M.M., DeWitt, D.A., Forbes, M.S., Savory, J., 2001. Abeta(1-42) and aluminum induce stress in the endoplasmic reticulum in rabbit hippocampus, involving nuclear translocation of gadd 153 and NF-kappaB. Brain Res. Mol. Brain Res. 96, 30e38. Guo, Q., Li, H., Gaddam, S.S., Justice, N.J., Robertson, C.S., Zheng, H., 2012. Amyloid precursor protein revisited: neuron-specific expression and highly stable nature of soluble derivatives. J. Biol. Chem. 287, 2437e2445. Hardy, J., Selkoe, D., 2002. The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science 297, 353e356. Heredia, L., Lin, R., Vigo, F.S., Kedikian, G., Busciglio, J., Lorenzo, A., 2004. Deposition of amyloid fibrils promotes cell-surface accumulation of amyloid beta precursor protein. Neurobiol. Dis. 16, 617e629. Hu, Y., Lee, X., Shao, Z., Apicco, D., Huang, G., Gong, B.J., Pepinsky, R.B., Mi, S., 2013. A DR6/p75(NTR) complex is responsible for beta-amyloid-induced cortical neuron death. Cell Death Dis. 4, e579. Kaech, S., Banker, G., 2006. Culturing hippocampal neurons. Nat. Protoc.1, 2406e2415. Kallop, D.Y., Meilandt, W.J., Gogineni, A., Easley-Neal, C., Wu, T., Jubb, A.M., Yaylaoglu, M., Shamloo, M., Tessier-Lavigne, M., Scearce-Levie, K., Weimer, R.M., 2014. A death receptor 6-amyloid precursor protein pathway regulates synapse density in the mature CNS but does not contribute to Alzheimer’s diseaserelated pathophysiology in murine models. J. Neurosci. 34, 6425e6437. Kasof, G.M., Gomes, B.C., 2001. Livin, a novel inhibitor of apoptosis protein family member. J. Biol. Chem. 276, 3238e3246. Kasof, G.M., Lu, J.J., Liu, D., Speer, B., Mongan, K.N., Gomes, B.C., Lorenzi, M.V., 2001. Tumor necrosis factor-alpha induces the expression of DR6, a member of the TNF receptor family, through activation of NF-kappaB. Oncogene 20, 7965e7975. Kuester, M., Kemmerzehl, S., Dahms, S.O., Roeser, D., Than, M.E., 2011. The crystal structure of death receptor 6 (DR6): a potential receptor of the amyloid precursor protein (APP). J. Mol. Biol. 409, 189e201. Kuner, P., Schubenel, R., Hertel, C., 1998. Beta-amyloid binds to p57NTR and activates NFkappaB in human neuroblastoma cells. J. Neurosci. Res. 54, 798e804. Kutner, R.H., Zhang, X.Y., Reiser, J., 2009. Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nat. Protoc. 4, 495e505. Lavrik, I., Golks, A., Krammer, P.H., 2005. Death receptor signaling. J. Cell Sci. 118 (Pt 2), 265e267. Li, R., Lindholm, K., Yang, L.B., Yue, X., Citron, M., Yan, R., Beach, T., Sue, L., Sabbagh, M., Cai, H., Wong, P., Price, D., Shen, Y., 2004. Amyloid beta peptide load is correlated with increased beta-secretase activity in sporadic Alzheimer’s disease patients. Proc. Natl. Acad. Sci. U.S.A 101, 3632e3637. Lichtenthaler, S.F., Multhaup, G., Masters, C.L., Beyreuther, K., 1999. A novel substrate for analyzing Alzheimer’s disease gamma-secretase. FEBS Lett. 453, 288e292. Masumura, M., Hata, R., Nishimura, I., Uetsuki, T., Sawada, T., Yoshikawa, K., 2000. Caspase-3 activation and inflammatory responses in rat hippocampus inoculated with a recombinant adenovirus expressing the Alzheimer amyloid precursor protein. Brain Res. Mol. Brain Res. 80, 219e227.

168

Y. Xu et al. / Neurobiology of Aging 36 (2015) 157e168

Matrone, C., Ciotti, M.T., Mercanti, D., Marolda, R., Calissano, P., 2008a. NGF and BDNF signaling control amyloidogenic route and Abeta production in hippocampal neurons. Proc. Natl. Acad. Sci. U.S.A 105, 13139e13144. Matrone, C., Di Luzio, A., Meli, G., D’Aguanno, S., Severini, C., Ciotti, M.T., Cattaneo, A., Calissano, P., 2008b. Activation of the amyloidogenic route by NGF deprivation induces apoptotic death in PC12 cells. J. Alzheimers Dis. 13, 81e96. Mi, S., Lee, X.H., Hu, Y.H., Ji, B.X., Shao, Z.H., Yang, W.X., Huang, G.R., Walus, L., Rhodes, K., Gong, B.J., Miller, R.H., Pepinsky, R.B., 2011. Death receptor 6 negatively regulates oligodendrocyte survival, maturation and myelination. Nat. Med. 17, 816e821. Mok, S.S., Clippingdale, A.B., Beyreuther, K., Masters, C.L., Barrow, C.J., Small, D.H., 2000. A beta peptides and calcium influence secretion of the amyloid protein precursor from chick sympathetic neurons in culture. J. Neurosci. Res. 61, 449e457. Nagata, S., 1997. Apoptosis by death factor. Cell 88, 355e365. Nikolaev, A., McLaughlin, T., O’Leary, D., Tessier-Lavigne, M., 2009. APP binds DR6 to trigger axon pruning and neuron death via distinct caspases. Nature 457, 981e989. Nishimura, I., Uetsuki, T., Dani, S.U., Ohsawa, Y., Saito, I., Okamura, H., Uchiyama, Y., Yoshikawa, K., 1998. Degeneration in vivo of rat hippocampal neurons by wildtype Alzheimer amyloid precursor protein overexpressed by adenovirusmediated gene transfer. J. Neurosci. 18, 2387e2398. Olsen, O., Kallop, D.Y., McLaughlin, T., Huntwork-Rodriguez, S., Wu, Z., Duggan, C.D., Simon, D.J., Lu, Y., Easley-Neal, C., Takeda, K., Hass, P.E., Jaworski, A., O’Leary, D.D., Weimer, R.M., Tessier-Lavigne, M., 2014. Genetic analysis reveals that amyloid precursor protein and death receptor 6 function in the same pathway to control axonal pruning independent of beta-secretase. J. Neurosci. 34, 6438e6447. Pan, G., Bauer, J.H., Haridas, V., Wang, S., Liu, D., Yu, G., Vincenz, C., Aggarwal, B.B., Ni, J., Dixit, V.M., 1998. Identification and functional characterization of DR6, a novel death domain-containing TNF receptor. FEBS Lett. 431, 351e356.

Ponomarev, S.Y., Audie, J., 2011. Computational prediction and analysis of the DR6NAPP interaction. Proteins 79, 1376e1395. Portelius, E., Brinkmalm, G., Tran, A., Andreasson, U., Zetterberg, H., WestmanBrinkmalm, A., Blennow, K., Ohrfelt, A., 2010. Identification of novel N-terminal fragments of amyloid precursor protein in cerebrospinal fluid. Exp. Neurol. 223, 351e358. Roch, J.M., Masliah, E., Roch-Levecq, A.C., Sundsmo, M.P., Otero, D.A., Veinbergs, I., Saitoh, T., 1994. Increase of synaptic density and memory retention by a peptide representing the trophic domain of the amyloid beta/A4 protein precursor. Proc. Natl. Acad. Sci. U.S.A 91, 7450e7454. Siegel, R.M., 2006. Caspases at the crossroads of immune-cell life and death. Nat. Rev. Immunol. 6, 308e317. Turner, P.R., O’Connor, K., Tate, W.P., Abraham, W.C., 2003. Roles of amyloid precursor protein and its fragments in regulating neural activity, plasticity and memory. Prog. Neurobiol. 70, 1e32. Van Gool, D., De Strooper, B., Van Leuven, F., Dom, R., 1995. Amyloid precursor protein accumulation in Lewy body dementia and Alzheimer’s disease. Dementia 6, 63e68. Vohra, B.P., Sasaki, Y., Miller, B.R., Chang, J., DiAntonio, A., Milbrandt, J., 2010. Amyloid precursor protein cleavage-dependent and -independent axonal degeneration programs share a common nicotinamide mononucleotide adenylyltransferase 1-sensitive pathway. J. Neurosci. 30, 13729e13738. Wajant, H., Pfizenmaier, K., Scheurich, P., 2003. Tumor necrosis factor signaling. Cell Death Differ. 10, 45e65. Xing, S.L., Chen, B., Shen, D.Z., Zhu, C.Q., 2012. b-amyloid peptide binds and regulates ectopic ATP synthase alpha-chain on neural surface. Int. J. Neurosci. 122, 290e297. Yankner, B.A., Duffy, L.K., Kirschner, D.A., 1990. Neurotrophic and neurotoxic effects of amyloid beta protein: reversal by tachykinin neuropeptides. Science 250, 279e282.